Plant Physiol. Tips for Better Browsing
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


First published online June 1, 2004; 10.1104/pp.104.040519

Plant Physiology 135:989-999 (2004)
© 2004 American Society of Plant Biologists

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
135/2/989    most recent
pp.104.040519v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Web of Science (5)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by LeClere, S.
Right arrow Articles by Bartel, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by LeClere, S.
Right arrow Articles by Bartel, B.
Agricola
Right arrow Articles by LeClere, S.
Right arrow Articles by Bartel, B.
DEVELOPMENT AND HORMONE ACTION

IAR4, a Gene Required for Auxin Conjugate Sensitivity in Arabidopsis, Encodes a Pyruvate Dehydrogenase E1{alpha} Homolog1

Sherry LeClere2, Rebekah A. Rampey and Bonnie Bartel*

Department of Biochemistry and Cell Biology, Rice University, Houston, Texas, 77005


    ABSTRACT
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 
The formation and hydrolysis of indole-3-acetic acid (IAA) conjugates represent a potentially important means for plants to regulate IAA levels and thereby auxin responses. The identification and characterization of mutants defective in these processes is advancing the understanding of auxin regulation and response. Here we report the isolation and characterization of the Arabidopsis iar4 mutant, which has reduced sensitivity to several IAA-amino acid conjugates. iar4 is less sensitive to a synthetic auxin and low concentrations of an ethylene precursor but responds to free IAA and other hormones tested similarly to wild type. The gene defective in iar4 encodes a homolog of the E1{alpha}-subunit of mitochondrial pyruvate dehydrogenase, which converts pyruvate to acetyl-coenzyme A. We did not detect glycolysis or Krebs-cycle-related defects in the iar4 mutant, and a T-DNA insertion in the IAR4 coding sequence conferred similar phenotypes as the originally identified missense allele. In contrast, we found that disruption of the previously described mitochondrial pyruvate dehydrogenase E1{alpha}-subunit does not alter IAA-Ala responsiveness or confer any obvious phenotypes. It is possible that IAR4 acts in the conversion of indole-3-pyruvate to indole-3-acetyl-coenzyme A, which is a potential precursor of IAA and IAA conjugates.


Auxins affect virtually every aspect of plant development, including phototropism, gravitropism, cell expansion, apical dominance, root growth, fruit development, vascular development, and senescence (Davies, 1995Go). By understanding how plants regulate levels of free indole-3-acetic acid (IAA), the active form of the most abundant naturally occurring auxin, we can gain insight into how plants develop and respond to environmental stimuli.

The IAA in Arabidopsis is found in three basic forms. The free acid is the active form of IAA but constitutes only a small fraction of the total IAA in Arabidopsis. The majority of IAA is found conjugated to peptides or amino acids via amide linkages or to sugars via ester linkages (Bartel et al., 2001Go; Ljung et al., 2002Go). This high proportion of conjugates suggests that auxin homeostasis may be regulated through formation and hydrolysis of conjugates in addition to regulation through de novo synthesis, transport, degradation, and interconversion between IAA and indole-3-butyric acid (Bartel et al., 2001Go; Ljung et al., 2002Go). IAA conjugates may function as storage, inactivation, or transport forms of IAA (Hangarter et al., 1980Go; Nowacki and Bandurski, 1980Go; Slovin, 1997Go) and some conjugates may have roles independent of hydrolysis (Hangarter et al., 1980Go; Magnus et al., 1992aGo).

The amide conjugates IAA-Asp, IAA-Glu, IAA-Ala, and IAA-Leu have been identified in Arabidopsis seedlings (Tam et al., 2000Go; Kowalczyk and Sandberg, 2001Go), and an IAA-peptide is abundant in Arabidopsis seeds (Walz et al., 2002Go). Certain endogenous IAA conjugates can elicit auxin responses in bioassays (Hangarter et al., 1980Go; Hangarter and Good, 1981Go; Bialek et al., 1983Go; Magnus et al., 1992bGo; Davies et al., 1999Go; LeClere et al., 2002Go), and conjugate activity often correlates with hydrolysis (Bialek et al., 1983Go; LeClere et al., 2002Go). For example, many IAA-amino acid conjugates inhibit Arabidopsis root elongation like IAA, and this bioactivity correlates with in vitro hydrolysis by heterologously expressed amidohydrolases (LeClere et al., 2002Go).

To enhance our understanding of the function and regulation of auxin conjugates, we have conducted screens for mutants that remain sensitive to free IAA but have reduced sensitivity to IAA conjugates. If conjugates are IAA precursors, then these conjugate resistant mutants may identify genes necessary for conjugate hydrolysis or uptake. If conjugates have additional roles, it also may be possible to genetically separate conjugate functions from those of IAA. The analysis of IAA-conjugate resistant mutants to date suggests that IAA conjugates with auxin activity act via their hydrolysis to release free IAA. Reported IAA-conjugate resistant mutants are defective in genes encoding IAA-conjugate hydrolases (ilr1; Bartel and Fink, 1995Go; and iar3; Davies et al., 1999Go) or genes predicted to affect the transport of cofactors necessary for this hydrolysis (iar1 and ilr2; Lasswell et al., 2000Go; Magidin et al., 2003Go). In this work we describe the isolation and characterization of a new IAA-conjugate-resistant mutant, iar4. The gene defective in this mutant encodes a homolog of the mitochondrial pyruvate dehydrogenase (PDH) E1{alpha}-subunit.


    RESULTS
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 

Isolation and Characterization of the iar4 Mutant

The ability of certain IAA-amino acids to inhibit Arabidopsis root elongation provides a convenient bioassay to screen for mutants disrupted in conjugate perception (Bartel and Fink, 1995Go; Davies et al., 1999Go; Lasswell et al., 2000Go; Magidin et al., 2003Go). We isolated iar4-1 from ethylmethane sulfonate mutagenized Arabidopsis as an individual less sensitive than wild type to root elongation inhibition by IAA-Ala. The IAA-Ala resistance of iar4-1 is recessive (data not shown), suggesting that it is a loss-of-function allele. To explore the specificity of the iar4 conjugate response defects, we assayed iar4 root elongation on several conjugates. iar4-1 is resistant to IAA-Ala and is slightly resistant to IAA-Gly, IAA-Leu, IAA-Met, and IAA-Phe. In contrast, iar4-1 responds like wild type to the inhibitory effects of IAA-Glu, IAA-Asn, IAA-Gln, and IAA-Tyr on root elongation (Fig. 1).



