|
|
||||||||
|
First published online July 9, 2004; 10.1104/pp.104.040899 Plant Physiology 135:1798-1808 (2004) © 2004 American Society of Plant Biologists The orf13 T-DNA Gene of Agrobacterium rhizogenes Confers Meristematic Competence to Differentiated Cells1Institute of Plant Sciences, University of Bern, CH3013 Bern, Switzerland (P.A.S., P.K., I.N., M.B., C.K.); Institut des Sciences Végétales, Centre National de la Recherche Scientifique, 91198 Gif-sur-Yvette, France (A.D.M.); and Friedrich Miescher Institut, CH-4058 Basel, Switzerland (C.F.)
Plant infections by the soil bacterium Agrobacterium rhizogenes result in neoplastic disease with the formation of hairy roots at the site of infection. Expression of a set of oncogenes residing on the stably integrated T-DNA is responsible for the disease symptoms. Besides the rol (root locus) genes, which are essential for the formation of hairy roots, the open reading frame orf13 mediates cytokinin-like effects, suggesting an interaction with hormone signaling pathways. Here we show that ORF13 induced ectopic expression of KNOX (KNOTTED1-like homeobox) class transcription factors, as well as of several genes involved in cell cycle control in tomato (Lycopersicon esculentum). ORF13 has a retinoblastoma (RB)-binding motif and interacted with maize (Zea mays) RB in vitro, whereas ORF13, bearing a point mutation in the RB-binding motif (ORF13*), did not. Increased cell divisions in the vegetative shoot apical meristem and accelerated formation of leaf primordia were observed in plants expressing orf13, whereas the expression of orf13* had no influence on cell division rates in the shoot apical meristem, suggesting a role of RB in the regulation of the cell cycle in meristematic tissues. On the other hand, ectopic expression of LeT6 was not dependent on a functional RB-binding motif. Hormone homeostasis was only altered in explants of leaves, whereas in the root no effects were observed. We suggest that ORF13 confers meristematic competence to cells infected by A. rhizogenes by inducing the expression of KNOX genes and promotes the transition of infected cells from the G1 to the S phase by binding to RB.
Plant pathogens change the differentiation program of plant cells to create a protected surrounding with nutrient availability. Agrobacterium tumefaciens and Agrobacterium rhizogenes infect wounds of several dicotyledonous and some monocotyledonous species and thereby generate tumorous outgrowths at the site of infection (Nilsson and Olsson, 1997
In addition to the rol genes, orf13 is encoded on the T-DNA of A. rhizogenes. The sequence of orf13 is highly conserved in the agropine-, mannopine-, cucumopine-, and mikimopine-type Ri plasmids, and two plant counterparts were found in tobacco (Nicotiana tabacum [torf13]) and in tree tobacco (Nicotiana glauca [NgORF13]; Aoki et al., 1994
Besides hormonal actions of the ORF13 protein in plants, an influence on cell proliferation has been reported. Carrot discs inoculated with Agrobacterium carrying 35S::orf13 developed dark green callus (Fründt et al., 1998
Orf13 expression leads to the formation of spikes (protrusions between minor veins) on leaves and petals of tobacco (Meyer et al., 2000
This study aims to characterize the effect of orf13 expression on cell cycle control and KNOX expression in plants expressing orf13 ectopically. The function of the RB-binding motif LxCxE in the ORF13 protein was analyzed. For that reason, the orf13 gene with a point mutation in the RB-binding site was ectopically expressed in plants and the plant phenotype was compared to plants expressing the nonmutated orf13 gene. In our study, we have chosen tomato (Lycopersicon esculentum) plants, because the meristem is easily accessible and leaf form is compound. Furthermore, the function of the KNOX genes in leaf formation is well described in tomato (Hareven et al., 1996
The ORF13 Protein Binds to the RB via the LxCxE Motif In Vitro To address the question of whether ORF13 is capable of physical interaction with the cell cycle regulating RB, the LxCxE motif of the mannopine-type pRi8196 was changed into LxAxK via site-directed mutagenesis. Both versions were expressed in Escherichia coli as recombinant proteins with 6-His tags and assayed for copurification in pull-down experiments with recombinant human glutathione S-transferase (GST)-RB fusions attached to glutathione Sepharose beads. The binding assay (Fig. 1) showed that the ORF13 protein with a native LxCxE sequence (ORF13) could bind to pRb with an intact C(706), but not to the pRb mutated in C(706), pRb(C706F). ORF13 harboring the LxAxK motif (ORF13*) was unable to bind pRb in this assay, indicating that the LxCxE motif in pORF13 is functional and that the pORF13-pRb interaction depends on the same C(706) in pRb as for D-type cyclins and adenoviral oncoproteins (Fig. 1).
