|
|
||||||||
|
First published online August 6, 2004; 10.1104/pp.104.045039 Plant Physiology 135:2207-2219 (2004) © 2004 American Society of Plant Biologists
Functional Characterization of OsMADS18, a Member of the AP1/SQUA Subfamily of MADS Box Genes1,[w] enicová2,3Dipartimento di Biologia (F.F., L.P., N.P., S.C., L.C.) and Dipartimento di Scienze Biomolecolari e Biotecnologie (S.M., Z.L-D., M.M.K.), Università degli Studi di Milano, 20133 Milan, Italy; and Dipartimento di Biologia Vegetale, Università La Sapienza, 00185 Rome, Italy (G.F., M.M.A.)
MADS box transcription factors controlling flower development have been isolated and studied in a wide variety of organisms. These studies have shown that homologous MADS box genes from different species often have similar functions. OsMADS18 from rice (Oryza sativa) belongs to the phylogenetically defined AP1/SQUA group. The MADS box genes of this group have functions in plant development, like controlling the transition from vegetative to reproductive growth, determination of floral organ identity, and regulation of fruit maturation. In this paper we report the functional analysis of OsMADS18. This rice MADS box gene is widely expressed in rice with its transcripts accumulated to higher levels in meristems. Overexpression of OsMADS18 in rice induced early flowering, and detailed histological analysis revealed that the formation of axillary shoot meristems was accelerated. Silencing of OsMADS18 using an RNA interference approach did not result in any visible phenotypic alteration, indicating that OsMADS18 is probably redundant with other MADS box transcription factors. Surprisingly, overexpression of OsMADS18 in Arabidopsis caused a phenotype closely resembling the ap1 mutant. We show that the ap1 phenotype is not caused by down-regulation of AP1 expression. Yeast two-hybrid experiments showed that some of the natural partners of AP1 interact with OsMADS18, suggesting that the OsMADS18 overexpression phenotype in Arabidopsis is likely to be due to the subtraction of AP1 partners from active transcription complexes. Thus, when compared to AP1, OsMADS18 during evolution seems to have conserved the mechanistic properties of protein-protein interactions, although it cannot complement the AP1 function.
Compared to dicot species such as Arabidopsis, Antirrhinum majus, or Petunia hybrida, there is much less known about genes controlling flower development in monocots, such as rice (Oryza sativa) and maize (Zea mays). More than a decade of extensive studies of floral developmental mutants in dicots have resulted in the elucidation of mechanisms involved in the transition from vegetative to reproductive growth, the determination of inflorescence, floral meristem, and floral organ identity (Purugganan et al., 1995
The ABC model has been shown to be widely applicable in dicot species (Pnueli et al., 1994
In monocot species like barley (Hordeum vulgare) and wheat (Triticum aestivum), AP1-like genes have been demonstrated to be induced by vernalization in winter accessions and are probably involved in the floral transition (Trevaskis et al., 2003
Here we present the functional analysis of the rice MADS box gene OsMADS18 which belongs to the AP1/SQUA group of MADS box transcription factors (Moon et al., 1999b The analysis of OsMADS18 in Arabidopsis revealed that some of the natural partners of AP1 are able to interact with OsMADS18, suggesting that OsMADS18, when overexpressed in Arabidopsis, can subtract AP1 protein partners from active transcription factor complexes. Although OsMADS18 appears not to be able to complement the AP1 function, it seems that the selectivity for protein partners is still conserved between these distantly related monocot and dicot MADS box proteins.
OsMADS18 Is an AP1/SQUA-Like MADS Box Gene
OsMADS18 is a rice MADS box transcription factor belonging to the AP1/SQUA clade of MADS box genes (Moon et al., 1999b
Northern-blot analysis demonstrated that OsMADS18 transcripts could be detected in roots, leaves, inflorescences, and developing kernels (Masiero et al., 2002
We analyzed by in situ expression experiments the spatial and temporal expression pattern in vegetative tissues and inflorescences. These experiments showed that after 30 d from germination the transcripts are present at high levels in the apical meristem and in the meristematic leaf primordia formed on its flanks. The same expression pattern was observed in the axillary vegetative meristems (Fig. 3A). Furthermore OsMADS18 is strongly expressed in adventitious root primordia formed at the base of the culm (Fig. 3B), but not in the parenchyma across which the adventitious root is elongating.
After the floral transition, as the inflorescence develops, OsMADS18 transcripts are localized in the developing panicle at the early stage of secondary rachis-branch primordia differentiation. OsMADS18 is not expressed in the elongating inflorescence branches but is restricted to the meristematic domes that will subsequently give rise both to spikelets and to secondary branches (Fig. 3C). The transcript is also present in the procambium of the rachis branches and in all floral organ primordia (Fig. 3D). These analyses show that OsMADS18 is expressed in all parts of the plant with high expression levels in the roots and flower meristems.
