|
|
||||||||
|
First published online July 9, 2004; 10.1104/pp.104.039859 Plant Physiology 135:1378-1387 (2004) © 2004 American Society of Plant Biologists AtOPT6 Transports Glutathione Derivatives and Is Induced by Primisulfuron1Unité Mixte de Recherches, Centre National de la Recherche Scientifique 6161, Transport des Assimilats, Laboratoire de Physiologie, Biochimie et Biologie Moléculaire Végétales, Bâtiment Botanique, Unité de Formation et de Recherche Sciences Fondamentales et Appliquées, 86022 Poitiers Cédex, France
The oligopeptide transporter (OPT) family contains nine members in Arabidopsis. While there is some evidence that AtOPTs mediate the uptake of tetra- and pentapeptides, OPT homologs in rice (Oryza sativa; OsGT1) and Indian mustard (Brassica juncea; BjGT1) have been described as transporters of glutathione derivatives. This study investigates the possibility that two members of the AtOPT family, AtOPT6 and AtOPT7, may also transport glutathione and its conjugates. Complementation of the hgt1met1 yeast double mutant by plant homologs of the yeast glutathione transporter HGT1 (AtOPT6, AtOPT7, OsGT1, BjGT1) did not restore the growth phenotype, unlike complementation by HGT1. By contrast, complementation by AtOPT6 restored growth of the hgt1 yeast mutant on a medium containing reduced (GSH) or oxidized glutathione as the sole sulfur source and induced uptake of [3H]GSH, whereas complementation by AtOPT7 did not. In these conditions, AtOPT6-dependent GSH uptake in yeast was mediated by a high affinity (Km = 400 µM) and a low affinity (Km = 5 mM) phase. It was strongly competed for by an excess oxidized glutathione and glutathione-N-ethylmaleimide conjugate. Growth assays of yeasts in the presence of cadmium (Cd) suggested that AtOPT6 may transport Cd and Cd/GSH conjugate. Reporter gene experiments showed that AtOPT6 is mainly expressed in dividing areas of the plant (cambium, areas of lateral root initiation). RNA blots on cell suspensions and real-time reverse transcription-PCR on Arabidopsis plants indicated that AtOPT6 expression is strongly induced by primisulfuron and, to a lesser extent, by abscisic acid but not by Cd. Altogether, the data show that the substrate specificity and the physiological functions of AtOPT members may be diverse. In addition to peptide transport, AtOPT6 is able to transport glutathione derivatives and metal complexes, and may be involved in stress resistance.
As other eucaryotic cells and procaryotes, plant cells have the ability to transport peptides across membranes. Peptide transport is important for storage and mobilization of reduced nitrogen (Higgins and Payne, 1977
The presence of multiple peptide transporters in the Arabidopsis genome and the known functions of peptide transport in bacteria, fungi, and animals suggest that peptide transporters may also play a key role in plant growth and development (Stacey et al., 2002a
The Arabidopsis genome contains 51 PTR family members (Stacey et al., 2002a
However, although the ability of Arabidopsis OPT members to transport tetra- and pentapeptides has been well established, the possibility that they may also transport glutathione and its derivatives has not yet been investigated in detail. This study demonstrates that AtOPT6 is able to transport glutathione in strains grown under sulfur-deprived conditions, whereas AtOPT7 is not. Furthermore, it is shown that expression of AtOPT6, which was characterized by
AtOPT6 and AtOPT7 full-length cDNAs were amplified from whole Arabidopsis seedlings by RT-PCR with specific primers and transferred to the yeast shuttle vector pDR 195 or pDR 196, respectively. The pDR/AtOPT6 and AtOPT7 constructs were used to transform the ABC 822 (MATa ura3-52 leu2- 1 lys2-801 his3- 200 trp1- 63 ade2-101 hgt1 ::LEU2) and the ABC 817 yeast (MATa his3 1 leu2 0 met15 0 ura3 0 hgt1 ::LEU2) yeast mutants deficient in glutathione transport. The requirement of the ABC 817 strain for a source of exogenous reduced sulfur is expected to be higher than that of ABC 822 due to disruption of a gene essential for