Effect of the Functional RB-Binding Motif in ORF13 on Plant Development To test the hypothesis that phenotypic alterations in orf13-expressing plants were due to the interaction of ORF13 with RB, either the orf13 gene with the LxCxE RB-binding motif (orf13) or the orf13 gene with the LxAxK motif (orf13*), both driven by the cauliflower mosaic virus 35S promoter, were introduced into tomato plants. Six independently transformed lines with comparable phenotypes were obtained for orf13 and five independently transformed lines with comparable phenotypes were obtained for orf13*. Two lines of each (L1 and L2) were used for further investigation. Orf13-expressing plants had a reduced growth in height and developed fewer leaves before entering the reproductive stage (Table I; Fig. 2A). Flowering was advanced. In control plants, lateral branch outgrowth was first observed at the time of flower induction. However, in orf13-expressing plants, the apical dominance was lost before the onset of flowering and the rate of lateral branch development was increased (Table I). Also orf13* plants had stunted growth and a reduced apical dominance, comparable to orf13 plants, whereas the number of leaves formed before flowering and the flowering time of orf13* plants were comparable to controls and differed from orf13 plants (Table I).
Leaf size was reduced in orf13-expressing plants, but the size of leaf epidermal cells was unchanged (Fig. 2B; Table I). On the adaxial side of leaves, the formation of spikes was observed (Fig. 2D; Table I). Transverse sections of leaves were made at the site of spike formation (Fig. 2, LN). In leaf spikes, the palisade parenchyma consisted of multiple cell layers with small isodiametric cells (Fig. 2, M and N), whereas in control leaves the palisade parenchyma consisted of one cell layer with elongated cells (Fig. 2L). Spikes frequently formed also on sepals, petals, and fruits. Sepal and petal numbers were increased in orf13 plants (Fig. 2, I and J; Fig. 3, A and B). Also, orf13* plants formed spikes on leaves, sepals, petals, and fruits (Table I), but orf13* expression had no influence on leaf size (Fig. 2B; Table I), as well as on sepal and petal numbers (Fig. 2K; Fig. 3, A and B).
Shoot architecture of orf13-expressing plants differed from wild type. Phyllotaxis was occasionally changed from spiral to irregular (data not shown). Leaves were often wrinkled, and the arrangement of lateral and intercalary leaflets was changed (Fig. 2, B, C, and F). The terminal leaflet was occasionally replaced by an outgrowth of the rachis (Fig. 2, B and E). Stems and petioles were frequently fasciated and petioles were fused to the main stem (Fig. 2, G and H). Whereas phyllotaxis and the arrangement of lateral and intercalary leaflets were normal in orf13* plants (Fig. 2B), organ fasciation and fusion were also observed (data not shown). In contrast to the shoot, ORF13 had only minor effects on root growth. Whereas root length was not significantly different between orf13-expressing and control plants, the dry weight was slightly reduced when orf13 was expressed. Furthermore, root structure was similar to control plants. Orf13* expression had no effect on root growth (data not shown). The differences obtained in organ numbers and organ size in orf13 but not in orf13* plants compared to controls indicate that the interaction of ORF13 with RB had an influence on plant growth. On the other hand, shoot morphology and architecture seem to be altered in a non-RB-dependent way, since no difference between orf13 and orf13* plants was observed. Thus ORF13 had RB-dependent, but also RB-independent, effects on plant growth and development.