RNAi-Mediated Silencing of OsMADS18
Overexpression of OsMADS18 in Rice To address the function of OsMADS18 in rice we constructed an overexpression cassette, fusing the OsMADS18 coding sequence with the strong CaMV35S promoter. Twenty-seven independent transgenic lines that overexpressed the transgene at different levels were identified (data not shown). Four of these plants that showed the highest levels of OsMADS18 expression remained very small in size and flowered at 105 d after germination compared to wild-type plants which flower at 140 d after germination (Fig. 5A). Two of them (501S and 1102S) were selected for further studies. Expression analysis of progeny plants of line 501S and 1102S demonstrated that OsMADS18 overexpression segregated with the early flowering phenotype (data not shown).
In order to test whether OsMADS18 overexpression affected only the transition to flowering or had a broader effect on rice development, we carried out a detailed morphological analysis on plants, ranging from 0 to 30 d after germination (Fig. 5D). The first effects can already be observed 5 d after germination (Fig. 5, B and C). At this time leaves of transgenic plants are still enclosed by the coleoptile, while wild-type leaves are already emerging from it. After 7 d from germination wild-type plants are about 12 mm long while the transgenic 501S and 1102S plants are 5.5 mm on average (Fig. 5D). Lines 501S and 1102S stay smaller than wild-type plants and this effect is due to a lower rate of internode elongation (Fig. 6, DG) and a reduction in the length of the leaf sheath. Despite this difference, leaf number is comparable between wild-type and transgenic lines. Regardless of this deficiency in elongation ability, mutant lines form axillary meristems earlier than wild-type plants. These axillary buds are visible in lines overexpressing OsMADS18 after 7 d from germination (Fig. 6, A and B), whereas in wild-type plants these buds develop only after 15 d from germination (Fig. 6C and Supplemental Fig. 1, available at www.plantphysiol.org). Furthermore, in the leaves of the transgenic plants the aerenchyma differentiates earlier than in wild-type plants and the aerenchyma cavities are larger (Fig. 6, A and B).
We also monitored the effects on root development in the transgenic lines 501S and 1102S. Microscopic analysis revealed that the adventitious root primordia develop at the same time as in wild-type plants although their number was reduced in these transgenic lines. Furthermore, at early stages the adventitious root elongation in lines 501S and 1102S is slower compared to wild-type plants (Fig. 5D; Supplemental Table I). The differences between wild-type and transgenic lines are more evident shortly after germination but, as the plants proceed in development, the developmental gap between wild-type and transgenic lines is progressively reduced (Fig. 5D; Supplemental Table I). After 30 d from germination the number and length of adventitious roots in wild-type and transgenic lines are comparable although in the transgenic lines the aerenchyma is still at a more advanced stage of development (Fig. 6, H and I).
AP1/SQUA-like genes, when overexpressed, generally cause an early flowering phenotype. To investigate whether OsMADS18 also induces early flowering in Arabidopsis we ectopically expressed OsMADS18 in this heterologous system. No significant effect on flowering time was observed, however, surprisingly, 10% of the plants (of a total of 100 transformants) showed floral phenotypes that were very similar to the ap1 mutant (Fig. 7H; Irish and Sussex, 1990
Around 5% of the plants showed more severe phenotypes. Some of the first-whorl organs were homeotically converted to carpelloid organs on which ovules developed (Fig. 7F). In these severely affected flowers the petals were, in general, completely absent (Fig. 7, E and F). Frequently the most affected plants had flowers from which extra flowers arose from the axils of the first whorl organs (Fig. 7) and this pattern was reiterated producing tertiary and even quaternary flowers (Fig. 7G).
One of the possible explanations for the ap1 phenotypes that we observed in the Arabidopsis plants that expressed OsMADS18 could be that in these transgenic plants the expression of the endogenous AP1 gene is repressed. To verify this possibility we performed a reverse transcription (RT)-PCR analysis to check for the expression of AP1 in these transgenic plants. Figure 8 shows the RT-PCR products obtained using RNA extracted from transgenic and control wild-type flowers. These analyses show that AP1 expression is not affected in these transgenic plants.
OsMADS18 Interacts With MADS Box Factors That Form Dimers With AP1 Another possible explanation for the observed ap1 phenotype in the OsMADS18-expressing Arabidopsis plants is that the OsMADS18 protein interacts with proteins that normally dimerize with AP1, since OsMADS18 shows significant sequence homology over a large part of the protein (Fig. 1). When these OsMADS18-containing protein complexes are not fully functional, this interaction could result in a dominant negative ap1 mutant phenotype.