Met synthesis. We first assessed the effects of complementation of ABC 817 by either pDR/AtOPT6, pDR/AtOPT7, or TEF-HGT1 by studying the growth phenotype on synthetic dextrose (SD) solid media containing different organic sulfur sources (Met, Cys, GSH) in the presence of sulfate in the medium. While the hgt1met15 mutant complemented by the yeast glutathione transporter HGT1 can grow in the presence of GSH, the transformants carrying either the AtOPT6 or AtOPT7 cDNA required the presence of either Met or Cys in the medium, but their growth was not restored by the presence of GSH alone. Similar results were obtained with the hgt1met15 mutant complemented with BjGT1 or OsGT1 (data not shown). Furthermore, in the presence of Met, addition of high GSH concentrations (400 µM or 1 mM) did not affect the growth of the ABC 817 mutant complemented by the plant genes (compared to control without GSH), but it drastically inhibited the growth of the mutant carrying the TEF-HGT1 construct (data not shown). These data indicate that in this genetic background and under those conditions, the ability of the plant genes to mediate GSH transport in yeast was not sufficient, unlike that of the yeast transporter HGT1. Further experiments were run with the ABC 822 strain, which, unlike the ABC 817 mutant, is affected in glutathione uptake, but not on Met synthesis. The ability of AtOPT6 to mediate uptake of glutathione was tested both by growth experiments and by direct measurements of glutathione uptake. The ABC 822 yeast strain disrupted on the OPT1 (HGT1) gene did not grow on a sulfur-free minimal medium containing either GSH or GSSG as the sole sulfur source (Fig. 1). However, complementation of this strain by the pDR/AtOPT6 construct allowed growth on the medium containing either GSH (Fig. 1A) or GSSG (Fig. 1B). Complementation of this strain by the empty vector or by the pDR/AtOPT7 construct did not allow growth in the presence of GSH (Fig. 1A). Similar results were obtained for growth assays in solid media (data not shown).
After complementation by the pDR/AtOPT6 construct, the ABC 822 strain was able to absorb labeled GSH, whereas it was not when transformed by the empty pDR vector. The uptake rate was constant during 5 min and thereafter decreased until 30 min (Fig. 2).
When the ABC 822 strain carrying the pDR/AtOPT6 construct was grown in synthetic complete medium, which contains many sulfur compounds, uptake of [3H]GSH was very low (data not shown). Thus, the glutathione uptake capacity was observed only when the yeasts were grown in a sulfur-deprived medium (SD-S) where the only source of sulfur is glutathione, confirming previous results (Bogs et al., 2003 Concentration dependence studies showed that the initial rate of [3H]GSH uptake (measured within the first 3 min of incubation) was not fully saturable up to 5 mM (Fig. 3A). However, this rate decreased above 1 mM, and Eadie-Hostee plot analysis indicates that uptake kinetics may be interpreted as the superimposition of a low affinity (Km = 5 mM) and a high affinity (Km = 405 µM) component (Fig. 3B).
The substrate specificity of AtOPT6 was studied by competition experiments where the uptake of 50 µM [3H]GSH was challenged by a 10-fold excess of various potential competing substrates (Fig. 4). Various amino acids (Cys, Gly, Glu), dipeptides (Gly-Gly, Gly-Glu, -Glu-Cys), tripeptides (Gly-Gly-Gly), tetrapeptides (KLGL, KLLG), or the pentapeptide Leu-enkephalin (YGGFL) did not affect the uptake of [3H]GSH. By contrast, other amino acids (Pro, Met, Gln), dipeptides (Leu-Leu, Cys-Gly), and the pentapeptide KLLLG significantly decreased [3H]GSH uptake. Glutathione-N-ethylmaleimide conjugate and, even more, GSSG also decreased the uptake of labeled GSH. Addition of 500 µM unlabeled GSH significantly inhibited the uptake of 50 µM [3H]GSH, but the inhibition was not very strong, confirming that GSH did not completely saturate the transport system under these conditions. GSH uptake mediated by AtOPT6 in yeasts was strongly sensitive to protonophores and low temperature (data not shown).