Morphological changes observed in plants expressing orf13 were similar to changes in tobacco caused by elevated cytokinin levels (Medford et al., 1989
Several bioassays were carried out to characterize the effects of orf13 expression on cytokinin and auxin homeostasis. Root growth and lateral root formation are known to depend on auxin (Davies, 1995
Cytokinins are known to retard senescence (Gan and Amasino, 1995
Shoots or roots can be regenerated from leaf discs when cultivated on appropriate concentrations of auxin and cytokinin. The addition of auxin favors root production, whereas cytokinins induce callus and shoot growth (Skoog and Miller, 1957
To test the hypothesis that ORF13 might interact with cell cycle regulation, the mitotic index of the shoot apical meristem (SAM), as well as the rate of leaf primordium production, was determined. In addition, expression levels of several cell cycle genes were measured in expanded leaves by semiquantitative reverse transcription (RT)-PCR. The structure of the SAM was not changed in orf13-expressing plants and layer organization was not disturbed (Fig. 4, A and B). Meristem diameter and cell size were comparable between transgenic and control plants (Table II). In plastic sections, mitotic figures were frequently observed in meristems of orf13-expressing plants (Fig. 4C). Orf13-expressing SAMs, but not orf13* SAMs, had an increased mitotic index (Table II). The expression pattern of histone H4 in meristems and young leaf primordia was visualized by in situ hybridization techniques. The intensity of staining for histone H4 expression (marker for the S phase of the cell cycle) was increased in the vegetative meristem as well as in young primordia when the orf13 gene was expressed (Fig. 4, D and E). In culture, orf13-expressing meristems formed more leaf primordia in 8 d than controls and orf13* plants (Table II). Taken together, ORF13, but not ORF13*, had a positive effect on the rate of cell divisions in the SAM and on leaf formation.
To test the influence of orf13 expression on the cell cycle activity in differentiated cells, the relative abundance of expression of several genes involved in cell cycle control was measured in the terminal leaflet of the second leaf of 3-week-old plants. The mRNA of RB, E2F, cyclinD3.1, cyclinD3.3, and histone H4 were elevated when orf13 was expressed compared to control plants, whereas expression levels of the small subunit of Rubisco (rbcS) and of rpl2, as well as total RNA contents, were comparable in control and orf13 plants (Fig. 4F). Elevated contents of the mRNA of the cell-cycle-regulating genes were also observed in orf13*, although the increase was stronger in orf13. These data suggest a higher cell division activity in cells of expanding leaves in the presence of orf13 expression. Whereas an increase of E2F, cyclinD3.1, and histone H4 mRNA suggest a higher cell cycle activity, elevated RB expression is expected to be found in cells of differentiating tissue. The changes in RB levels, due to orf13 expression, indicate a perturbation of its normal functioning. Elevated levels of RB expression were also observed in Arabidopsis plants overexpressing cyclinD3.1 (Dewitte et al., 2003
Mitotic activity in the division zone of the main root was visualized by expressing the cyclinB1.1::GUS construct, including a mitotic destruction box (Colon-Carmona et al., 1999
The accumulation of nondifferentiated cells in the spikes of orf13-expressing plants led us to investigate the expression of several KNOX-class transcription factors. The class I KNOX transcription factors LeT6 and TKN1 are normally restricted to the SAM and to young leaflet primordia (Hareven et al., 1996
We have investigated the influence of ectopic orf13 expression on tomato plant growth, focusing on cell cycle control and KNOX-class transcription factor regulation. It has previously been proposed that orf13 encodes a growth regulator that shares properties with cytokinins (Hansen et al., 1993
In our investigation, we were able to observe a proliferative effect of orf13 expression in the SAM, where an increased number of mitoses was detected (Table II). This had no influence on meristem structure. In addition, the formation of leaf primordia was enhanced in orf13-expressing plants. The increased number of mitoses could be a consequence of the accumulation of cells in mitosis. Dewitte et al. (2003)