Yeast Two-Hybrid Assay Using OsMADS18 as a Bait
To confirm the interaction between OsMADS18 and its putative partners, the complete open reading frames of OsMADS47, OsMADS24, OsMADS45, and OsMADS6 were cloned in frame with the activation domain of GAL4 in the vector GAL4-AD. The plasmids obtained were named 47-AD, 24-AD, 45-AD, and 6-AD. Yeast strain PJ694A (James et al., 1996
To investigate whether OsMADS18 was able to form homodimers the OsMADS18 open reading frame was also cloned as an activation domain fusion protein. Both the 18-BD and 18-AD vectors were introduced into PJ694A and their interaction was assayed by growth on selective media and by -galactosidase assays. The lack of activation of the markers showed that OsMADS18 is not able to form homodimers (Table I).
In Vitro Confirmation of Two-Hybrid Interactions
OsMADS18 Interacts with SEP Proteins from Arabidopsis As reported by Pelaz et al. (2001)
To investigate further the evolutionary conservation of the AP1 and OsMADS18 interactions we also tested AP1 for interaction with the rice homologs of SEP3 (Table II). These assays showed that AP1 makes stable interactions with OsMADS24 and OsMADS47. These results indicate that AP1 and OsMADS18 each form heterodimers that are conserved between monocot and dicot plants.
OsMADS18 Belongs to the FUL Lineage of MADS Box Transcription Factors
In our effort to isolate and study MADS box genes involved in flower development and floral transition, we started with the functional characterization of OsMADS18. Phylogenetic reconstruction placed OsMADS18 in the AP1/SQUA clade, in close relationship to AP1 and FUL from Arabidopsis and SQUA from Antirrhinum. Recently, Litt and Irish (2003)
OsMADS18 is widely expressed in rice, as revealed by expression analysis in flowering plants (Pelucchi et al., 2002
OsMADS18 transcripts can be detected in rice leaves only after 4 weeks from germination, and the increase in steady state mRNA levels correlates with the progressive acquisition of flowering competence. Also in other monocot species, like barley and wheat, the switch to the reproductive stage is marked by an increase in expression of AP1/SQUA-like genes. In winter accessions of wheat, Triticum monococcum, and barley, the WAP1, TmAP1, and BM5 genes, respectively, show a marked increase in transcript levels during the induction of the reproductive phase (Trevaskis et al., 2003
Since increased expression of AP1/SQUA-like genes in monocots is correlated with the floral transition we investigated whether alterations in OsMADS18 expression caused changes in flowering time. Transgenic rice plants overexpressing OsMADS18 showed an early flowering phenotype with a heading date that was anticipated 5 weeks when compared to the wild type. All rice MADS box genes belonging to the AP1/SQUA subfamily characterized so far, have been shown to cause early flowering when overexpressed (Chung et al., 1994 Ectopic expression of OsMADS18 induced precocious initiation of axillary shoot meristems. This observation together with the early transition to flowering suggests that OsMADS18 is able to promote the differentiation program of the vegetative shoots. This effect is not maintained for the entire life cycle but is progressively reduced, and when the plants are at 30 d after germination there is almost no difference anymore between the wild-type and transgenic plants. Assuming that OsMADS18 is able to stimulate shoot differentiation, its ectopic expression at early stages of plant development (when OsMADS18 normally is not expressed) might cause the observed acceleration. Whereas at later stages when OsMADS18 is normally expressed, the overexpression of this gene has no significant effect.
Silencing of OsMADS18 through an RNAi approach did not result in any phenotypic effect when compared to wild-type plants. Although RNAi-based gene silencing is very effective in rice, as already reported by Hayama et al. (2003)
By expression of OsMADS18 in Arabidopsis we investigated whether this rice gene can stimulate flowering, as has been shown for the SQUA-like genes AP1 and FUL (Mandel and Yanofsky, 1995
Although the severity of the observed phenotypes varied between the different transgenic lines, their phenotypes were always similar to those previously described for ap1 mutants (Bowman et al., 1993
The ap1 mutant phenotype observed in plants expressing OsMADS18 is not due to silencing of AP1, since AP1 is normally expressed in these transgenic plants. Since AP1 forms ternary complexes to exploit its functions, OsMADS18 might interact with the same partners as AP1 giving rise to inactive complexes and acting as a dominant negative factor. It has been reported that AP1 interacts with SEP proteins, SVP and AGL24 (Pelaz et al., 2001
The two-hybrid screen for OsMADS18 partners in rice resulted in isolation of partial proteins although none of the sequences lacked the regions corresponding to the K box. We dissected the OsMADS18 domains to identify those important for dimerization and confirmed that only those containing a K box were able to interact with OsMADS18 partners (Supplemental Table II). This confirms previous reports that the K box is important for MADS box protein dimerization (Krizek and Meyerowitz, 1996 It is very likely that the observed ap1 phenotype is caused by the formation of complexes between OsMADS18 and AP1 partners, which might be able to bind to the same target genes as those containing AP1. However, those containing OsMADS18 are probably functionally inactive, blocking the binding of the functional AP1 complexes. In this scenario the dominant negative effect is not due to the subtraction of SEP proteins from active complexes but more likely involves competition between active and nonactive complexes on the promoters of AP1 target genes. The dominant negative effect is not observed in rice flowers when we overexpressed OsMADS18 since the complexes formed with OsMADS18 are functional, activating the natural set of target genes. Furthermore, the fact that we do not observe any floral phenotypic effect indicates that the increased OsMADS18 mRNA levels do not interfere with normal flower development.
