|
|
||||||||
|
Plant Physiology 135:1879-1887 (2004) © 2004 American Society of Plant Biologists Use of the Fluorescent Timer DsRED-E5 as Reporter to Monitor Dynamics of Gene Activity in Plants1Wageningen University, Department of Plant Sciences, Laboratory of Molecular Biology, 6703 HA, Wageningen, The Netherlands
Fluorescent proteins, such as green fluorescent protein and red fluorescent protein (DsRED), have become frequently used reporters in plant biology. However, their potential to monitor dynamic gene regulation is limited by their high stability. The recently made DsRED-E5 variant overcame this problem. DsRED-E5 changes its emission spectrum over time from green to red in a concentration independent manner. Therefore, the green to red fluorescence ratio indicates the age of the protein and can be used as a fluorescent timer to monitor dynamics of gene expression. Here, we analyzed the potential of DsRED-E5 as reporter in plant cells. We showed that in cowpea (Vigna unguiculata) mesophyll protoplasts, DsRED-E5 changes its fluorescence in a way similar to animal cells. Moreover, the timing of this shift is suitable to study developmental processes in plants. To test whether DsRed-E5 can be used to monitor gene regulation in plant organs, we placed DsRED-E5 under the control of promoters that are either up- or down-regulated (MtACT4 and LeEXT1 promoters) or constitutively expressed (MtACT2 promoter) during root hair development in Medicago truncatula. Analysis of the fluorescence ratios clearly provided more accurate insight into the timing of promoter activity.
Reporter genes are useful tools to study gene expression in transformed organisms. The most widely used reporters in plants are uidA ( -glucuronidase [GUS]; Jefferson et al., 1987
Derivatives of the Aequorea victoria GFP (e.g. eGFP, RS-smGFP; Cormack et al., 1996
Although GFP and DsRED are very useful reporter genes in living cells, their high stability (half life of GFP approximately 1 d and of DsRED1 approximately 4.6 d; Verkhusha et al., 2003 Here we studied the potential of DsRED-E5 as a reporter gene in plants. We used a transient expression system, cowpea (Vigna unguiculata) mesophyll protoplasts, to determine its fluorescent properties (e.g. color conversion over time) in plant cells. Further, we investigated whether DsRED-E5 can visualize dynamics of promoter activity in Medicago truncatula root hairs.
Characterization of DsRED-E5 Fluorescence in Cowpea Mesophyll Protoplasts To characterize the fluorescent properties of DsRED-E5 in plant cells, we cloned the DsRED-E5 coding region in the vector pMon999e35S, carrying the constitutive cauliflower mosaic virus (CaMV) 35S promoter. The resulting 35S::DsRED-E5 transgene was transiently expressed in cowpea mesophyll protoplasts isolated from leaf tissue. After transfection, protoplasts were analyzed for green and red fluorescence over time by confocal laser scanning microscopy (CLSM; see "Materials and Methods" and below for more details). Protoplasts carrying the 35S::DsRED-E5 construct became fluorescent 9 to 10 h after transfection (Fig. 1A). At this time point, only green fluorescence was detectable (Fig. 1A). Red fluorescence appeared in these protoplasts 14 to 15 h after transfection (Fig. 1B) and increased in intensity over time (Fig. 1, C and D). These data show that DsRED-E5 shifts its fluorescence from green to red over time in plant cells also, suggesting that DsRED-E5 is suitable to study dynamic processes in plants.
To obtain a better idea of the timing of DsRED-E5 fluorescence maturation in plants, we determined the ratio between the green and the red fluorescence intensities in the DsRED-E5 expressing protoplasts at different time points after transfection. This ratio will be defined as G/R. The optimal wavelengths to excite the green and the red form of dsRED-E5 are 488 nm and 558 nm, respectively. Alternatively, a single excitation wavelength can be used to excite both forms due to the overlap of their excitation spectra. The use of two different wavelengths to excite dsRED-E5 (488 nm and 543 nm) has major disadvantages. A pronounced photobleaching of DsRED-E5 was observed, especially at the high laser power required to excite DsRED-E5 in root hairs (see below). This photobleaching would affect the fluorescence intensity measured after excitation with the second laser, and therefore the data would be unreliable. Further, the use of two lasers to excite DsRED-E5 could lead to variations in the fluorescence intensities due to laser instability over time. The use of a single excitation wavelength for both emitting forms will overcome these problems. Therefore, we decided to use a single argon laser (488 nm) to excite both the green and the red emitting form of DsRED-E5.