A smaller leaf size was observed in orf13 but not in orf13*-expressing plants. This is due to an earlier cessation of leaf growth and not to a reduced size of leaf cells, since the number of epidermal leaf cells per square millimeter was comparable to the number of cells in control and orf13* leaves (Table I). Wyrzykowska et al. (2002)
Coordinated plant development requires controlled interaction of cell growth, cell division, and cell differentiation. Cell differentiation is often accompanied by a reduction of division activity. The cyclinD/RB/E2F pathway has been proposed to regulate the timing of cell cycle exit in relation to cell differentiation (de Veylder et al., 2002
Ectopic expression of the KNOX-class transcription factors LeT6, LeT12, and TKN4 was observed in leaves of orf13- and orf13*-expressing tomato plants, suggesting a non-RB-dependent influence of orf13 on KNOX gene expression (Fig. 5). The same was true for the formation of spikes, stunted growth, loss of apical dominance, fusion of organs, and stem fasciation. We interpret these changes to be a consequence of ectopic expression of KNOX genes. A relationship between KNOX gene expression and cytokinin contents was shown. Overexpression of KNOX genes increased cytokinin levels in different plant species (Kusaba et al., 1998
A. rhizogenes generates its living environment by changing the genetic program of infected plant cells, which start to produce nutrients for the bacteria and develop adventitious roots. The genetic program change is encoded on the bacterial T-DNA and has to be integrated into plant cells and replicated therein. For plant geminiviruses, an efficient method was described to subvert host cell cycle machinery and facilitate their replication (Gutierrez, 2000
Cloning of the orf13 Gene and Mutagenesis
The full-length orf13 was amplified by PCR from pRi8196 (accession no. M60490; Hansen et al. 1991
PBi121ORF13LCE and pBi121ORFLAK were introduced into Agrobacterium tumefaciens strain LBA4404. For plant transformation, cotyledon leaf discs of tomato plants (Lycopersicon esculentum cv Moneymaker) were soaked in YEB solution containing the transgenic A. tumefaciens for 1 min and then transferred to plates containing 1x Murashige and Skoog (MS) medium, 3% Suc, 1x vitamin B5, pH 5.8, 8% agarose (MS medium) supplied with 120 µg L1 naphthalene-L-acetic acid (NAA) and 1 mg L1 6-benzylaminopurine, and were incubated in the dark for 48 h. Then leaf discs were transferred to MS medium containing zeatin (2 mg mL1) at 18-h-light, 6-h-dark cycles at 23°C. When shoots emerged from leaf discs, they were transferred to MS medium lacking zeatin for rooting. Appropriate antibiotics were added to growing media for the selection of the integrated gene.
Tomato plants were also transformed with the cyclinB1.1::GUS construct (Colon-Carmona et al., 1999
Tomato plants were grown in soil (16-h-light, 8-h-dark cycles, at 25°C and 60% humidity). Pictures were taken with a Nikon (Tokyo) digital camera (Coolpix 5000). Scanning electron microscopy (SEM) pictures were made with a variable-pressure scanning electron microscope (model S-3500 N; Hitachi, Tokyo). Leaf area of the third leaf of 3-week-old plants was measured with an area meter (DELTA-T DEVICES). For analyses of epidermal leaf cells, the adaxial side of the terminal leaflet of the third leaf from the bottom 28 d after sowing was visualized by SEM and cells were counted. Plastic sections were prepared as described previously (Loreto et al., 2001
For tissue culture experiments, primary leaves of tomato plants were sterilized (ethanol 70% for 1 min, bleach for 7 min) and leaf discs were incubated on plates containing MS medium with different concentrations of hormones added to the medium (NAA, 010 µM, zeatin, 010 µM). Leaf discs that had formed callus or roots were counted 10 d after incubation. For the GUS histochemical assay, roots were prefixed in 50 mM NaPO4, pH 7.0, containing 8% (v/v) formaldehyde and 0.25% (v/v) glutaraldehyde for 45 min and incubated in staining solution (50 mM NaPO4, pH 7.0, 0.5 mg mL1 X-gluc, 1 mM K4Fe(CN)6, and 1 mM K3Fe(CN)6) for 10 to 16 h at 37°C. GUS staining was visualized with a Sony (Tokyo) camera attached to a Nikon microscope.