As OsMADS18 is able to interact with at least a subset of the AP1 partners in yeast we demonstrated that AP1 can, vice versa, interact with OsMADS24 and OsMADS45 but not with OsMADS6. It's clear from these experiments that, although different in expression pattern, OsMADS18 and AP1 still retain the ability to interact with phylogenetically related partners. The analysis of conserved interactions can be used to compare putative functional homologs as already demonstrated for other rice MADS box factors (Moon et al., 1999a It seems likely that a parallel exists between complexes formed in rice and Arabidopsis and, although their functionality cannot be fully restored when corresponding partners are exchanged, they strongly indicate their evolutionary common origin.
Plant Material For the overexpression and RNAi-mediated silencing of OsMADS18, the indica cultivar Cypressus and the japonica cultivar Nipponbare were used, respectively. Overexpression of OsMADS18 in Arabidopsis was carried out in the Wassilewskjia ecotype.
Transformation of rice (Oryza sativa) was carried out by cocultivation of Agrobacterium tumefaciens and embryogenic scutellum-derived calli from mature rice seeds as described by K. D'Halluin and E. Gobel (1992; Publication of the International Application under the Patent Cooperation Treaty WO 92/09696) and by Hiei et al. (1994)
Arabidopsis was transformed according to the floral dip method as described by Clough and Bent (1998)
Protein sequences were aligned using the multiple alignment mode of the ClustalX software (ver. 1.83), visualized and edited with the GENEDOC utilities (ver. 2.3.000; www.psc.edu/biomed/genedoc).
OsMASD18 cDNA was amplified with primers OL13 and OL14 (OL13, GAATTCGGGAGAGGGCCGGTGC; OL14, GTCGACTCATGTGTGACTTGTCCGGAG) to introduce the cloning sites EcoRI and SalI. Amplification was followed by digestion, and the DNA fragment was cloned in pBDGAL4 (18-BD). The bait includes the complete coding sequence of OsMADS18, excluding the initial Met. The bait deletions of OsMADS18 were also generated by PCR, subsequently digested and cloned in pBDGAL4 as described by Masiero et al. (2002)
The complete OsMADS18-coding region was cloned in pET32a to produce the recombinant protein (TRX-OsMADS18), using oligos OL13 and OL14. OsMADS18 was fused in frame with thioredoxin at the N-terminal domain and with a tail of 6 His residues. This plasmid was used to transform Escherichia coli strain BL21 (DE3) plysS. The overexpression system based on the T7 promoter was used to produce the recombinant protein (Studier et al., 1990
To construct the 35S:OsMADS18 overexpression plasmid, BstXI and NheI cloning sites were introduced in the OsMADS18 cDNA by means of PCR. The entire coding region of OsMADS18 was fused as a BstXI-NheI fragment in the sense orientation to the 61-bp fragment of the leader sequence from the chlorophyll a/b binding protein gene (cab22L) from petunia (Harpster et al., 1988 To construct the OsMADS18 RNAi plasmid a specific portion of OsMADS18 (corresponding to nucleotide position 83280) was amplified with OL668 (GGGGACAAGTTTGTACAAAAAAGCAGGCTTACTGGAGCCAAATACTGAG) and OL669 (GGGGACCACTTTGTACAAGAAAGCTGGGTCAAGTCACACATGAAGGCATCTG). The product of the amplification was cloned into the binary vector pFRH using the Gateway Cloning Technology (Invitrogen, Carlsbad, CA).
Total RNA was extracted from rice tissues as described by Verwoerd et al. (1989)
For the histological analysis, wild-type seeds and 35S:OsMADS18 seeds were sterilized according to Hiei et al. (1994)
Developing inflorescences of wild-type plants (O. sativa L. cv Nipponbare) were fixed and embedded in paraffin as described by Lopez-Dee et al. (1999)
Yeast strain HF7c, used for the library screening, was supplied by CLONTECH Laboratories (Palo Alto, CA; Feilotter et al., 1994
The TNT-coupled Reticulocyte Lysate system (Promega, Madison, WI) was used to make in vitro translated proteins, and 35S-Met was incorporated to label the protein. To perform coimmunoprecipitation experiments protein G-agarose was used since anti-thioredoxin antibodies have high affinity for it. The conditions employed for coimmunoprecipitation were reported previously by Goto and Meyerowitz (1994)
Upon request, all novel materials described in this publication will be made available in a timely manner for noncommercial research purposes.