At least five independent transgenic lines expressing either an AtOPT6 promoter-GUS or AtOPT7 promoter-GUS fusion were analyzed histochemically to study the pattern of AtOPT6 and AtOPT7 expression during development. In young embryos, a weak AtOPT6-GUS-driven expression transiently appeared in the procambium (Fig. 5A). At a later stage, GUS expression was apparent over the whole surface of the embryos (Fig. 5B). AtOPT6 was also strongly expressed in the inner tegument, in the area adjacent to the micropyle (Fig. 5C). In adult plants, AtOPT6 expression was detected in the vascular bundles of the leaves, petioles, and stems (Fig. 5D). In the petiole (Fig. 5G) and in the stem (Fig. 5H), GUS activity was the strongest in the cambial zone of the vascular bundles. In the roots, AtOPT6-driven GUS expression was noticed in the regions of lateral root initiation (Fig. 5, E and F). In the flowers, the expression was detected at a relatively low level in the vascular network of the petals; by contrast, the stamen filaments and the gynoecium were strongly stained (Fig. 5I).
AtOPT7-driven GUS expression was not detected at the embryo stage (Fig. 6, A and B). In adult plants, this expression was more important in the aerial parts than in the root system (Fig. 6C) and somewhat stronger than AtOPT6 expression, although this was not quantified. In the leaves, the expression was detected in the major and the first order veins (Fig. 6D) and in the hydathodes. In the roots, AtOPT7 was expressed in circular zones surrounding lateral root primordia (Fig. 6E) and in some parts of the root epidermis (Fig. 6F). Unlike AtOPT6, AtOPT7 was expressed in the cortical tissues of the stem but not in the conducting bundles (Fig. 6G). In the flowers, AtOPT7 was expressed at a low level in the sepals, but neither in the petals nor in the reproductive tissues (Fig. 6H).
Attempts to detect AtOPT6 expression by northern blot in Arabidopsis plants grown in normal conditions were unsuccessful (data not shown). The inductibility of AtOPT6 expression by various compounds was tested in Arabidopsis suspension cells. Because glutathione has been reported to be involved in resistance against biotic and abiotic stress, and more particularly against oxidative stress (Noctor and Foyer, 1998
Real-time RT-PCR was conducted on various organs of hydroponically grown Arabidopsis plants treated either by cadmium or primisulfuron. Both compounds were added in the liquid medium 36 h before the plants were collected. Cadmium treatment did not affect AtOPT6 expression in roots, leaves, and stems (Fig. 8), thus confirming the data obtained with suspension cells. By contrast, primisulfuron almost doubled the expression of AtOPT6 in roots and stems but had no significant effect in leaves.
Glutathione is known to chelate heavy metals (Perrin and Watt, 1971
The importance of peptide transport in plants and the small information available on this process have been recently underlined (Stacey et al., 2002a AtOPT6 and AtOPT7 were cloned by PCR and introduced in the yeast mutants ABC 817 (hgt1met15) and ABC 822 (hgt1) by a 2-µ high copy number vector. Unlike the yeast glutathione transporter HGT1, none of the plant homologs tested (AtOPT6, AtOPT7, OsGT1, BjGT1) was able to restore growth of the hgt1met15 mutant on a medium containing GSH and sulfate. By contrast, complementation by AtOPT6, but not by AtOPT7, was able to restore growth of the hgt1 mutant and to mediate uptake of [3H]GSH in a sulfur-free minimal medium (Figs. 1 and 2). This indicates that the ability of the plant genes to complement glutathione auxotrophy is sufficient only in a genetic background where the need for reduced sulfur compounds is not too strong.
In contrast with AtOPT7, expression of AtOPT6 in the ABC 822 hgt1 yeast strain restored its ability to grow on a sulfur-free minimal medium containing either GSH or GSSG as the sole sulfur source (Fig. 1). In agreement with a previous report (Koh et al., 2002
The ability of the ABC 822/pDR/AtOPT6 yeast to absorb GSH was confirmed by direct uptake measurements under the same conditions (Fig. 2). The characteristics of [3H]GSH uptake mediated by AtOPT6 expression in the yeast were essentially the same as those described previously for BjGT1 and OsGT1. The initial rate of uptake mediated by AtOPT6 was about 0.3 nmol GSH mg1 protein min1, compared to about 1 nmol GSH mg1 protein min1 for BjGT1 (Bogs et al., 2003
The substrate specificity of AtOPT6 was studied indirectly by measurements of [3H]GSH uptake in the presence of an excess of potential competitors. An excess of unlabeled GSH inhibited uptake of [3H]GSH only moderately (about 30%) due to the fact that GSH transport may be mediated by the low affinity phase and thus is not completely saturated at 5 mM. In spite of this limitation, the main features observed with OsGT1 (Zhang et al., 2004
Both AtOPT6 and AtOPT7 expression in the ABC 822 (hgt1
Koh et al. (2002)
The metabolism of both primisulfuron and ABA is mediated via glucosylation. It is thus unexpected that both compounds induce the expression of a transporter so far characterized as a glutathione transporter. However, the same situation has been described for the induction of ABC transporters of the multidrug resistance proteins family by xenobiotics. Tommasini et al. (1997)
In conclusion, these data and those described by Koh et al. (2002)
Cloning of AtOPT6 and AtOPT7 cDNAs The PCR experiments were performed using cDNA prepared from 21-d-old plants and the Pfu turbo polymerase (Promega, Madison, WI). The AtOPT6 cDNA (GenBank accession no. AL035602.1) was cloned by PCR using primers AtOPT6-forward (5'CTCTTCTAAAACGATGGGAGAG3') and AtOPT6-reverse (5'GTACAAAGCACTTGGTATATGC3'). The AtOPT7 (BAC clone T12H20, GenBank accession no. AF080119.1) coding sequence was cloned by PCR using primers AtOPT7-forward (5'GAAGACAACCATVGGAAGAATC3') and AtOPT7-reverse (5'GGTACCAAATCCAACCACC3'). The PCR products were cloned into the pGEM-T Easy (Promega) vector and entirely sequenced.