Tissue fixation, sectioning, and in situ hybridization with the histone H4 and LeT6 probes were as described by Fleming et al. (1993)
RNA of expanded leaves of 3- and 4-week-old plants was extracted as described by Caderas et al. (2000)
Synthesis of cDNA from tobacco leaf RNA was performed as described. Degenerate primers for the RB sequence were designed (FW: 5'-TGTAAGCACAGCGATGACAACT, REV: 5'-GTACATTGAAGATCCTTTTTCCCA), and PCR was carried out with tobacco cDNA. The resulting fragment was purified (NucleoSpin Extract, Marcherey-Nagel, Duren, Germany), cloned into pBluescript SK (-), and sequenced. The resulting sequence (5'-AATTGGGTACCGGGCCCCCCCTCGAGGTCGACGGTATCGATAAGCTTGATTGTAAGCACAGCGATGACAACTGCCAGGTGGCTGCGTACCGTCATAGCTCCACTACAGGCAAAACCTTCACCTGAGTTGGAGAGATTTTTGTCTGCCTGTGATAGGAATGTATCAGCTGATGTGATCCGGAGGGCTCACATTATTCTGGAGGCTATATTTCCAAGTAGTGGTCCTGGGGAGCATTGTGCGGCTGGGAGCCTGCAAAGCACAAGCTTAATGGACAACATATGGGCAGAGCAACGTAGATCTGAGTCTCTGAAGTTGTATTATAGGGTTCTGCAGACTATGTGTGTCGCAGAATCTCAGATTTTGCATGTGACCAATTTAACTTCGTTGCTAACCAATGAGAGGTTTCATAGATGTATGCTTGCCTGCTCAGCTGAACTAGTTCTTGCCACTCACAAGACAGTTACAATGTTGTTTCCAGCTGTTTTGGAGAGAACAGGAATTACATCTTTTGATCTCAGTAAGGTGATAGAGAGCTTCATCAGGCATGAAGAAAGTCTTCCTCGAGAACTGAGACGCCATTTGAATTCACTCGAAGAAAGACTCTTGGAGAGCATGGTTTG) has 91% identity to NtRb1 (accession no. AB015221).
Recombinant proteins were produced in Escherichia coli strain M15 (Qiagen) and the pull-down assay performed according to the procedure of Groisman and collaborators (Groisman et al., 1996 Sequence data from this article have been deposited with the EMBL/GenBand data libraries under accession numbers M60490, TC105867, CAB51788, X05983, AJ002590, AF000141, X69179, AB015221, X64562, U32247, AF000142, and AF533597.
We thank Therese Mandel (Institute of Plant Sciences, University of Bern, Switzerland) for technical support and Peter Doerner (Salk Institute for Biological Studies, La Jolla, CA) for the cyclinB1::GUS construct. We also thank Thomas Schmülling (Institute of Biology/Applied Genetics, Freie Universitat Berlin, Germany), Samuel Zeeman and Didier Reinhardt (both Institute of Plant Sciences, University of Bern, Switzerland) for critical reading of the manuscript, and our colleagues in the laboratory for stimulating discussions. Received February 12, 2004; returned for revision April 26, 2004; accepted May 2, 2004.
1 This work was supported by a Marie-Heim-Vögtlin fellowship (SNF 3155540.98, EU QLK5CT200000357, and SNFTMR 83 EU050209 to P.A.S.).
2 Present address: Physiologie Végétale University of Neuchâtel, Rue Emile Argand 13, CH2007 Neuchâtel, Switzerland.
3 Present address: Advolis Life Science Concepts, Oetlingerstrasse 10, CH4057 Basel, Switzerland.
4 Present address: Novartis Pharma AG, CH4002 Basel, Switzerland. Article, publication date, and citation information can be found at www.plantphysiol.org/cgi/doi/10.1104/pp.104.040899. * Corresponding author; e-mail cris.kuhlemeier{at}ips.unibe.ch; fax 41316314942.