The green emitting form of DsRED-E5 has a broad emission spectrum that extends from 475 to 625 nm and is similar to that of GFP (Tsien, 1998
To determine G/R in the DsRED-E5 expressing protoplasts, approximately 20 protoplasts for each time point were analyzed by CLSM. Within a transfection experiment, protoplasts show a high heterogeneity of signal intensity. To determine G/R, protoplasts were randomly selected and therefore they express DsRED-E5 at different levels. The green and red fluorescences were corrected for the background signal observed in nontransfected protoplasts as well as for the above described bleed-through in the red channel. About 10 h after transfection, G/R was between 15 and 10 (12 ± 2.3 [SD]; n = 20; Fig. 1A) and subsequently decreased in time reaching a value of 1 (1 ± 0.6; n = 22) at approximately 40 h after transfection (Fig. 1C). From this time point on, G/R was lower than 1 and reached the lowest value of 0.17 (0.17 ± 0.02; n = 20) 95 to 105 h after transfection (Fig. 1D). The differences in G/R over time corresponded to clear differences in the hue color of the protoplasts (Fig. 1, overlay). The protoplasts in fact shifted from a bright green fluorescence, observed in the first hours after transfection, to yellow-orange, and finally to a red fluorescence, when the red emitting form was predominantly present (Fig. 1, overlay). Moreover, at a specific time point, G/R was similar in the different protoplasts although fluorescence intensities varied. For instance, the values of the G/R measured in protoplasts 25 and 90 h after transfection were of 2.73 ± 0.40 (n = 105) and 0.20 ± 0.02 (n = 62), respectively. The low SD values show that the rate of green to red conversion is independent of DsRED-E5 concentration and therefore from the level of gene expression within a cell (Terskikh et al., 2000
Next we determined the time required for the green form of DsRED-E5 to mature into the red form. From the experiment described above, it appeared that the rate of this maturation is in the order of 1 to 2 d. A more precise estimation could not be determined in this experiment since, under our experimental condition, the rate of protein synthesis changes over time (Rottier, 1980 After CHX application, the fluorescence intensity remained constant in the treated protoplasts, whereas it increased in the untreated sample (data not shown), indicating that the CHX treatment was effective. Moreover, G/R decreased rapidly and more or less in a linear manner within the first 14 h after CHX treatment from the initial value of 11.6 ± 2.36 (n = 23) to 2.37 ± 0.20 (n = 19) at 14 h (Fig. 2C). After this time point, a residual level of green fluorescent form remained in the protoplasts and G/R decreased slower (Fig. 2C), reaching a value of 0.93 ± 0.05 (n = 23; Fig. 2, A and C) and the lowest value of approximately 0.2 ± 0.05 (n = 21), respectively, approximately 24 and 55 to 60 h after CHX application (Fig. 2, B and C). These data show that once DsRED-E5 synthesis stopped, G/R decreased 10-fold in approximately 24 h, whereas under the same experimental condition, the intensity of GFP fluorescence remained about constant (data not shown). Therefore, DsRED-E5 is more suitable than other reporter genes to study regulation of gene activity during plant developmental processes.