View larger version (23K):
[in this window]
[in a new window]
 
Figure 1. iar4-1 root elongation on IAA conjugates. Bars represent mean root lengths of 8-d-old seedlings grown on the indicated concentration of conjugate. Error bars represent SDs of the means (n = 10–12).

 
We tested the iar4 response to several auxins and other phytohormones to explore the specificity of IAR4 in auxin metabolism or signaling. Because iar4-1 has a short root on unsupplemented media (Fig. 1), we compared root growth of iar4 to wild type over a range of hormone concentrations to gain a clearer picture of the ability of iar4 to perceive and respond to these compounds. To examine whether iar4 is defective in auxin responses in general, the endogenous auxins IAA and indole-3-butyric acid and the synthetic auxins 2,4-dichlorophenoxyacetic acid (2,4-D) and 1-naphthaleneacetic acid were tested. iar4 is less sensitive than wild type to the inhibition of root elongation caused by certain concentrations of 2,4-D. In contrast, iar4 responds more similarly to wild type to IAA, indole-3-butyric acid, and naphthaleneacetic acid. However, the fact that iar4 has a short root on unsupplemented medium may be obscuring any slight reduction in sensitivity to these other auxins (Fig. 2, A–D).



View larger version (26K):
[in this window]
[in a new window]
 
Figure 2. iar4-1 root elongation on auxins and other hormones. A–F, Mean root lengths of 8-d-old seedlings grown on the indicated concentration of hormone. G, Seedlings were grown for 4 d on unsupplemented medium then transferred to medium containing the indicated concentration of ABA for another 4 d, and root lengths after transfer were measured. H, Mean root lengths of 9-d-old seedlings grown on the indicated concentration of ACC. Error bars represent SDs of the means (n = 12).

 
We also tested other phytohormones and found that iar4-1 roots respond similarly to wild type to the inhibitory effects of abscisic acid (ABA), the cytokinin benzyladenine, and the brassinosteroid brassinolide but may be slightly resistant to the ethylene precursor 1-aminocyclopropane-1-carboxylic acid (ACC; Fig. 2, E–H). Dark-grown iar4-1 hypocotyl elongation, however, is inhibited normally by higher concentrations of ACC (data not shown), unlike some of the previously characterized ethylene-resistant mutants (Roman et al., 1995Go). We conclude that IAR4 is unlikely to be involved in general hormone responses but seems to be defective in an auxin-related process.

Many plants hydrolyze conjugates during germination, and this hydrolysis is thought to supply developing seedlings with IAA (Epstein et al., 1980Go; Bialek and Cohen, 1992Go; Ljung et al., 2001Go; Rampey et al., 2004Go). Because iar4-1 is resistant to IAA-Ala, and because 8-d-old iar4-1 seedlings have shorter roots than wild type on unsupplemented medium, we examined iar4-1 germination rates. As shown in Figure 3A, the mutant germinates at the same time as wild type, and the iar4-1 defect in root elongation is not a reflection of delayed germination but persists throughout early development. The resistance to IAA-Ala is also seen throughout early development and is not the result of faster germination on the conjugate-containing medium.



View larger version (25K):
[in this window]
[in a new window]
 
Figure 3. iar4-1 root growth at 22°C versus 28°C. A, Seedlings were grown on vertical plates either lacking hormone or containing 40 µM IAA-Ala. Error bars represent SDs of the mean root lengths (n = 12). B, Seedlings were grown under white light on vertical plates lacking hormone at either 22°C or 28°C. Error bars are SDs of the mean root lengths (n = 12). C, Seedlings were grown under either white light or yellow long-pass filters or in darkness in the presence or absence of 15 mM Suc at 22°C or 28°C. Error bars represent SDs of the mean root lengths of 8-d-old seedlings (n = 12). D, For all hormones except ABA, seedlings were grown at 28°C for 8 d on the indicated concentration of each hormone. For ABA, 4-d-old seedlings were transferred to ABA and root growth 4 d after transfer was measured. Error bars represent SDs of the mean root lengths (n = 12).

 
Growth of Arabidopsis seedlings at high temperature (28°C) increases endogenous IAA levels (Gray et al., 1998Go) and can increase hypocotyl (Gray et al., 1998Go) and root elongation (Rogg et al., 2001Go). As shown in Figure 3, B and C, the difference between wild-type and iar4-1 root length on hormone-free medium is reduced in seedlings grown at 28°C in the light compared to those grown at 22°C, regardless of whether the medium is supplemented with Suc. This finding is consistent with the iar4 defect resulting from decreased endogenous auxin concentrations or a change in auxin sensitivity. However, the short root phenotype is not rescued at 22°C by growth under yellow filters (Fig. 3C), which slows the breakdown of indolic compounds (Stasinopoulos and Hangarter, 1990Go).

To explore whether iar4-1 might be a temperature sensitive allele and to clarify the results at 22°C that were complicated by the short root on unsupplemented medium, we measured the sensitivity of wild type and iar4 to several hormones at 28°C. Like at 22°C, we found that iar4 remains less sensitive than wild type to root inhibition by IAA-Ala and 2,4-D at 28°C and responds like wild type to other hormones tested (Fig. 3D).


IAR4 Encodes a PDH E1{alpha} Homolog

We identified the gene defective in iar4-1 using a map-based positional cloning strategy. By analysis of recombination events in an F2 outcrossed population using PCR-based markers (Table I; Bell and Ecker, 1994Go), we mapped IAR4 to a 45-kb region 35 cM from the top of chromosome 1 between the markers F3I6.8 and F3I6.17 (Fig. 4A). We sequenced the coding regions of the predicted genes in this interval and identified a single base change, a C-to-T substitution in the coding region of At1g24180 (F3I6.11). A C-to-T base change is consistent with an ethylmethane sulfonate-induced mutation and converts a conserved Arg residue at position 121 to a Cys. To confirm that the mutation we identified in At1g24180 is responsible for the iar4 mutant phenotype, we transformed the mutant with a genomic construct expressing the wild-type version of the gene from its own 5' and 3' regulatory sequences (see "Materials and Methods"). As shown in Figure 4B, this construct restores IAA-Ala sensitivity and normal root elongation to iar4-1, indicating that we have identified the IAR4 gene.