Aoki S, Kawaoka A, Sekine M, Ichikawa T, Fjita T, Shinmyo A, Syono K (1994) Sequence of the cellular T-DNA in the untransformed genome of Nicotiana glauca that is homologous to ORFs 13 and 14 of the Ri plasmid and analysis of its expression in genetic tumors of N. glauca x N. langsdorffii. Mol Gen Genet 243: 706710[ISI][Medline]
Caderas D, Muster M, Vogler H, Mandel T, Rose JKC, McQueen-Mason S, Kuhlemeier C (2000) Limited correlation between expansin gene expression and elongation growth rate. Plant Physiol 123: 13991413
Celenza JL, Grisafi PL, Fink GR (1995) A pathway for lateral root formation in Arabidopsis thaliana. Genes Dev 9: 21312142 Chen J-J, Janssen B-J, Williams A, Sinha N (1997) A gene fusion at a homeobox locus: alterations in shape and implications for morphological evolution. Plant Cell 9: 12891304[Abstract] Chuck G, Lincoln C, Hake S (1996) KNAT1 induces lobed leaves with ectopic meritems when overexpressed in Arabidopsis. Plant Cell 8: 12771289[Abstract] Cockcroft CE, den Boer BGW, Healy JMS, Murray JAH (2000) Cyclin D control of growth rate in plants. Nature 405: 575579[CrossRef][Medline] Colon-Carmona A, You R, Haimovitch-Gal T, Doerner P (1999) Spatio-temporal analysis of mitotic activity with a labile cyclin-GUS fusion protein. Plant J 20: 503508[CrossRef][ISI][Medline] Davies PJ (1995) The plant hormones: their nature, occurrence and functions. In PJ Davies, ed, Plant Hormones: Physiology, Biochemistry and Molecular Biology. Kluwer Academic, Dordrecht, The Netherlands, pp 112 De Veylder L, Beeckman T, Beemster GTS, Engler JDA, Ormenese S, Maes S, Naudts M, Van Der Schueren E, Jacqmard A, Engler G, et al (2002) Control of proliferation, endoreduplication and differentiation by the Arabidopsis E2Fa-Dpa transcription factor. EMBO J 21: 13601368[CrossRef][ISI][Medline]
Dewitte W, Riou-Khamlichi C, Scofield S, Healy JMS, Jacqmard A, Kilby NJ, Murray JAH (2003) Altered cell cycle distribution, hyperplasia, and inhibited differentiation in Arabidopsis cased by the D-type cyclin CYCD3. Plant Cell 15: 7992
Du W, Vidal M, Xie J-E, Dyson N (1996) RBF, a novel RB-related gene that regulates E2F activity and interacts with cyclin E in Drosophila. Genes Dev 10: 12061218 Estruch JJ, Schell J, Spena A (1991) The protein encoded by the rolB plant oncogene hydrolyses indole glucosides. EMBO J 10: 31253128[ISI][Medline] Fleming AJ, Mandel T, Roth I, Kuhlemeier C (1993) The patterns of gene expression in the tomato shoot apical meristem. Plant Cell 5: 297309[Abstract]
Frugis G, Giannino D, Mele G, Nicolodi C, Chiappetta A, Bitonti MB, Innocenti AM, Dewitte W, Van Onckelen V, Mariotti D (2001) Overexpression of KNAT1 in lettuce shifts leaf determinate growth to a shoot-like indeterminate growth associated with an accumulation of isopentenyl-type cytokinins. Plant Physiol 126: 13701380 Fründt C, Meyer AD, Ichikawa T, Meins F (1998) A tobacco homologue of the Ri-plasmid orf13 gene causes cell proliferation in carrot root discs. Mol Gen Genet 259: 559568[CrossRef][ISI][Medline]
Gan S, Amasino RM (1995) Inhibition of leaf senescence by autoregulated production of cytokinin. Science 270: 19861988
Groisman R, Masutani H, Leibovitch MP, Robin P, Soudant I, Trouche D, Harel-Bellan A (1996) Physical interaction between the mitogen-responsive serum response factor and myogenic basic-helix-loop-helix proteins. J Biol Chem 271: 52585264 Gutierrez C (2000) DNA replication and cell cycle in plants: learning from geminiviruses. EMBO J 19: 792799[CrossRef][ISI][Medline]