DsRED-E5 as Reporter in M. truncatula Roots
To determine whether the fluorescent timer could be used as a reporter for studying promoter regulation in plant organs, we analyzed the potential of DsRED-E5 to reveal changes in promoter activity during a dynamic process such as root hair development. Root hairs were selected since they protrude from the epidermal cells, by which they are accessible for microscopic analysis. Root hair development has been investigated in detail in several plant species including M. truncatula (Sieberer and Emons, 2000 To test whether DsRED-E5 can be used as a reporter to study regulation of gene activity in root hairs, we used three different promoters, one of which is constitutively expressed in all cells of the root, including the epidermis, and the other two are induced during root epidermis development. As a constitutively expressed promoter, we selected the M. truncatula ACTIN2 (MtACT2) promoter (R. Mirabella, C. Franken, R. Geurts, and T. Bisseling, unpublished data). Such a constitutive promoter can be used to determine the steady-state value of the G/R in root hairs. Therefore we placed DsRED-E5 under the control of the MtACT2 promoter and introduced the MtACT2::DsRED-E5 fusion into M. truncatula roots by Agrobacterium rhizogenes mediated root transformation. Transformed roots were identified scoring for DsRED-E5 fluorescence under a stereo fluorescence macroscope. The fluorescence pattern confirmed that the MtACT2 promoter is constitutively expressed in roots: the signal was visible in the root meristem, in the epidermis, and in root hairs in all stages of development (Fig. 3, A and B). MtACT2::DsRED-E5 expressing root hairs were further analyzed by CLSM, and G/R in root hairs at different developmental stages was measured. The background signal detected in nontransformed root hairs and the bleed-through of the green signal into the red channel were taken into account as described above. The data presented here come from the analysis of five roots independently transformed with the MtACT2::DsRED-E5 fusion (Table I). In bulges, growing hairs (Fig. 3C), growth terminating (Fig. 3D), and "young mature" hairs (Fig. 3E), in a region of 0.5 mm above the growth terminating hairs, G/R had a value of approximately 2.8 (respectively, 2.84 ± 0.33 [n = 33], 2.78 ± 0.18 [n = 22], and 2.66 ± 0.25 [n = 15]; Table I). This value was lower in "old mature" root hairs, closer to the hypocotyl (data not shown), probably due to an overall reduction of protein synthesis in old root hairs. These data show that the value of G/R is constant in the region between bulges and young mature root hairs, indicating that a steady-state G/R level of approximately 2.8 is reached at these stages. Moreover, the values of the G/R were similar in independently transformed roots (Table I), confirming that also in M. truncatula root hairs G/R is independent of the expression level of the transgene. Further, the G/R value was uniform within one root hair (data not shown).
Next we determined whether the induction of promoters in root hairs could be studied using DsRED-E5 as reporter. For this purpose, we chose the ACTIN4 (MtACT4) promoter of M. truncatula, which is induced during root epidermis development (R. Mirabella, C. Franken, R. Geurts, and T. Bisseling, unpublished data). Therefore, we fused DsRED-E5 to the MtACT4 promoter. MtACT4::DsRED-E5 transformed roots were analyzed and G/R was quantified in root hairs of different ages in the region of the root encompassing bulges, growing, growth terminating, and young mature root hairs, in which the steady-state G/R occurred in the MtACT2::DsRED-E5 expressing root hairs. Considering that the steady-state value of the G/R in root hairs is approximately 2.8, values higher than 2.8 indicate recent promoter induction, whereas values below 2.8 indicate down-regulation of the promoter activity. In growing and growth terminating root hairs of MtACT4::DsRED-E5 transformed roots, G/R was 9.84 ± 2.26 (n = 20) and 9.56 ± 2.14 (n = 21), respectively (Fig. 4; Table I). These values being markedly higher than the steady-state value indicates that the MtACT4 promoter is induced in these hairs. Young mature hairs had a value of the G/R of 2.99 ± 0.54 (n = 11), indicating that G/R has almost reached the steady-state level (Fig. 4C; Table I).