We thank Dr. Marten Denekamp for providing the pFRH RNAi binary vector. Received April 22, 2004; returned for revision May 25, 2004; accepted May 25, 2004.
1 This work was supported in part by the EU grants Cereal Gene Tags (QLG2CT200101453) and Conflow (QLK5CT200101412) and by the national grants Cofin '98 and Ateneo 2003. L.P. was supported by a European Community postdoctoral fellowship (QLK5CT200052129).
2 These authors contributed equally to the paper.
3 Present address: DSM Food Specialties, P.O. Box 1, 2600 MA Delft, The Netherlands.
4 Present address: Max-Planck-Institute für Züchtungforschung, Carl-von-Linne-Weg 10, 50829 Köln, Germany.
5 Present address: Plant Development and Reproduction, Plant Research International B.V., P.O. Box 16, 6700 AA Wageningen, the Netherlands.
[w] The online version of this article contains Web-only data. Article, publication date, and citation information can be found at www.plantphysiol.org/cgi/doi/10.1104/pp.104.045039. * Corresponding author; e-mail martin.kater{at}unimi.it; fax 00390250315044.
Ambrose BA, Lerner DR, Ciceri P, Padilla CM, Yanofsky MF, Schmidt RJ (2000) Molecular and genetic analyses of the Silky1 gene reveal conservation in floral organ specification between eudicots and monocots. Mol Cells 5: 569579[CrossRef][Web of Science][Medline] Angenent GC, Franken J, Busscher M, van Dijken A, van Went JL, Dons HJ, van Tunen AJ (1995) A novel class of MADS box genes is involved in ovule development in petunia. Plant Cell 7: 15691582[Abstract] Berbel A, Navarro C, Ferrándiz C, Cañas LA, Madueño F, Beltrán JP (2001) Analysis of PEAM4, the pea AP1 functional homologue, supports a model for AP1-like genes controlling both floral meristem and floral organ identity in different plant species. Plant J 25: 441451[CrossRef][Web of Science][Medline]
Bowman JL, Alvarez J, Weigel D, Meyerowitz EM, Smyth DR (1993) Control of flower development in Arabidopsis thaliana by APETALA1 and interacting genes. Development 119: 721743 Bowman JL, Smyth DR, Meyerowitz EM (1991) Genetic interactions among floral homeotic genes of Arabidopsis. Development 112: 120[Abstract]
Carpenter R, Coen ES (1990) Floral homeotic mutations produced by transposon-mutagenesis in Antirrhinum majus. Genes Dev 4: 14831493 Chung YY, Kim SR, Finkel D, Yanofsky MF, An G (1994) Early flowering and reduced apical dominance result from ectopic expression of a rice MADS box gene. Plant Mol Biol 26: 657665[CrossRef][Web of Science][Medline] Chung YY, Kim SR, Kang HG, Noh YS, Park MC, Finkel D, An G (1995) Characterization of two rice MADS box genes homologous to GLOBOSA. Plant Sci 109: 4556[CrossRef] Clifford HT (1987) Spikelets and floral morphology. In TR Soderstrom, K Hilu, CS Campbell, ME Barkworth, eds, Grass Systematics and Evolution. Smithsonian Institute Press, Washington DC Clough SJ, Bent AF (1998) Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J 16: 735743[CrossRef][Web of Science][Medline] Coen ES, Meyerowitz EM (1991) The war of the whorls: genetic interactions controlling flower development. Nature 353: 3137[CrossRef][Medline] Colombo L, Franken J, Koetje E, van Went J, Dons HJ, Angenent GC, van Tunen AJ (1995) The petunia MADS box gene FBP11 determines ovule identity. Plant Cell 7: 18591868[Abstract] Colombo L, Marziani G, Masiero S, Wittich PE, Schmidt RJ, Sari-Gorla M, Pé ME (1998) BRANCHED SILKLESS mediates the transition from spikelet to floral meristem during Zea mays ear development. Plant J 16: 355363[CrossRef][Web of Science]