Hansen G, Larribe M, Vaubert D, Tempe J, Biermann BJ, Montoya AL, Chilton MD (1991) Agrobacterium rhizogenes pRi8196 T-DNA: mapping and DNA sequence of functions involved in mannopine synthesis and hairy root differentiation. Proc Natl Acad Sci USA 88: 77637767 Hansen G, Vaubert D, Heron JN, Clerot D, Tempe J, Brevet J (1993) Phenotypic effects of overexpression of Agrobacterium rhizogenes T-DNA ORF13 in transgenic tobacco plants are mediated by diffusible factors. Plant J 4: 581585 Hareven D, Gutfinger T, Parnis A, Eshed Y, Lifschitz E (1996) The making of a compound leaf: genetic manipulation of leaf architecture in tomato. Cell 84: 735744[CrossRef][ISI][Medline] Hewelt A, Prinsen E, Thomas M, Van Onckelen H, Meins F (2000) Ectopic expression of maize knotted1 results in the cytokinin-autotrophic growth of cultured tobacco tissues. Planta 210: 884889[CrossRef][ISI][Medline]
Horowitz JM, Yandell DW, Park SH, Canning S, Whyte P, Buchkovich K, Harlow E, Weinberg RA, Dryja TP (1989) Point mutational inactivation of the retinoblastoma antioncogene. Science 243: 937940
Kaelin WG, Ewen ME, Livingston DM (1990) Definition of the minimal simian virus 40 large T antigen- and adenovirus E1A-binding domain in the retinoblastoma gene product. Mol Cell Biol 10: 37613769 Kaelin WG, Pallas DC, DeCaprio JA, Kaye FJ, Livingston DM (1991) Identification of cellular proteins that can interact specifically with the T/E1A-binding region of the retinoblastoma gene product. Cell 64: 521532[CrossRef][ISI][Medline]
Kelly MO, Bradford KJ (1986) Insensitivity of the diageotropica tomato mutant to auxin. Plant Physiol 82: 713717 Kong L-J, Orozco BM, Roe JL, Nagar S, Ou S, Feiler HS, Durfee T, Miller AB, Gruissem W, Robertson D, et al (2000) A geminivirus replication protein interacts with the retinoblastoma protein through a novel domain to determine symptoms and tissue specificity of infection in plants. EMBO J 19: 34853495[CrossRef][ISI][Medline]
Kürsteiner O, Dupuis I, Kuhlemeier C (2003) The pyruvate decarboxylase1 gene of Arabidopsis is required during anoxia but not other environmental stresses. Plant Physiol 132: 968978
Kusaba S, Kano-Murakami Y, Matsuoka M, Tamaoki M, Sakamoto T, Yamaguchi I, Fukumoto M (1998) Alteration of hormone levels in transgenic tobacco plants overexpressing the rice homeobox gene OSH1. Plant Physiol 116: 471476 Laemmli UK (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227: 680685[CrossRef][Medline] Lemcke K, Schmülling T (1998) Gain of function assays identify non-rol genes from Agrobacterium rhizogenes TL-DNA that alter plant morphogenesis or hormone sensitivity. Plant J 15: 423433[Medline]
Lincoln C, Long J, Yamaguchi J, Serikawa K, Hake S (1994) A knotted-like homeobox gene in Arabidobsis is expressed in the vegetative meristem and dramatically alters leaf morphology when overexpressed in transgenic plants. Plant Cell 6: 18591876 Long JA, Moran EI, Medford JI, Barton MK (1996) A member of the KNOTTED class of homeodomain proteins encoded by the STM gene of Arabidopsis. Nature 379: 6669[CrossRef][Medline]
Loreto F, Mannozzi M, Maris C, Nascetti P, Ferranti F, Pasqualini S (2001) Ozone quenching properties of isoprene and its antioxidant role in leaves. Plant Physiol 126: 9931000