These data clearly indicate that DsRED-E5 can be successfully used to detect the induction of the MtACT4 promoter in root hairs. To determine whether DsRED-E5 is also a useful marker to study repression of gene activity during development, we used the EXTENSIN1 promoter of tomato (Lycopersicon esculentum Mill LeEXT1promoter). A LeEXT1::GUS transgene has been shown to be active exclusively in root hairs, both in potato and tobacco (Bucher et al., 2002
A LeEXT1::DsRED-E5 fusion was introduced in M. truncatula roots. In all the six independent LeEXT1::DsRED-E5 roots analyzed by CLSM, a clear fluorescence was visible only in growing root hairs (Fig. 6A). These growing hairs displayed a G/R of approximately 3 (3.05 ± 0.67 [n = 41]; Table I), which is close to the steady-state level. At an earlier stage of development (bulges), fluorescence was too low to quantify. Growth terminating (Fig. 6B) and young mature hairs (Fig. 6C) had a G/R of approximately 1.5 (1.51 ± 0.22 [n = 41]) and approximately 0.6 (0.61 ± 0.09 [n = 19]), respectively (Table I). The decrease in G/R value was accompanied by a clear shift in the root hair color, from green in growing hairs to orange-red in young mature root hairs (Fig. 6 overlay).
In parallel, a LeEXT1::GFP (RS-smGFP) fusion was also introduced into M. truncatula and transformed roots were analyzed by CLSM. The fluorescence could be detected starting from the bulge stage (Fig. 5D) and was present in tip growing, growth terminating, and mature root hairs (Fig. 5, E and F), with a pattern similar to that obtained using GUS as reporter. Moreover the intensity of the GFP fluorescence increased moving from the bulge stage to young mature hairs (data not shown). In young mature hairs expressing LeEXT1::DsRED-E5, a value of the G/R lower (approximately 0.6) than the steady-state value (approximately 2.8) was reached. This indicates that in these hairs the LeEXT1 promoter activity has been decreased. The down-regulation of the LeEXT1 promoter already occurs in the growth terminating hairs, as indicated by a G/R value already markedly lower than the steady-state value. In contrast, when the LeEXT1::GFP fusion was used, no reduction of the fluorescence intensity was detected in root hairs at these developmental stages (Fig. 5). In these roots, as well as in roots transformed with a LeEXT1::GUS fusion, a decrease of the reporter product could first be observed in the region of the roots with old mature hairs at a distance of about 1.5 to 2 mm from the growth terminating hairs. The time span between the growth terminating stage and the stage where the decrease of GUS or GFP is detected is approximately 24 to 30 h. Therefore, compared to GUS or GFP, DsRED-E5 allows a markedly more precise detection of the timing of LeEXT1 promoter down-regulation. Compared to the MtACT2 promoter, the LeEXT1 promoter is active at a lower level. As a consequence, we did not detect any fluorescence in bulges and the fluorescence signal could be detected for the first time in growing hairs. In these hairs, the value of the G/R had almost reached the steady-state. The observation that as soon as the fluorescence can be detected in growing hairs, G/R is already at the steady-state indicates that the activation of the LeExt1 promoter must have occurred at an earlier stage than growing hairs. This conclusion is in agreement with the expression pattern observed in the LeEXTt1::GUS or the LeEXT1::GFP roots, in which the promoter activity could be detected at earlier stages, namely as soon as the bulges started to emerge from the epidermal cells. In conclusion, these data show that the fluorescent timer, DsRED-E5, can be used as a marker to monitor both promoter activation and down-regulation in plants, and by determining its G/R a more accurate timing can be obtained. In principal DsRED-E5 is equally suitable as GFP/GUS to determine when a gene is first induced during development, although due to its low quantum yield it is less sensitive than GFP/GUS. On the other hand, DsRED-E5 is most useful to reveal promoter down-regulation, which is hampered by the high stability of conventional reporters like GFP and GUS. In addition, DsRED-E5 can be useful to study increase or decrease of gene activity in cells that already express this gene. For example an external signal might alter the expression level of a certain gene in cells where this gene is already active. In such a case, the timing of this alteration can also be more accurately determined by analyzing the G/R value of DsRED-E5.