View this table:
[in this window]
[in a new window]
 
Table I. Markers used in the positional cloning of IAR4

 


View larger version (37K):
[in this window]
[in a new window]
 
Figure 4. Identification of the IAR4 gene. A, Positional cloning of IAR4. IAR4 was mapped to a region on chromosome 1 (thick line) between markers F3I6-8&9 and F21J9-12&4 (Table I) on BACs F3I6 and F21J9. The name of each DNA marker is shown above the line, and the number of recombinants/the number of chromosomes scored is shown below. Open reading frames within this region are shown below the BACs, with exons illustrated as boxes, introns indicated as lines, and direction of transcription denoted by an arrowhead at the end of the last exon. The positions of the iar4 alleles are shown. B, Rescue of the iar4 phenotype. Wild type (Ws), iar4-1, and T3 progeny of iar4-1 homozygous for a genomic IAR4 T-DNA construct (pBENEE-IAR4) were grown on medium containing either no hormone or 40 µM IAA-Ala for 8 d. Error bars represent SDs of the mean root lengths (n = 12). C, The T-DNA insertion mutant iar4-2 allele is also resistant to IAA-Ala, but the T-DNA insertion at1g59900-1 allele displays wild-type IAA-Ala sensitivity. Seedlings were grown at 22°C on plates containing no hormone or at 22°C on plates containing the indicated concentration of IAA, 2,4-D, or IAA-Ala. Bars represent mean root lengths of 12 individuals and error bars are SDs of the means. iar4-1 is in the Ws background, and iar4-2 and at1g59900-1 (SALK_074384) are in the Col-0 background.

 
To determine whether the missense mutation identified in iar4-1 was likely to confer a complete loss of function, we identified a second iar4 allele from the Salk Institute Genomic Analysis Laboratory collection (Alonso et al., 2003Go). The iar4-2 allele (SALK_011308) contains a T-DNA insertion in the second intron of IAR4 (Fig. 4A) and is likely to be a null allele. Like iar4-1, iar4-2 is resistant to the inhibitory effects of IAA-Ala on root elongation (Fig. 4C). Unlike the iar4-1 allele in the Wassilewskija (Ws) accession, the iar4-2 allele in the Columbia (Col-0) accession is not significantly defective in root elongation on unsupplemented medium (Fig. 4C).

As shown in Figure 5A, the predicted IAR4 protein is 81% identical to a previously characterized Arabidopsis mitochondrial PDH E1{alpha}-subunit (At1g59900; Luethy et al., 1995Go). Like the previously described subunit, IAR4 is predicted to have a mitochondrial targeting sequence by the iPSORT (Bannai et al., 2002Go) and TargetP (Emanuelsson et al., 2000Go) programs. In contrast, IAR4 is only 32% identical to a previously characterized Arabidopsis plastidic PDH E1{alpha}-subunit (At1g01090; Johnston et al., 1997Go), but the Arg residue mutated to a Cys in iar4-1 is conserved even in this distantly related E1{alpha}-subunit (Fig. 5A). These three proteins are the only apparent PDH E1{alpha}-subunits encoded in the Arabidopsis genome (The Arabidopsis Genome Initiative, 2000Go).



View larger version (99K):
[in this window]
[in a new window]
 
Figure 5. IAR4 is similar to mitochondrial PDH E1{alpha}-subunits. A, Sequences from predicted PDH E1{alpha}-subunits were aligned with the MegAlign program (DNASTAR, Inc., Madison, WI) using the Clustal W method. Amino acid residues identical in at least four of the sequences are boxed in black. The position of the Arg residue mutated to a Cys in iar4-1 is highlighted with a gray box and a triangle indicates the position of the intron interrupted by a T-DNA in iar4-2. The protein predicted from the IAR4 cDNA is compared to predicted mitochondrial E1{alpha} sequences from Arabidopsis (At1g59900; Luethy et al., 1995Go), sugar beet (Bv; Yui et al., 2003Go), potato (St; Grof et al., 1995Go), maize (Zm; Thelen et al., 1999Go), budding yeast (Sc; Behal et al., 1989Go), and human (Hs; GenBank accession no. AAH30697) and the plastid PDH E1{alpha} from Arabidopsis (At1g01090; Johnston et al., 1997Go). Also included are sequences from rice (Os) and cotton (Gh) plant genome projects assembled in the TIGR Gene Index Database (URL: http://www.tigr.org/tdb/tgi; Quackenbush et al., 2001Go). B, Phylogenetic tree of IAR4 and its relatives. The tree reconstructs the evolutionary relationship between selected characterized and putative PDH E1{alpha}-subunits. The proteins were aligned as described in panel A, and the unrooted phylogram was generated by using PAUP 4.05b (Swofford, 2001Go). The bootstrap method was performed for 200 replicates with a distance optimality criterion, and all characters were weighted equally. Along with the proteins from panel A, additional sequences compared in panel B are from rat (Rn; Matuda et al., 1991Go), Sinorhizobium meliloti (Sm; GenBank accession no. NP_385551), and TIGR Gene Index Database sequences from Medicago truncatula (Mt), wheat (Ta), tomato (Le), and rice (Os). Shaded ovals highlight the plant proteins predicted to be mitochondrial (left) or plastidic (right).

 
The PDH complex converts pyruvate to acetyl-coenzyme A (CoA), thereby linking glycolysis to the Krebs cycle (Mooney et al., 2002Go). To test if the iar4-1 root elongation defect may be in part due to a deficiency in Krebs cycle intermediates, we examined the ability of citrate to rescue the short root phenotype of iar4-1. As shown in Figure 6B, the short root of iar4-1 is not rescued by citrate. Fumaric acid is the Krebs cycle intermediate that accumulates to the highest levels in Arabidopsis plants (Chia et al., 2000Go). We examined fumaric acid levels in 8-d-old iar4-1 and wild-type seedlings using gas chromatography (Chia et al., 2000Go) and found that iar4 and wild type accumulate similar levels of fumaric acid (Fig. 6D). These results suggest that fumaric and citric acids are not limiting in the iar4 mutant.



View larger version (31K):
[in this window]
[in a new window]
 
Figure 6. iar4 responds normally to Suc, citrate, and ethanol. A–C, Seedlings were grown on the indicated concentration of Suc for 8 d, citrate (pH 5.5) for 9 d, or ethanol for 8 d. Error bars represent SDs of mean root lengths (n = 10–12). D, 8-d-old seedlings grown on filter paper overlaid on PNS medium were harvested and fumaric acid was assayed using gas chromatography (see "Materials and Methods"). Fumarate levels were normalized to palmitoleic acid (16:1) levels and displayed in arbitrary units. Error bars represent SEs of the means (n = 3).