The 2.27-kb and 2.37-kb PCR fragments corresponding, respectively, to the open reading frame of AtOPT6 and AtOPT7 cDNAs were subcloned from the pGEM-T Easy vector into the EcoRI site of yeast expression vector pDR195 (AtOPT6) and into the NotI site of pDR196 (AtOPT7). The vectors pDR195 and pDR196 were kind gifts of Doris Rentsch (University of Bern, Switzerland).
The Saccharomyces cerevisiae strain ABC 822 bearing a deletion in HGT1 (MATa ura3-52 leu2-
SD-S medium was prepared according to DIFCO's Bacto yeast nitrogen base without amino acids and ammonium sulfate recipe (DIFCO Laboratories, Detroit), with the modification that all sulfur containing reagents were substituted with equal amounts of the corresponding chloride salt (Zhang et al., 2004
For growth assays in liquid and on solid medium, cells of ABC 822/pDR and ABC 822/pDR/AtOPT were grown overnight to an OD600 = 0.6 in minimal liquid SD medium containing ammonium sulfate and 2% Glc and the necessary amino acids. Uptake experiments were conducted as described by Zhang et al. (2004)
The yeast were grown in yeast nitrogen base (DIFCO Laboratories) supplemented with ammonium sulfate, 2% Glc, and necessary auxotrophic supplements until an OD600 of 0.6. Twenty-five milliliters of fresh medium were inoculated to reach an initial OD600 of 9.7 103. The yeast were grown on a rotary shaker (200 rpm) at 28°C, and the OD600 was monitored for about 100 h by sampling 500-µL aliquots. In some experiments, CdCl2 (50 µM, final concentration), GSH, or GSSG (500 µM) were added to the medium as described in the "Results" section. To check for glutathione auxotrophy, the yeasts were grown in SD-S liquid medium supplemented with either 500 µM GSH or GSSG.
Seeds of Arabidopsis (Columbia ecotype) were grown hydroponically in nonsterile conditions. Cell suspensions of Arabidopsis (ecotype Columbia, strain T87) were cultured as described previously (Axelos et al., 1992
The cultures were kept on a rotary shaker at 120 rpm and under 16-h photoperiod. Stress treatments were conducted 6 d after inoculation. Phytohormones (ABA) and growth regulators (2,4-D) were added at 10 µM (final concentration). The herbicide primisulfuron (80 nM), CdCl2 (50 µM), and hydrogen peroxide (5 mM) were directly administered into the culture medium. At the end of the treatment, plant cells were washed twice with deionized water and deep-frozen before RNA extraction. In another set of experiments, Arabidopsis plants were grown hydroponically. Primisulfuron (80 nM) and CdCl2 (50 µM) were added to the liquid medium 36 h before the plants (3 weeks old) were sampled.