Medford JI, Horgan R, El-Sawi Z, Klee HJ (1989) Alterations of endogenous cytokinins in transgenic plants using a chimeric isopentenyl transferase gene. Plant Cell 1: 403413 Meyer A, Tempé J, Costantino P (2000) Hairy root; a molecular overview. Functional analysis of Agrobacterium rhizogenes T-DNA genes. In G Stacey, NT Keen, eds, Plant Microbe Interactions. APS Press, St. Paul, pp 93139
Mironov V, De Veylder L, Van Montagu M, Inzé D (1999) Cyclin-dependent kinases and cell division in plants: the nexus. Plant Cell 11: 509521 Murray JAH (1997) The retinoblastoma protein is in plants. Trends Plant Sci 2: 8284 Nilsson O, Olsson O (1997) Getting to the root: the role of the Agrobacterium rhizogenes rol genes in the formation of hairy roots. Physiol Plant 100: 463473[CrossRef] Quirino BF, Noh Y-S, Himelblau E, Amasino RM (2000) Molecular aspects of leaf senescence. Trends Plant Sci 5: 278282[CrossRef][ISI][Medline]
Reinhardt D, Frenz M, Mandel T, Kuhlemeier C (2003) Microsurgical and laser ablation analysis of interactions between the zones and layers of the tomato shoot apical meristem. Development 130: 40734083
Reed RC, Brady SR, Muday GK (1998) Inhibition of auxin movement from the shoot into the root inhibits lateral root development in Arabidopsis. Plant Physiol 118: 13691378
Riou-Khamlichi C, Huntley R, Jacqmard A, Murray JAH (1999) Cytokinin activation of Arabidopsis cell division through a D-type cyclin. Science 283: 15411544 Rupp HM, Frank M, Werner T, Strnad M, Schmülling T (1999) Increased steady state mRNA levels of the STM and KNAT1 homeobox genes in cytokinin overproducing Arabidopsis thaliana indicate a role for cytokinins in the shoot apical meristem. Plant J 18: 557563[CrossRef][ISI][Medline] Sentoku N, Sato Y, Matsuoka M (2000) Overexpression of rice OSH genes induces ectopic shoots on leaf sheaths of transgenic rice plants. Dev Biol 220: 358364[CrossRef][ISI][Medline]
Sinha N, Williams R, Hake S (1993) Overexpression of the maize homeobox gene, KNOTTED-1, causes a switch from determinate to indeterminate cell fates. Genes Dev 7: 787795 Skoog F, Miller CO (1957) Chemical regulation of growth and organ formation in plant tissues cultured in vitro. Symp Soc Exp Biol 11: 118131
Slightom JL, Durand-Tardif M, Jouanin L, Tepfer D (1986) Nucleotide sequence analysis of the TL_DNA of Agrobacterium rhizogenes agropine type plasmid. J Biol Chem 261: 108121 Weinberg RA (1995) The retinoblastoma protein and cell cycle control. Cell 81: 323330[CrossRef][ISI][Medline]
White FF, Taylor BH, Huffman GA, Gordon MP, Nester EW (1985) Molecular and genetic analysis of the transferred DNA regions of the root-inducing plasmid of Agrobacterium rhizogenes. J Bacteriol 164: 3344 Wyrzykowska J, Pien S, Shen WS, Fleming AJ (2002) Manipulation of leaf shape by modulation of cell division. Development 129: 957964
Zhu J, Oger PM, Schrammeijer B, Hooykaas PJJ, Farrand SK, Winans SC (2000) The bases of crown gall tumorigenesis. J Bacteriol 182: 38853895 Zobel RW (1974) Control of morphogenesis in the ethylene-requiring tomato mutant, diageotropica. Can J Bot 52: 735741 Zupan J, Muth TR, Draper O, Zambryski P (2000) The transfer of DNA from Agrobacterium tumefaciens into plants: a feast of fundamental insights. Plant J 23: 1128[CrossRef][ISI][Medline] This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||