 
To test for {beta}-oxidation defects we assessed the ability of iar4-1 to develop in the dark in the presence or absence of Suc. iar4 germinates and develops normally under these conditions (Fig. 3C), suggesting that iar4 catabolizes seed storage lipids normally and can metabolize Suc similarly to wild type. We also tested iar4-1 root elongation on a range of Suc concentrations to determine if the mutant has altered Suc sensitivity and found that iar4-1 responds to Suc similarly to wild type (Fig. 6A). In addition, we examined the response of iar4-1 to increasing concentrations of ethanol to see if the mutant would be supersensitive to ethanol because of a buildup of this pyruvate metabolite. We found that iar4-1 responds to ethanol similarly to wild type (Fig. 6C).


A Mutation in a Second Mitochondrial PDH E1{alpha} Subunit

To determine if IAA-Ala resistance can result from a general defect in pyruvate metabolism, we obtained two T-DNA insertions from the Salk Institute (La Jolla, CA) Genomic Analysis Laboratory collection in At1g59900, which encodes the previously identified mitochondrial PDH E1{alpha}-subunit (Luethy et al., 1995Go). Sequencing the sites of the insertions (see "Materials and Methods") revealed that the T-DNA is inserted in the middle of intron 5 in SALK_074384 (at1g59900-1) and 37 bp upstream of the initiator ATG in SALK_047438 (at1g59900-2). Homozygous lines carrying either of these alleles displayed wild-type sensitivity to IAA-Ala and other auxins (Fig. 4C and data not shown), indicating that the iar4 mutant phenotypes are not general to all defects in PDH E1{alpha} isozymes. We also found that at1g59900-1 seedlings have wild-type responses to ethanol, Suc, and citrate, and that at1g59900-1 plants lack obvious morphological abnormalities (data not shown).


    DISCUSSION
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 
The gene defective in the iar4 mutant encodes a protein 81% identical to a characterized Arabidopsis mitochondrial PDH E1{alpha}-subunit (Luethy et al., 1995Go). In plants, PDH is found both in the mitochondria and the chloroplast (Mooney et al., 2002Go). The E1{alpha}-subunit functions as a heterotetramer with the E1{beta}-subunit to decarboxylate pyruvate and forms an acetaldehyde conjugate with the thiamine pyrophosphate cofactor. The acetyl group is transferred from thiamine pyrophosphate to CoA-sulfhydryl group via the lipoic acid prosthetic group of the E2 subunit, resulting in the release of acetyl-CoA. The E3 subunit uses FAD to reoxidize the E2 lipoyl moieties to produce FADH2 and then transfers the proton and electrons to NAD+ to form NADH (Mooney et al., 2002Go). To our knowledge, this is the first report of a plant mutant in any part of the PDH complex.

Phenotypic analyses of the iar4 mutant suggest that IAR4 has a function related to auxin. iar4-1 has a short root on unsupplemented medium and is less sensitive than wild type to several IAA-amino acid conjugates, to some concentrations of the synthetic auxin 2,4-D, and to the ethylene precursor ACC. In contrast, iar4 responds more similarly to wild type to exogenous IAA and to other phytohormones. Both missense (iar4-1) and insertion (iar4-2) alleles have reduced sensitivity to IAA-Ala, indicating that this phenotype results from a loss of IAR4 function.

Because iar4 was identified for its resistance to IAA-Ala, it was intriguing to learn that the defective gene in this mutant encodes an apparent PDH subunit. There are several possible explanations for the IAA-Ala resistance of the iar4 mutant. One possibility is that IAR4 is a subunit of a true mitochondrial PDH complex, and disruption of IAR4 function decreases pyruvate conversion to acetyl-CoA. In the iar4 mutant, reduced acetyl-CoA levels or accumulation of an upstream component or secondary metabolite could indirectly affect auxin metabolism by depleting precursors or inhibiting required reactions (Fig. 7A). However, citrate, which enters the TCA cycle downstream of acetyl-CoA, fails to rescue the iar4 mutant root elongation defect; the mutant accumulates normal levels of fumaric acid; and ethanol, which is derived from pyruvate, does not exacerbate the mutant phenotype (Fig. 6). The iar4 mutant also responds like wild type to Suc (Fig. 6). We expected that Suc might either rescue the root elongation defect due to increased flux through glycolytic pathways or result in increased sensitivity due to a buildup of pyruvate or side products. We did not observe either of these effects. Although these are negative results, none provide evidence that iar4 is defective in processes that might be expected to be affected by mitochondrial PDH.



View larger version (31K):
[in this window]
[in a new window]
 
Figure 7. Two possible models for IAR4 function. A, IAR4 may encode a bona fide PDH complex E1{alpha}-subunit, and a decrease in the conversion of pyruvate to acetyl-CoA may cause IAA-Ala resistance in the iar4 mutant. Dashed arrows represent speculative steps. B, IAR4 may encode an E1{alpha}-subunit of an indole-3-pyruvate dehydrogenase complex, and a decrease in IAA-CoA formation may cause the IAA-Ala resistance in the iar4 mutant. IAA-CoA may serve as an IAA conjugate precursor or might be hydrolyzed to IAA. ILR1, IAR3, and ILL2 are amidohydrolases that cleave IAA conjugates to yield free IAA (LeClere et al., 2002Go; Rampey et al., 2004Go). Dashed arrows represent speculative steps.

 
We also examined insertional mutants in At1g59900, the other Arabidopsis mitochondrial PDH E1{alpha}-subunit gene. Homozygous plants carrying an insertion before exon 6 of At1g59900, which encodes a mitochondrial E1{alpha} protein 81% identical to IAR4 (Luethy et al., 1995Go), are viable and have wild-type responses to IAA-Ala. Because iar4 is resistant to IAA-Ala, whereas a mutant defective in the other mitochondrial PDH E1{alpha} responds normally to IAA-Ala, it is possible that IAR4 acts in IAA-Ala metabolism or response while the other E1{alpha}-subunit acts in mitochondrial pyruvate metabolism. Some functional redundancy between IAR4 and At1g59900 in pyruvate metabolism is also likely, as both iar4 and at1g59900-1 lack dramatic growth defects and have wild-type responses to ethanol, Suc, and citrate. An essential role for PDH E1{alpha} activity is suggested by the recent report of male sterility resulting from antisense expression of a sugar beet PDH E1{alpha} gene in tobacco anther tapetum (Yui et al., 2003Go). It is likely that a double mutant between the iar4 and at1g59900-1 mutants described here would reveal any functional redundancy between these two isozymes.