Total RNA was isolated from yeasts as described by Logemann et al. (1987)
Real-time PCR-specific primers to AtOPT6 (forward, GAGTAGAACTCAATTCTTCTTAA; reverse, ACCAGAATTGATTTGGGATTGA) and to eIF1
The promoter regions of AtOPT6 and AtOPT7 were amplified by PCR from genomic DNA. Genomic DNA was prepared from whole plants using the Wizard kit (Promega). The primers used were: ProAtOPT6-forward, ATCCGTGTGGTCATTATTTAGC, and ProAtOPT6-reverse, GAGTGAGTGTTCCGTTCTTTG; ProAtOPT7-forward, TGTTTTCTT TCCTACCACTGG, and AtOPT7-reverse, CTTCTTCTTCTTCTTGCTCTG. Amplification allowed to recover a 2.4-kb and a 2.0-kb fragment of the AtOPT6 and AtOPT7 promoter regions, respectively. These fragments were subcloned into the pSK vector and sequenced. They were subcloned into the XbaI/SmaI cloning site of the pCB308 vector containing the uidA reporter gene sequence (Xiang et al., 1999 Sequence data from this article have been deposited with the EMBL/GenBank data libraries under accession numbers AL035602.1 and CAB38285.1 (AtOPT6), and AF080119 and AAC35527.1 (AtOPT7).
We thank Prof. Doris Rentsch (University of Bern, Switzerland) for gift of pDR plasmids, Prof. Alain Kitzis (University of Poitiers, France) for quantitative PCR facilities, and Dr. Nathalie Frangne (University of Poitiers, France) for help with GUS localization. Received January 28, 2004; returned for revision April 8, 2004; accepted April 13, 2004.
1 This work was supported by grants from the Indo-French Centre for the Promotion of Advanced Research and from the Association Franco-Chinoise pour la Recherche Scientifique et Technique.
2 Present address: Chinese Academy of Sciences, Plant Physiology Laboratory, Botanical Institute of South China, 510650 Leyigu Guangzhou, China. Article, publication date, and citation information can be found at www.plantphysiol.org/cgi/doi/10.1104/pp.104.039859. * Corresponding author; e-mail serge.delrot{at}univ-poitiers.fr; fax 33 (0)5 49 45 41 86.
Axelos M, Curie C, Mazzolini L, Bardet C, Lescure B (1992) A protocol for transient gene expression in Arabidopsis thaliana protoplasts isolated from cell suspension cultures. Plant Physiol Biochem 30: 123128 Bogs J, Bourbouloux A, Cagnac O, Wachter A, Rausch T, Delrot S (2003) Functional characterization and expression analysis of a glutathione transporter, BjGT1, from Brassica juncea: evidence for regulation by heavy metal exposure. Plant Cell Environ 26: 17031711[CrossRef]
Bourbouloux A, Shahi P, Chakladar A, Delrot S, Bachhawat AK (2000) Hgt1p, a high affinity glutathione transporter from the yeast Saccharomyces cerevisiae. J Biol Chem 275: 1325913265 Dantzig AH, Tabas LB, Bergin L (1992) Cefaclor uptake by the proton-dependent dipeptide transport carrier of human intestinal Caco-2 cells and comparison to cephalexin uptake. Biochim Biophys Acta 1112: 167173[Medline]
Guttierez-Alcala G, Gotor C, Meyer AJ, Fricker M, Vega JM, Romero LC (2000) Glutathione biosynthesis in Arabidopsis trichome cells. Proc Natl Acad Sci USA 97: 1110811113
Hauser M, Donhardt AM, Barnes D, Naider F, Becker JM (2000) Enkephalins are transported by a novel eukaryotic peptide uptake system. J Biol Chem 275: 30373041 Higgins CF, Payne JW (1977) Characterization of active dipeptide transport by germinating barley embryos: effects of pH and metabolic inhibitors. Planta 136: 7176[CrossRef] Hori R, Tomita Y, Katsura T, Yasuhara M, Inui KI, Takano M (1993) Transport of bestatin in rat renal brush-border membrane vesicles. Biochem Pharmacol 45: 17631768[CrossRef][ISI][Medline]
Koh S, Wiles AM, Sharp JS, Naider FR, Becker JM, Stacey G (2002) An oligopeptide transporter gene family in Arabidopsis. Plant Physiol 128: 2129 Logemann J, Schell J, Willmitzer L (1987) Improved method for the isolation of RNA from plant tissues. Anal Biochem 163: 1620[CrossRef][ISI][Medline]