DNA Manipulation and Plasmid Construction
Molecular biology protocols were conducted according to standard procedures (Sambrook and Russel, 2001
The isolation of the MtACT2 and MtACT4 will be described elsewhere (R. Mirabella, C. Franken, R. Geurts, and T. Bisseling, unpublished data). In short, a 2.8-kb 5' promoter region of MtACT2 and 2.9-kb region of MtACT4 were PCR amplified using the following primers (with restriction sites used for cloning underlined): 5' MtACT2p-H, CCCAAGCTTGGATGTGGTTTGGTTAATAG; 3' MtACT2p-K, GGGGTACCTTGACCATTCCAGTTCC; MtACT4p-S, ACATGCATGCAATTTAGTATATATTTTGGGATGAG; and 3' MtACT4p-K, GGGGTACCTTGACCATGCCGGTTCC. The amplified fragments contain the putative promoter, the 5' untranslated region, the first intron, and the coding region of the first 19 amino acids, as used for the analysis of the Arabidopsis ACTIN genes (An et al., 1996
Cowpea (Vigna Unguiculata) protoplasts were prepared and transfected using the polyethylene glycol method as described (van Bokhoven et al., 1993
Medicago truncatula (Jemalong A17) root transformation was performed as previously reported (Limpens et al., 2004
GUS staining was performed according to Jefferson et al. (1987)
Fluorescence microscopy was performed using a Zeiss (Jena, Germany) LSM 510 CLSM implemented on an inverted microscope (Axiovert 100). Excitation was provided by the 488 nm Ar laser line, controlled by an acousto optical tuneable filter. To separate excitation from emission and to divide the fluorescence emission into the green and red channels, two dichroic beam splitters were used. The HFT 488 dichroic beam splitter was used to reflect excitation and transmit fluorescence emission. A mirror was used to reflect the emitted fluorescence to the NFT 545 secondary beam splitter. Fluorescence reflected by the NFT 545 splitter was filtered through a 505 to 530 nm band pass filter, resulting in the green channel, whereas fluorescence transmitted by the NFT 545 splitter was filtered through a 565 to 590 nm band pass filter, resulting in the red channel. A Zeiss plan-neofluar 40x (N.A. 1.3) oil immersion objective lens was used for scanning. For detection of green and red fluorescence, equal detection settings were used. For imaging root hairs, the pinhole was fully open. To determine G/R, time series images were acquired. To quantify the fluorescence intensities, equally sized regions of interest were drawn in cytoplasmic rich regions of protoplasts/root hairs and the pixel intensities in these regions were determined using the Zeiss LSM 510 software.
Upon request, all new materials described in this publication will be available and will be distributed in a timely manner. Sequence data from this article have been deposited with the EMBL/GenBank data libraries under accession numbers AJ809891 and AJ809892.
We thank J. Pouwels and Dr. M. Bucher for providing us the pMon999e35S vector and the LeEXTENSIN1 promoter, respectively. We are grateful to Dr. M. Hink for the help with CLSM and to J. Vermeer for the helpful discussions. Received January 8, 2004; returned for revision May 6, 2004; accepted May 10, 2004.
1 This work was supported by the European Community Training and Mobility of Researchers program FMRX CT 980239 (grant to R.M.).
2 Present address: Department of Plant Physiology, Swammerdam Institute for Life Science, University of Amsterdam, Kruislaan 318, 1098 SM Amsterdam, The Netherlands.
3 Present address: Division of Cell Biology, The Netherlands Cancer Institute, Plesmanlaan 121, 1066 CX, Amsterdam, The Netherlands. www.plantphysiol.org/cgi/doi/10.1104/pp.103.038539. * Corresponding author; e-mail ton.bisseling{at}wur.nl; fax 31317483584.