Interestingly, in addition to the two predicted mitochondrial E1{alpha}-subunits (IAR4/At1g24180 and At1g59900), there are three predicted E1{beta}-subunits (At1g30120, At2g34590, and At5g50850) in Arabidopsis. Although only a single combination (At1g59900 E1{alpha} with At5g50850 E1{beta}) has been heterologously expressed, purified, and tested for activity in vitro (Szurmak et al., 2003Go), a variety of E1 {alpha}2{beta}2 heterotetramers may exist in vivo, and these different enzymes may display different catalytic or regulatory properties.

Rather than or in addition to acting on pyruvate, IAR4 may function with other PDH subunits to catalyze the conversion of indole-3-pyruvate (IPA) to indole-3-acetyl-CoA (IAA-CoA; Fig. 7B). In several plant-associated microbes, IPA is an intermediate in an IAA biosynthetic pathway in which a Trp aminotransferase converts Trp to IPA, and an IPA decarboxylase converts IPA to indole-3-acetaldehyde, which is then oxidized to IAA (Koga, 1995Go). IPA is present in Arabidopsis (Tam and Normanly, 1998Go), but the pathways by which it is formed and the products to which it contributes are unknown (Bartel et al., 2001Go). If IAR4 functions as a subunit of an IPA dehydrogenase that converts IPA to IAA-CoA, this IAA-CoA could then be hydrolyzed to release IAA or could provide activated IAA as a precursor to amide-linked IAA conjugates such as IAA-amino acids (Fig. 7B). In this case, certain iar4 mutant tissues could have reduced levels of IAA and/or IAA-Ala, which might lead to the observed IAA-Ala resistance. The stimulation by CoA of in vitro IAA ester formation led to the initial suggestion that IAA-CoA might be an intermediate in IAA conjugate formation (Kopcewicz et al., 1974Go). Biochemical studies have shown that formation of IAA-Asp, which is thought to function in auxin detoxification (Normanly, 1997Go), has both auxin-inducible and constitutive components (Venis, 1972Go). It is likely that a recently described family of IAA adenylating enzymes act in at least some pathways of IAA conjugate formation (Staswick et al., 2002Go), but it is possible that distinct enzymes and pathways are used to synthesize conjugates used for storage, constitutive detoxification, and inducible detoxification of IAA.

To explore the likelihood that Arabidopsis encodes mitochondrial PDH E1{alpha}-subunits with different roles, we undertook a phylogenetic analysis of available plant sequences. Examination of assembled cDNAs from various plant genome projects (TIGR Gene Index Databases; URL: http://www.tigr.org/tdb/tgi; Quackenbush et al., 2001Go) revealed that the closest sequenced IAR4 homolog is TC17531 from cotton, which is 82% to 83% identical to both IAR4 and At1g59900 (Fig. 5A). Phylogenetic analysis does not reveal whether this cotton sequence is more closely related to IAR4 or At1g59900 (Fig. 5B). When additional plant genome sequences are complete, it will be interesting to learn whether other plants, like Arabidopsis and Medicago, encode multiple apparent mitochondrial E1{alpha}-subunits (Fig. 5B).

Our understanding of IAA homeostasis is far from complete, but further characterization of IAR4 may reveal the importance of IPA to IAA-CoA conversion in IAA or conjugate biosynthesis or may provide a link between more general glycolytic pathways and IAA biosynthesis and metabolism.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 

Plant Growth Conditions

Arabidopsis accessions Wassilewskija (Ws) and Columbia (Col-0) were used as wild type for iar4-1 and iar4-2, respectively. For determination of root length, seeds were surface sterilized (Last and Fink, 1988Go) and sown on plant nutrient medium (PN; Haughn and Somerville, 1986Go) solidified with 0.6% (w/v) agar and supplemented with 15 mM Suc (PNS) unless otherwise noted. Plates were sealed with gas-permeable surgical tape (LecTec, Minnetonka, MN). For growth in soil, plants were either transferred from PNS or sown directly in soil (Metromix 200; Scotts, Marysville, OH) and grown at 22 to 25°C under continuous illumination with cool-white fluorescent bulbs (approximately 200 µE m–2 s–1; Sylvania, Versailles, KY).

Unless otherwise indicated, plates were incubated at 22 or 28°C under yellow long-pass filters (25–45 µE m–2 s–2) to slow the breakdown of indolic compounds (Stasinopoulos and Hangarter, 1990Go). IAA-L-amino acid conjugates were from Aldrich (Milwaukee, WI) or were synthesized as described (LeClere et al., 2002Go). Conjugates were diluted from 20 to 100 mM stocks in 50% (v/v) or 100% ethanol. All remaining hormone stocks were diluted from stocks in 100% ethanol. For testing root elongation on ABA, 4-d-old seedlings were transferred from PNS to plates containing ABA, the positions of the root tips were marked, plates were incubated vertically for another 4 d, and root growth following transfer was measured. For dark grown seedlings, plates were incubated for 1 d under white light (120 µE m–2 s–2) to induce germination then wrapped in aluminum foil for the indicated number of days.


Mutant Isolation

The iar4-1 mutant was isolated as described previously for iar3-1 (Davies et al., 1999Go) from pools of Ws mutagenized with ethylmethane sulfonate. The iar4-1 mutant was backcrossed to the parental Ws line five times to remove extraneous mutations prior to phenotypic analysis. The iar4-2 mutant is a sequence-indexed Arabidopsis T-DNA insertion mutant (SALK_011308) isolated by the Salk Institute Genomic Analysis Laboratory (Alonso et al., 2003Go) that we obtained from the Arabidopsis Biological Resource Center (ABRC; Ohio State University, Columbus, OH). We verified the position of the T-DNA insert in iar4-2 using PCR with the primers iar4-2-5' (AGGACAAACCTTCACAGTTGTGTGTTCGG) and iar4-2-3' (TGTTTCACAGCCAGTGCTTCCATACCATC) and a modified version of the LBb1 primer (CAAACCAGCGTGGACCGCTTGCTGCAACTC; http://signal.salk.edu). PCR amplification with iar4-2-5' and iar4-2-3' yields a 246-bp product from wild-type genomic DNA, whereas amplification with iar4-2-3' and LBb1 yields a 375-bp product from iar4-2 genomic DNA. This product was sequenced, revealing that the T-DNA had inserted at position 1069 of IAR4 (where 1 is the position of the initiator ATG). The precise insert positions in the other PDH E1{alpha} gene (At1g59900) were similarly determined using PCR with gene-specific primers (ACCTCATGAAGCGAACCACCACGACCTAAG for SALK_047438 and TTGATATCGCTGTTGTTCATATAAGTAGTAG for SALK_074384) paired with the LBb1 primer followed by direct sequencing of the resultant amplification products. The SALK_047438 (at1g59900-2) T-DNA is inserted in the 5'-untranslated region, at position –37 relative to the initiator ATG, whereas the SALK_074384 (at1g59900-1) T-DNA is inserted in intron 5 at position 2073 of At1g59900 (where 1 is the position of the initiator ATG).