Cornelissen M, Vandewiele M (1989) Nuclear transcriptional activity of the tobacco plastid psbA promoter. Nucleic Acids Res 17: 1929 Davies B, Egea-Cortines M, de Andrade Silva E, Saedler H, Sommer H (1996) Multiple interactions amongst floral homeotic MADS box proteins. EMBO J 15: 43304343[Web of Science][Medline] Denecke J, Gossele V, Botterman J, Cornelissen M (1989) Quantitative analysis of transiently expressed genes in plant cells. Methods Mol Cell Biol 1: 1927 Egea-Cortines M, Saedler H, Sommer H (1999) Ternary complex formation between the MADS box proteins SQUAMOSA, DEFICIENS and GLOBOSA is involved in the control of floral architecture in Antirrhinum majus. EMBO J 18: 53705379[CrossRef][Web of Science][Medline] Fan HY, Hu Y, Tudor M, Ma H (1997) Specific interactions between the K domains of AG and AGLs, members of the MADS domain family of DNA binding proteins. Plant J 12: 9991010[CrossRef][Web of Science][Medline] Favaro R, Immink RGH, Ferioli V, Bernasconi B, Byzova M, Angenent GC, Kater M, Colombo L (2002) Ovule-specific MADS box proteins have conserved protein-protein interactions in monocot and dicot plants. Mol Genet Genomics 268: 152159[CrossRef][Web of Science][Medline]
Favaro R, Pinyopich A, Battaglia R, Kooiker M, Borghi L, Ditta G, Yanofsky MF, Kater MM, Colombo L (2003) MADS box protein complexes control carpel and ovule development in Arabidopsis. Plant Cell 15: 26032611
Feilotter HE, Hannon GJ, Ruddel CJ, Beach D (1994) Construction of an improved host strain for two hybrid screening. Nucleic Acids Res 22: 15021503 Ferrándiz C, Gu Q, Martienssen R, Yanofsky MF (2000) Redundant regulation of meristem identity and plant architecture by FRUITFUL, APETALA1 and CAULIFLOWER. Development 127: 725734[Abstract]
Ferrándiz C, Liljegren SJ, Yanofsky MF (2000) Negative regulation of the SHATTERPROOF genes by FRUITFUL during Arabidopsis fruit development. Science 289: 436438
Ferrario S, Immink RGH, Shchennikova A, Busscher-Lange J, Angenent GC (2003) The MADS box gene FBP2 is required for SEPALLATA function in petunia. Plant Cell 15: 914925 Fornara F, Marziani G, Mizzi L, Kater M, Colombo L (2003) MADS box genes controlling flower development in rice. Plant Biol 5: 1622
Gocal GFW, King RW, Blundell CA, Schwartz OM, Andersen CH, Weigel D (2001) Evolution of floral meristem identity genes: analysis of Lolium temulentum genes related to APETALA1 and LEAFY of Arabidopsis. Plant Physiol 125: 17881801
Goto K, Meyerowitz EM (1994) Function and regulation of the Arabidopsis floral homeotic gene PISTILLATA. Genes Dev 8: 15481556 Greco R, Stagi L, Colombo L, Angenent GC, Sari-Gorla M, Pè ME (1997) MADS box genes expressed in developing inflorescences of rice and sorghum. Mol Gen Genet 253: 615623[CrossRef][Web of Science][Medline] Harpster MH, Townsend JA, Jones JDG, Bedbrook J, Dunsmuir P (1988) Relative strengths of the 35S califlower mosaic virus, 1', 2', and nopaline synthase promoters in transformed tobacco sugarbeet and oilseed rape callus tissue. Mol Gen Genet 212: 182190[CrossRef][Medline] Hartmann U, Höhmann S, Nettesheim K, Wisman E, Saedler H, Huijser P (2000) Molecular cloning of SVP: a negative regulator of the floral transition in Arabidopsis. Plant J 21: 351360[CrossRef][Web of Science][Medline] Hayama R, Yokoi S, Tamaki S, Yano M, Shimamoto K (2003) Adaptation of photoperiodic pathways produces short-day flowering in rice. Nature 422: 719722[CrossRef][Medline] Hiei Y, Komari T, Kubo T (1994) Transformation of rice mediated by Agrobacterium tumefaciens. Plant Mol Biol 35: 205218 Honma T, Goto K (2001) Complexes of MADS box proteins are sufficient to convert leaves into flower organs. Nature 409: 525529[CrossRef][Medline] Huijser P, Klein J, Lonnig WE, Meijer H, Saedler H, Sommer H (1992) Bracteomania, an inflorescence anomaly, is caused by the loss of function of the MADS box gene squamosa in Antirrhinum majus. EMBO J 11: 12391249[Web of Science][Medline] Immink RGH, Angenent GC (2002) Transcription factors do it together: the hows and whys of studying protein-protein interactions. Trends Plant Sci 7: 531534[CrossRef][Web of Science][Medline] Immink RGH, Ferrario S, Busscher-Lange J, Kooiker M, Busscher M, Angenent GC (2003) Analysis of the petunia MADS box transcription factor family. Mol Genet Genomics 268: 598606[Web of Science][Medline]
Irish VF, Sussex IM (1990) Function of the apetala-1 gene during Arabidopsis floral development. Plant Cell 2: 741753 James P, Halladay J, Craig EA (1996) Genomic libraries and a host strain designed for highly efficient two-hybrid selection in yeast. Genetics 144: 14251436[Abstract]