An Y-Q, Mc Dowell JM, Huang S, Mc Kinney EC, Meagher RB (1996) Strong, constitutive expression of the Arabidopsis ACT2/ACT8 actin subclass in vegetative tissues. Plant J 10: 107121[CrossRef][ISI][Medline]
Baird GS, Zacharias DA, Tsien RY (2000) Biochemistry, mutagenesis, and oligomerization of DsRED, a red fluorescent protein from coral. Proc Natl Acad Sci USA 97: 1198411989
Bucher M, Brunner S, Zimmermann P, Zardi GI, Amrhein N, Willmitzer L, Riesmeier JW (2002) The expression of an extensin-like protein correlates with cellular tip growth in tomato. Plant Physiol 128: 911923 Chalfie M (1995) Green fluorescent protein. Photochem Photobiol 62: 651656[ISI][Medline]
Chalfie M, Tu Y, Euskirchen G, Ward WW, Prasher DC (1994) Green fluorescent protein as a marker for gene expression. Science 263: 802805 Cormack BP, Valdivia RH, Falkow S (1996) FACS-optimized mutants of the green fluorescent protein (GFP). Gene 173: 3338[CrossRef][ISI][Medline] Cubitt AB, Heim R, Adams SR, Boyd AE, Gross LA, Tsien RY (1995) Understanding, improving and using green fluorescent proteins. Trends Biochem Sci 20: 448455[CrossRef][ISI][Medline] Davis SJ, Vierstra RD (1998) Soluble, highly fluorescent variants of green fluorescent protein (GFP) for use in higher plants. Plant Mol Biol 36: 521528[CrossRef][ISI][Medline] Diaz CL, Melchers LS, Hooykaas PJJ, Lugtenberg BJJ, Kijne KW (1989) Root lectin as a determinant of host-plant specificity in the Rhizobium-legume symbiosis. Nature 338: 579581[CrossRef] Jach G, Binot E, Frings S, Luxa K, Schell J (2001) Use of red fluorescent protein from Discosoma sp. (dsRED) as a reporter for plant gene expression. Plant J 28: 483491[CrossRef][ISI][Medline]
Jefferson AR, Kavanagh TA, Bevan MW (1987) Gus fusions:
Limpens E, Ramos J, Franken C, Raz V, Compaan B, Franssen H, Bisseling T, Geurts R (2004) RNA interference in Agrobacterium rhizogenes-transformed roots of Arabidopsis and Medicago truncatula. J Exp Bot 55: 983992 Matz MV, Fradkov AF, Labas YA, Savitsky AP, Zaraisky AG, Markelov ML, Lukyanov SA (1999) Fluorescent proteins from nonbioluminescent Anthozoa species. Nat Biotechnol 17: 969973[CrossRef][ISI][Medline]
Ow DV, Wood KV, DeLuca M, De Wet JR, Helinski DR, Howell SH (1986) Transient and stable expression of the firefly luciferase gene in plant cells and transgenic plants. Science 234: 856859 Rottier P (1980) Viral protein synthesis in cowpea mosaic virus infected protoplasts. PhD thesis. University of Wageningen, Wageningen, The Netherlands Sambrook J, Russel DW (2001) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY Sieberer B, Emons AMC (2000) Cytoarchitecture and pattern of cytoplasmic streaming in root hairs of Medicago truncatula during development and deformation by nodulation factors. Protoplasma 214: 118127[CrossRef]
Terskikh A, Fradkov A, Ermakova G, Zaraisky A, Tan P, Kajava AV, Zhao X, Lukyanov S, Matz M, Kim S, et al (2000) "Fluorescent timer": protein that changes color with time. Science 290: 15851588 Tsien RY (1998) The green fluorescent protein. Annu Rev Biochem 67: 509544[CrossRef][ISI][Medline]
Van Bokhoven H, Verver J, Wellink J, Kammen A (1993) Protoplasts transiently expressing the 200K coding sequence of cowpea mosaic virus B-RNA support replication of M-RNA. J Gen Virol 74: 22332241 Van Engelen FA, Molthoff JW, Conner AJ, Nap J-P, Pereira A, Stiekema WJ (1995) pBINPLUS: an improved plant transformation vector based on pBIN19. Transgenic Res 4: 288290[CrossRef][ISI][Medline] Verkhusha VV, Kuznetsova IM, Stepanenko OV, Zaraisky AG, Shavlovsky MM, Turoverov KK, Uversky VN (2003) High stability of Discosoma DsRed as compared to Aequorea EGFP. Biochemistry 42: 78797884[CrossRef][Medline] Related articles in Plant Physiol.:
This article has been cited by other articles:
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ASPB Publications | PLANT PHYSIOLOGY | THE PLANT CELL | |
|---|---|---|---|