Gas Chromatography Analysis of Fumarate Content

One hundred 8-d-old seedlings grown under white light on filter paper overlaid on PNS were harvested and stored at –80°C until analysis. Fumarate content was assayed using gas chromatography as previously described (Chia et al., 2000Go). Fumarate levels were normalized by dividing the area of the fumarate peak by the area of the palmitoleic acid (16:1) peak and are expressed in arbitrary units.


Positional Cloning of the IAR4 Gene

F2 seedlings from an outcross of iar4-1 (in the Ws background) to Col-0 were screened for resistance to 20 or 40 µM IAA-Ala. DNA was isolated (Celenza et al., 1995Go) from individuals with the longest roots and screened with PCR-based polymorphic markers (Konieczny and Ausubel, 1993Go; Bell and Ecker, 1994Go), including the newly developed markers shown in Table I. The predicted open reading frames in the mapping interval were amplified by PCR from genomic DNA prepared from the iar4-1 mutant. For IAR4, two pairs of oligonucleotides were used for amplification (F3I6.11-2: TTATACCATGTTGACTTCAGCTTCCAACC plus F3I6.11-7: TGAACCAATCATCTCCTTGGGAAGCAAG and F3I6.11-3: ATGTCAACGCTATGTGATTGAATTCACAAG plus F3I6.11-6: GGTTTGACCTTTTCCATAAACGACGCTTCG) with a program of 40 cycles of 95°C for 30 s, 56°C for 30 s, and 72°C for 3 min. Amplification products were gel purified and sequenced directly using an automated DNA sequencer (Lone Star Labs, Houston) and the primers used for amplification plus additional primers (F3I6.11-4: TAGATGGAATGGGAACGGCTACATGGAGG and F3I6.11-5: AGACAACTCAGTCTCACCTTCAAGCCAGG).

To confirm the splicing pattern of the predicted IAR4 gene, an EST clone corresponding to a full-length IAR4 cDNA (213P12T7) was obtained from ABRC. The insert of this cDNA was sequenced using vector-derived and internal primers. The GenBank accession number for the IAR4 cDNA is AY135561.


Generation of Rescue Constructs and Transgenic Plants

To generate a genomic IAR4 rescue construct, a 3.4-kb SspI fragment was isolated from the bacterial artificial chromosome F3I6 (GenBank accession no. AC002396). This fragment was subcloned into the SmaI site of the plant transformation vector pBENEEblue, a plasmid offering blue/white selection and kanamycin and ampicillin selection in bacteria, BASTA selection in soil, and plasmid rescue capabilities in transgenic plants (LeClere, 2002Go). The resultant plasmid (pBENEE-IAR4) was electroporated into Agrobacterium strain GV3101 (Koncz et al., 1992Go) and the floral dip method (Clough and Bent, 1998Go) was used to transform homozygous iar4-1 mutant plants that had been backcrossed to Ws five times. T1 plants were selected in soil as previously described (LeClere and Bartel, 2001Go). Lines homozygous for the transgene were selected by examining the BASTA resistance of T3 seedlings.


Distribution of Materials

Upon request, all novel materials described in this publication will be made available in a timely manner for noncommercial research purposes, subject to the requisite permission from any third-party owners of all or parts of the material. Obtaining any permissions will be the responsibility of the requestor.

Sequence data from this article have been deposited with the EMBL/GenBank data libraries under accession number AY135561.


    ACKNOWLEDGMENTS
 
We thank Haifeng Chen for the initial mapping of iar4 and developing markers, the ABRC for seeds and cDNA and BAC clones, the Salk Institute Genomic Analysis Laboratory for the sequence-indexed Arabidopsis T-DNA insertion mutants (SALK_011308, SALK_047438, and SALK_074384). We are grateful to Douglas Randall for useful discussions and to Diana Dugas, Melanie Monroe-Augustus, Andrew Woodward, and Bethany Zolman for critical comments on the manuscript.

Received February 4, 2004; returned for revision March 20, 2004; accepted March 21, 2004.


    FOOTNOTES
 
1 This work was supported by the National Institutes of Health (grant nos. R29–GM54749 and T32–GM08362) and by the Robert A. Welch Foundation (grant no. C–1309) and Houston Livestock Show and Rodeo scholarships (to S.L. and R.A.R.). Back

2 Present address: Stoller Enterprises, 4001 W. Sam Houston Parkway N., Suite 100, Houston, TX 77043. Back

Article, publication date, and citation information can be found at www.plantphysiol.org/cgi/doi/10.1104/pp.104.040519.

* Corresponding author; e-mail bartel{at}rice.edu; fax 713–348–5154.


    LITERATURE CITED
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 
Alonso JM, Stepanova AN, Leisse TJ, Kim CJ, Chen H, Shinn P, Stevenson DK, Zimmerman J, Barajas P, Cheuk R, et al (2003) Genome-wide insertional mutagenesis of Arabidopsis thaliana. Science 301: 653–657[Abstract/Free Full Text]

Bannai H, Tamada Y, Maruyama O, Nakai K, Miyano S (2002) Extensive feature detection of N-terminal protein sorting signals. Bioinformatics 18: 298–305[Abstract/Free Full Text]

Bartel B, Fink GR (1995) ILR1, an amidohydrolase that releases active indole-3-acetic acid from conjugates. Science 268: 1745–1748[Abstract/Free Full Text]

Bartel B, LeClere S, Magidin M, Zolman BK (2001) Inputs to the active indole-3-acetic acid pool: de novo synthesis, conjugate hydrolysis, and indole-3-butyric acid {beta}-oxidation. J Plant Growth Regul 20: 198–216[CrossRef]

Behal RH, Browning KS, Reed LJ (1989) Nucleotide and deduced amino acid sequence of the alpha subunit of yeast pyruvate dehydrogenase. Biochem Biophys Res Commun 164: 941–946[CrossRef][Medline]

Bell CJ, Ecker JR (1994) Assignment of 30 microsatellite loci to the linkage map of Arabidopsis. Genomics 19: 137–144[CrossRef][Web of Science][Medline]

Bialek K, Cohen JD (1992) Amide-linked indoleacetic acid conjugates may control levels of indoleacetic acid in germinating seedlings of Phaseolus vulgaris. Plant Physiol 100: 2002–2007[Abstract/Free Full Text]