Jang S, An K, Lee S, An G (2002) Characterization of tobacco MADS box genes involved in floral initiation. Plant Cell Physiol 43: 230238
Jeon JS, Jang S, Lee S, Nam J, Kim C, Lee SH, Chung YY, Kim SR, Lee YH, Cho YG, et al (2000a) leafy hull sterile1 is a homeotic mutation in a rice MADS box gene affecting rice flower development. Plant Cell 12: 871884 Jeon JS, Lee S, Jung KH, Yang WS, Yi GH, Oh BG, An G (2000b) Production of transgenic rice plants showing reduced heading date and plant height by ectopic expression of rice MADS box genes. Mol Breed 6: 581592[CrossRef] Kang HG, Jang S, Chung JE, Cho YG, An G (1997) Characterization of two rice MADS box genes that control flowering time. Mol Cells 7: 559566[Web of Science][Medline] Kang HG, Jong-Seong J, Lee S, An G (1998) Identification of class B and class C organ identity genes from rice plants. Plant Mol Biol 38: 10211029[CrossRef][Web of Science][Medline] Kang HG, Noh YS, Chung YY, Costa MA, An K, An G (1995) Phenotypic alterations of petal and sepal by ectopic expression of a rice MADS box gene in tobacco. Plant Mol Biol 29: 110[CrossRef][Web of Science][Medline]
Kater MM, Colombo L, Franken J, Busscher M, Masiero S, van Lookeren Campagne MM, Angenent GC (1998) Multiple AGAMOUS homologs from cucumber and petunia differ in their ability to induce reproductive organ fate. Plant Cell 10: 171182
Kater MM, Franken J, Carney KJ, Colombo L, Angenent GC (2001) Sex determination in the monoecious species cucumber is confined to specific floral whorls. Plant Cell 13: 481493
Krizek BA, Meyerowitz EM (1996) Mapping the protein regions responsible for the functional specificities of the Arabidopsis MADS domain organ-identity proteins. Proc Natl Acad Sci USA 93: 40634070 Kyozuka J, Kobayashi T, Morita M, Shimamoto K (2000) Spatially and temporally regulated expression of rice MADS box genes with similarity to Arabidopsis class A, B and C genes. Plant Cell Physiol 41: 710718
Kyozuka J, Shimamoto K (2002) Ectopic expression of OsMADS3, a rice ortholog of AGAMOUS, caused a homeotic transformation of lodicules to stamens in transgenic rice plants. Plant Cell Physiol 43: 130135
Lee S, Kim J, Son JS, Nam J, Jeong DH, Lee K, Jang S, Yoo J, Lee J, Lee DY, et al (2003) Systematic reverse genetic screening of T-DNA tagged genes in rice for functional genomic analyses: MADS box genes as a test case. Plant Cell Physiol 44: 14031411 Lim J, Moon YH, An G, Jang SK (2000) Two rice MADS domain proteins interact with OsMADS1. Plant Mol Biol 44: 513527[CrossRef][Web of Science][Medline]
Litt A, Irish VF (2003) Duplication and diversification in the APETALA1/FRUITFULL floral homeotic gene lineage: implications for the evolution of floral development. Genetics 165: 821833 Lopez-Dee ZP, Wittich PE, Pé ME, Rigola D, del Buono I, Sari Gorla M, Kater MM, Colombo L (1999) OsMADS13, a novel rice MADS box gene expressed during ovule development. Dev Genet 25: 237244[CrossRef][Web of Science][Medline]
Ma H, Yanofsky MF, Meyerowitz EM (1991) AGL1-AGL6, an Arabidopsis gene family with similarity to floral homeotic and transcription factor genes. Genes Dev 5: 484495 Mandel MA, Gustafson-Brown C, Savidge B, Yanofsky MF (1992) Molecular characterization of the Arabidopsis floral homeotic gene APETALA1. Nature 360: 273277[CrossRef][Medline] Mandel MA, Yanofsky MF (1995) A gene triggering flower formation in Arabidopsis. Nature 377: 522524[CrossRef][Medline]
Masiero S, Imbriano C, Ravasio F, Favaro R, Pelucchi N, Sari Gorla M, Mantovani R, Colombo L, Kater MM (2002) Ternary complex formation between MADS box transcription factors and the histone fold protein NF-YB. J Biol Chem 277: 2642926435 Mena M, Mandel MA, Lerner DR, Yanofsky MF, Schmidt RJ (1995) A characterization of the MADS box gene family in maize. Plant J 8: 845854[CrossRef][Web of Science][Medline] Menzel G, Apel K, Melzer S (1996) Identification of two MADS box genes that are expressed in the apical meristems of the long-day plant Sinapsis alba in transition to flowering. Plant J 9: 399408[CrossRef][Web of Science][Medline] Michaels SD, Ditta G, Gustafson-Brown C, Pelaz S, Yanofsky M, Amasino RM (2003) AGL24 acts as a promoter of flowering in Arabidopsis and is positively regulated by vernalization. Plant J 33: 867874[CrossRef][Web of Science][Medline] Moon YH, Jung JH, Kang HG, An G (1999a) Identification of a rice APETALA3 homologue by yeast two-hybrid screening. Plant Mol Biol 40: 167177[CrossRef][Web of Science][Medline]