Lu YP, Li ZS, Drozdowicz YM, Hörtensteiner S, Martinoia E, Rea PA (1998) AtMRP2, an Arabidopsis ATP binding cassette transporter able to transport glutathione S-conjugates and chlorophyll catabolites: functional comparisons with AtMRP1. Plant Cell 10: 267282
Lu YP, Li ZS, Rea PA (1997) AtMRP1 gene of Arabidopsis encodes a glutathione S-conjugate pump: isolation and functional definition of a plant ATP binding cassette transporter gene. Proc Natl Acad Sci USA 94: 82438248 Noctor G, Foyer CH (1998) Ascorbate and glutathione: keeping active oxygen under control. Annu Rev Plant Physiol Plant Mol Biol 49: 249279[CrossRef][ISI]
Noctor G, Gomez L, Vanacker H, Foyer CH (2002) Interactions between biosynthesis, compartmentation and transport in the control of glutathione homeostasis and signalling. J Exp Bot 53: 12831304 Perrin DD, Watt AE (1971) Complex formation of zinc and cadmium with glutathione. Biochim Biophys Acta 230: 96104[Medline] Rentsch D, Laloi M, Rouhara I, Schmelzer E, Delrot S, Frommer WB (1995) NTR1 encodes a high affinity oligopeptide transporter in Arabidopsis. FEBS Lett 370: 264268[CrossRef][ISI][Medline] Sambrook J, Fritsch EF, Maniatis T (1989) Molecular Cloning: A Laboratory Manual, Ed 2. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY Sanchez-Fernandez R, Ardiles-Diaz W, Van Montagu M, Inze D, May MJ (1998) Cloning and expression anamlyses of AtMRP4, a novel MRP-like gene from Arabidopsis thaliana. Mol Gen Genet 258: 655662[CrossRef][ISI][Medline] Sherman F (1991) Getting started with yeast. Methods Enzymol 194: 321[CrossRef][ISI][Medline] Song W, Koh S, Czako M, Marton L, Drenkard E, Becker JM, Stacey G (1997) Antisense expression of the peptide transport gene AtPTR2-B delays flowering and arrests seed development in transgenic Arabidopsis plants. Plant Physiol 114: 927935[Abstract] Song W, Steiner HY, Zang L, Naider F, Becker JM, Stacey G (1996) Cloning of a second Arabidopsis peptide transport gene. Plant Physiol 110: 171178[Abstract] Stacey G, Koh S, Granger C, Becker JM (2002a) Peptide transport in plants. Trends Plant Sci 7: 257263[CrossRef][ISI][Medline]
Stacey MG, Koh S, Becker JM, Stacey G (2002b) AtOPT3, a member of the oligopeptide transporter family is essential for embryo development in Arabidopsis. Plant Cell 14: 27992811 Steiner HY, Naider F, Becker JM (1995) The PTR family: a new group of peptide transporters. Mol Microbiol 16: 825834[CrossRef][ISI][Medline] Steiner HY, Song W, Zhang L, Naider F, Becker JM, Stacey G (1994) An Arabidopsis peptide transporter is a member of a new class of membrane transport proteins. Plant Cell 6: 12891299[Abstract] Tommasini R, Vogt E, Schmid J, Fromenteau M, Amrhein N, Martinoia E (1997) Differential expression of genes coding for ABC transporters after treatment of Arabidopsis thaliana with xenobiotics. FEBS Lett 411: 206210[CrossRef][Medline]
Vernoux T, Wilson RC, Seeley KA, Reichheld JP, Muroy S, Brown S, Maughan SC, Cobbett CS, Van Montagu M, Inze D, et al (2000) The root meristemless1/cadmium sensitive 2 gene defines a glutathione dependent pathway involved in initiation and maintenance of cell division during postembryonic root development. Plant Cell 12: 97110
Wintz H, Fox T, Wu YY, Feng V, Chen W, Chang HS, Zhu T, Vulpe C (2003) Expression profiles of Arabidopsis thaliana in mineral deficiencies reveal novel transporters involved in metal homeostasis. J Biol Chem 278: 4764447653 Xiang C, Han P, Lutziger I, Wang K, Oliver DJ (1999) A mini binary vector series for plant transformation. Plant Mol Biol 40: 711717[CrossRef][ISI][Medline]
Zhang MY, Bourbouloux A, Cagnac O, Shrikanth CV, Rentsch D, Bachhawat AK, Delrot S (2004) A novel family of transporters mediating the transport of glutathione derivatives in plants. Plant Physiol 134: 482491 This article has been cited by other articles:
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TAB |