Bialek K, Meudt WJ, Cohen JD (1983) Indole-3-acetic acid (IAA) and IAA conjugates applied to bean stem sections. Plant Physiol 73: 130–134[Abstract/Free Full Text]

Celenza JL, Grisafi PL, Fink GR (1995) A pathway for lateral root formation in Arabidopsis thaliana. Genes Dev 9: 2131–2142[Abstract/Free Full Text]

Chia DW, Yoder TJ, Reiter W-D, Gibson SI (2000) Fumaric acid: an overlooked form of fixed carbon in Arabidopsis and other plant species. Planta 211: 743–751[CrossRef][Web of Science][Medline]

Clough SJ, Bent AF (1998) Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J 16: 735–743[CrossRef][Web of Science][Medline]

Davies PJ (1995) Plant Hormones. Kluwer Academic Publishers, Dordrecht, The Netherlands, pp 833

Davies RT, Goetz DH, Lasswell J, Anderson MN, Bartel B (1999) IAR3 encodes an auxin conjugate hydrolase from Arabidopsis. Plant Cell 11: 365–376[Abstract/Free Full Text]

Emanuelsson O, Nielsen H, Brunak S, von Heijne G (2000) Predicting subcellular localization of proteins based on their N-terminal amino acid sequence. J Mol Biol 300: 1005–1016[CrossRef][Web of Science][Medline]

Epstein E, Cohen JD, Bandurski RS (1980) Concentration and metabolic turnover of indoles in germinating kernels of Zea mays L. Plant Physiol 65: 415–421[Abstract/Free Full Text]

Gray WM, Östin A, Sandberg G, Romano CP, Estelle M (1998) High temperature promotes auxin-mediated hypocotyl elongation in Arabidopsis. Proc Natl Acad Sci USA 95: 7197–7202[Abstract/Free Full Text]

Grof CP, Winning BM, Scaysbrook TP, Hill SA, Leaver CJ (1995) Mitochondrial pyruvate dehydrogenase. Molecular cloning of the E1 alpha subunit and expression analysis. Plant Physiol 108: 1623–1629[Abstract]

Hangarter RP, Good NE (1981) Evidence that IAA conjugates are slow-release sources of free IAA in plant tissues. Plant Physiol 68: 1424–1427[Abstract/Free Full Text]

Hangarter RP, Peterson MD, Good NE (1980) Biological activities of indoleacetylamino acids and their use as auxins in tissue culture. Plant Physiol 65: 761–767[Abstract/Free Full Text]

Haughn GW, Somerville C (1986) Sulfonylurea-resistant mutants of Arabidopsis thaliana. Mol Gen Genet 204: 430–434[CrossRef][Web of Science]

Johnston ML, Luethy MH, Miernyk JA, Randall DD (1997) Cloning and molecular analyses of the Arabidopsis thaliana plastid pyruvate dehydrogenase subunits. Biochim Biophys Acta 1321: 200–206[Medline]

Koga J (1995) Structure and function of indolepyruvate decarboxylase, a key enzyme in indole-3-acetic acid biosynthesis. Biochim Biophys Acta 1249: 1–13[CrossRef][Medline]

Koncz C, Schell J, Rédei GP (1992) T-DNA transformation and insertion mutagenesis. In C Koncz, N-H Chua, J Schell, eds, Methods in Arabidopsis Research. World Scientific, River Edge, NJ, pp 224–273

Konieczny A, Ausubel FM (1993) A procedure for mapping Arabidopsis mutations using co-dominant ecotype-specific PCR-based markers. Plant J 4: 403–410[CrossRef][Web of Science][Medline]

Kopcewicz J, Ehmann A, Bandurski RS (1974) Enzymatic esterification of indole-3-acetic acid to myo-inositol and glucose. Plant Physiol 54: 846–851[Abstract/Free Full Text]

Kowalczyk M, Sandberg G (2001) Quantitative analysis of indole-3-acetic acid metabolites in Arabidopsis thaliana. Plant Physiol 127: 1845–1853[Abstract/Free Full Text]

Lasswell J, Rogg LE, Nelson DC, Rongey C, Bartel B (2000) Cloning and characterization of IAR1, a gene required for auxin conjugate sensitivity in Arabidopsis. Plant Cell 12: 2395–2408[Abstract/Free Full Text]

Last RL, Fink GR (1988) Tryptophan-requiring mutants of the plant Arabidopsis thaliana. Science 240: 305–310[Abstract/Free Full Text]

LeClere S (2002) Analysis of the function and metabolism of indole-3-acetic acid conjugates in Arabidopsis thaliana. PhD thesis. Biochemistry and Cell Biology, Rice University, Houston, pp 152

LeClere S, Bartel B (2001) A library of Arabidopsis 35S-cDNA lines for identifying novel mutants. Plant Mol Biol 46: 695–703[CrossRef][Web of Science][Medline]

LeClere S, Tellez R, Rampey RA, Matsuda SPT, Bartel B (2002) Characterization of a family of IAA-amino acid conjugate hydrolases from Arabidopsis. J Biol Chem 277: 20446–20452[Abstract/Free Full Text]

Ljung K, Hull AK, Kowalczyk M, Marchant A, Celenza J, Cohen JD, Sandberg G (2002) Biosynthesis, conjugation, catabolism and homeostasis of indole-3-acetic acid in Arabidopsis thaliana. Plant Mol Biol 50: 309–332[CrossRef][Web of Science][Medline]

Ljung K, Östin A, Lioussanne L, Sandberg G (2001) Developmental regulation of indole-3-acetic acid turnover in Scots pine seedlings. Plant Physiol 125: 464–475[Abstract/Free Full Text]

Luethy MH, Miernyk JA, Randall DD (1995) The mitochondrial pyruvate dehydrogenase complex: nucleotide and deduced amino-acid sequences of a cDNA encoding the Arabidopsis thaliana E1{alpha}-subunit. Gene 164: 251–254[CrossRef][Web of Science][Medline]

Magidin M, Pittman JK, Hirschi K, Bartel B (2003) ILR2, a novel gene regulating IAA conjugate sensitivity and metal transport in Arabidopsis thaliana. Plant J 35: 523–534[CrossRef][Web of Science][Medline]

Magnus V, Hangarter RP, Good NE (1992a) Interaction of free indole-3-acetic acid and its amino acid conjugates in tomato hypocotyl cultures. J Plant Growth Regul 11: 67–75