Moon YH, Kang HG, Jung JY, Jeon JS, Sung SK, An G (1999b) Determination of the motif responsible for interaction between the rice APETALA1/AGAMOUS-LIKE9 family proteins using a yeast two-hybrid system. Plant Physiol 120: 11931203 Pelaz S, Ditta GS, Baumann E, Wisman E, Yanofsky MF (2000) B and C floral organ identity functions require SEPALLATA MADS box genes. Nature 405: 200203[CrossRef][Medline] Pelaz S, Gustafson-Brown C, Kohalmi SE, Crosby WL, Yanofsky MF (2001) APETALA1 and SEPALLATA3 interact to promote flower development. Plant J 26: 385394[CrossRef][Web of Science][Medline] Pelucchi N, Fornara F, Favalli C, Masiero S, Lago C, Pè ME, Colombo L, Kater MM (2002) Comparative analysis of rice MADS box genes expressed during flower development. Sex Plant Reprod 15: 113122[CrossRef] Pinyopich A, Ditta GS, Savidge B, Liljegren SJ, Baumann E, Wisman E, Yanofsky MF (2003) Assessing the redundancy of MADS box genes during carpel and ovule development. Nature 424: 8588[CrossRef][Medline] Pnueli L, Hareven D, Broday L, Hurwitz C, Lifschitz E (1994) The TM5 MADS box gene mediates organ differentiation in the three inner whorls of tomato flowers. Plant Cell 6: 175186[Abstract] Purugganan MD, Rounsley SD, Schmidt RJ, Yanofsky MF (1995) Molecular evolution of flower development: diversification of the plant MADS box regulatory gene family. Genetics 140: 345356[Abstract] Schmidt RJ, Ambrose BA (1998) The blooming of grass flower development. Curr Opin Plant Biol 1: 6067[CrossRef][Web of Science][Medline] Schmitz J, Franzen R, Ngyuen TH, Garcia-Maroto F, Pozzi C, Salamini F, Rohde W (2000) Cloning, mapping and expression analysis of barley MADS box genes. Plant Mol Biol 42: 899913[CrossRef][Web of Science][Medline]
Schultz EA, Haughn GN (1993) Genetic analysis of the floral initiation process (FLIP) in Arabidopsis. Development 119: 745765
Schwarz-Sommer Z, Huijser P, Nacken W, Saedler H, Sommer H (1990) Genetic control of flower development by homeotic genes in Antirrhinum majus. Science 250: 931936 Studier FW, Rosenberg AH, Dunn JJ, Dubendorf JW (1990) Use of T7 DNA polymerase to direct expression of cloned genes. Methods Enzymol 185: 6089[Medline]
Trevaskis B, Bagnall DJ, Ellis MH, Peacock WJ, Dennis ES (2003) MADS box genes control vernalization-induced flowering in cereals. Proc Natl Acad Sci USA 100: 1309913104
Vandenbussche M, Theissen G, Van de Peer Y, Gerats T (2003) Structural diversification and neo-functionalization during floral MADS box genes evolution by C-terminal frameshift mutations. Nucleic Acids Res 31: 44014409
Verwoerd TC, Dekken BMM, Hoekema A (1989) A small scale procedure for the rapid isolation of plant RNAs. Nucleic Acids Res 17: 2362 Xiao H, Wang Y, Liu D, Wang W, Li X, Zhao X, Xu J, Zhai W, Zhu L (2003) Functional analysis of the rice AP3 homologue OsMADS16 by RNA interference. Plant Mol Biol 52: 957966[CrossRef][Web of Science][Medline]
Yalovsky S, Rodriguez-Conception M, Bracha K, Toledo-Ortez G, Gruissem W (2000) Prenylation of the floral transcription factor APETALA1 modulates its function. Plant Cell 12: 12571266
Yan L, Loukoianov A, Tranquilli G, Helguera M, Fahima T, Dubcovsky J (2003) Positional cloning of the wheat vernalization gene VRN1. Proc Natl Acad Sci USA 100: 62636268 Yang Y, Fanning L, Jack T (2003) The K domain mediates heterodimerization of the Arabidopsis floral organ identity proteins, APETALA3 and PISTILLATA. Plant J 33: 4759[CrossRef][Web of Science][Medline]
Yu H, Xu Y, Tan EL, Kumar PP (2002) AGAMOUS-LIKE 24, a dosage-dependent mediator of the flowering signals. Proc Natl Acad Sci USA 99: 1633616341 This article has been cited by other articles:
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ASPB Publications | PLANT PHYSIOLOGY® | THE PLANT CELL | |
|---|---|---|---|