Magnus V, Nigovic B, Hangarter RP, Good NE (1992b) N-(Indol-3-ylacetyl)amino acids as sources of auxin in plant tissue culture. J Plant Growth Regul 11: 19–28

Matuda S, Nakano K, Ohta S, Saheki T, Kawanishi Y, Miyata T (1991) The alpha-ketoacid dehydrogenase complexes. Sequence similarity of rat pyruvate dehydrogenase with Escherichia coli and Azotobacter vinelandii alpha-ketoglutarate dehydrogenase. Biochim Biophys Acta 1089: 1–7[Medline]

Mooney BP, Miernyk JA, Randall DD (2002) The complex fate of {alpha}-ketoacids. Annu Rev Plant Biol 53: 357–375[CrossRef][Medline]

Normanly J (1997) Auxin metabolism. Physiol Plant 100: 431–442[CrossRef]

Nowacki J, Bandurski RS (1980) Myo-inositol esters of indole-3-acetic acid as seed auxin precursors of Zea mays L. Plant Physiol 65: 422–427[Abstract/Free Full Text]

Quackenbush J, Cho J, Lee D, Liang F, Holt I, Karamycheva S, Parvizi B, Pertea G, Sultana R, White J (2001) The TIGR gene indices: analysis of gene transcript sequences in highly sampled eukaryotic species. Nucleic Acids Res 29: 159–164[Abstract/Free Full Text]

Rampey RA, LeClere S, Kowalczyk M, Ljung K, Sandberg G, Bartel B (2004) A family of auxin-conjugate hydrolases that contribute to free indole-3-acetic acid levels during Arabidopsis germination. Plant Physiol 135: 978–988

Rogg LE, Lasswell J, Bartel B (2001) A gain-of-function mutation in IAA28 suppresses lateral root development. Plant Cell 13: 465–480[Abstract/Free Full Text]

Roman G, Lubarsky B, Kieber JJ, Rothenberg M, Ecker JR (1995) Genetic analysis of ethylene signal transduction in Arabidopsis thaliana: five novel mutant loci integrated into a stress response pathway. Genetics 139: 1393–1409[Abstract]

Slovin JP (1997) Phytotoxic conjugates of indole-3-acetic acid: potential agents for biochemical selection of mutants in conjugate hydrolysis. Plant Growth Regul 21: 215–221[CrossRef]

Stasinopoulos TC, Hangarter RP (1990) Preventing photochemistry in culture media by long-pass light filters alters growth of cultured tissues. Plant Physiol 93: 1365–1369[Abstract/Free Full Text]

Staswick PE, Tiryaki I, Rowe ML (2002) Jasmonate response locus JAR1 and several related Arabidopsis genes encode enzymes of the firefly luciferase superfamily that show activity on jasmonic, salicylic, and indole-3-acetic acids in an assay for adenylation. Plant Cell 14: 1405–1415[Abstract/Free Full Text]

Swofford DL (2001) PAUP*. Phylogenetic Analysis using Parsimony (and Other Methods). Sinauer Associates, Sunderland, MA

Szurmak B, Strokovskaya L, Mooney BP, Randall DD, Miernyk JA (2003) Expression and assembly of Arabidopsis thaliana pyruvate dehydrogenase in insect cell cytoplasm. Protein Expr Purif 28: 357–361[Medline]

Tam YY, Epstein E, Normanly J (2000) Characterization of auxin conjugates in Arabidopsis. Low steady-state levels of indole-3-acetyl-aspartate, indole-3-acetyl-glutamate, and indole-3-acetyl-glucose. Plant Physiol 123: 589–595

Tam YY, Normanly J (1998) Determination of indole-3-pyruvic acid levels in Arabidopsis thaliana by gas chromatography–selected ion monitoring-mass spectrometry. J Chromatogr A 800: 101–108[CrossRef][Web of Science][Medline]

The Arabidopsis Genome Initiative (2000) Analysis of the genome sequence of the flowering plant Arabidopsis thaliana. Nature 408: 796–815[CrossRef][Medline]

Thelen JJ, Miernyk JA, Randall DD (1999) Molecular cloning and expression analysis of the mitochondrial pyruvate dehydrogenase from maize. Plant Physiol 119: 635–644[Abstract/Free Full Text]

Venis MA (1972) Auxin-induced conjugation systems in peas. Plant Physiol 49: 24–27[Abstract/Free Full Text]

Walz A, Park S, Slovin JP, Ludwig-Müller J, Momonoki YS, Cohen JD (2002) A gene encoding a protein modified by the phytohormone indoleacetic acid. Proc Natl Acad Sci USA 99: 1718–1723[Abstract/Free Full Text]

Yui R, Iketani S, Mikami T, Kubo T (2003) Antisense inhibition of mitochondrial pyruvate dehydrogenase E1{alpha} subunit in anther tapetum causes male sterility. Plant J 34: 57–66[CrossRef][Web of Science][Medline]




This article has been cited by other articles:


Home page
Plant Physiol.Home page
M. Quint, L. S. Barkawi, K.-T. Fan, J. D. Cohen, and W. M. Gray
Arabidopsis IAR4 Modulates Auxin Response by Regulating Auxin Homeostasis
Plant Physiology, June 1, 2009; 150(2): 748 - 758.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
L. C. Strader, M. Monroe-Augustus, K. C. Rogers, G. L. Lin, and B. Bartel
Arabidopsis iba response5 Suppressors Separate Responses to Various Hormones
Genetics, December 1, 2008; 180(4): 2019 - 2031.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
R. A. Rampey, A. W. Woodward, B. N. Hobbs, M. P. Tierney, B. Lahner, D. E. Salt, and B. Bartel
An Arabidopsis Basic Helix-Loop-Helix Leucine Zipper Protein Modulates Metal Homeostasis and Auxin Conjugate Responsiveness
Genetics, December 1, 2006; 174(4): 1841 - 1857.
[Abstract] [Full Text] [PDF]


Home page
ANN BOT (LOND)Home page
A. W. WOODWARD and B. BARTEL
Auxin: Regulation, Action, and Interaction
Ann. Bot., April 1, 2005; 95(5): 707 - 735.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
135/2/989    most recent
pp.104.040519v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Web of Science (5)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by LeClere, S.
Right arrow Articles by Bartel, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by LeClere, S.
Right arrow Articles by Bartel, B.
Agricola
Right arrow Articles by LeClere, S.
Right arrow Articles by Bartel, B.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
ASPB Publications PLANT PHYSIOLOGY® THE PLANT CELL
Copyright © 2004 by the American Society of Plant Biologists