Plant Physiol.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


First published online August 6, 2004; 10.1104/pp.104.045039

Plant Physiology 135:2207-2219 (2004)
© 2004 American Society of Plant Biologists

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow All Versions of this Article:
135/4/2207    most recent
pp.104.045039v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via ISI Web of Science (26)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fornara, F.
Right arrow Articles by Kater, M. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fornara, F.
Right arrow Articles by Kater, M. M.
Agricola
Right arrow Articles by Fornara, F.
Right arrow Articles by Kater, M. M.
DEVELOPMENT AND HORMONE ACTION

Functional Characterization of OsMADS18, a Member of the AP1/SQUA Subfamily of MADS Box Genes1,[w]

Fabio Fornara2, Lucie Parenicová2,3, Giuseppina Falasca2, Nilla Pelucchi, Simona Masiero4, Stefano Ciannamea5, Zenaida Lopez-Dee, Maria Maddalena Altamura, Lucia Colombo and Martin M. Kater*

Dipartimento di Biologia (F.F., L.P., N.P., S.C., L.C.) and Dipartimento di Scienze Biomolecolari e Biotecnologie (S.M., Z.L-D., M.M.K.), Università degli Studi di Milano, 20133 Milan, Italy; and Dipartimento di Biologia Vegetale, Università La Sapienza, 00185 Rome, Italy (G.F., M.M.A.)


    ABSTRACT
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 
MADS box transcription factors controlling flower development have been isolated and studied in a wide variety of organisms. These studies have shown that homologous MADS box genes from different species often have similar functions. OsMADS18 from rice (Oryza sativa) belongs to the phylogenetically defined AP1/SQUA group. The MADS box genes of this group have functions in plant development, like controlling the transition from vegetative to reproductive growth, determination of floral organ identity, and regulation of fruit maturation. In this paper we report the functional analysis of OsMADS18. This rice MADS box gene is widely expressed in rice with its transcripts accumulated to higher levels in meristems. Overexpression of OsMADS18 in rice induced early flowering, and detailed histological analysis revealed that the formation of axillary shoot meristems was accelerated. Silencing of OsMADS18 using an RNA interference approach did not result in any visible phenotypic alteration, indicating that OsMADS18 is probably redundant with other MADS box transcription factors. Surprisingly, overexpression of OsMADS18 in Arabidopsis caused a phenotype closely resembling the ap1 mutant. We show that the ap1 phenotype is not caused by down-regulation of AP1 expression. Yeast two-hybrid experiments showed that some of the natural partners of AP1 interact with OsMADS18, suggesting that the OsMADS18 overexpression phenotype in Arabidopsis is likely to be due to the subtraction of AP1 partners from active transcription complexes. Thus, when compared to AP1, OsMADS18 during evolution seems to have conserved the mechanistic properties of protein-protein interactions, although it cannot complement the AP1 function.


Compared to dicot species such as Arabidopsis, Antirrhinum majus, or Petunia hybrida, there is much less known about genes controlling flower development in monocots, such as rice (Oryza sativa) and maize (Zea mays). More than a decade of extensive studies of floral developmental mutants in dicots have resulted in the elucidation of mechanisms involved in the transition from vegetative to reproductive growth, the determination of inflorescence, floral meristem, and floral organ identity (Purugganan et al., 1995Go; Ferrándiz et al., 2000Go; Hartmann et al., 2000Go). The flowers of the well-studied dicot species like Arabidopsis and Antirrhinum consist of four concentric whorls with, from outside to inside, the sepals, petals, stamens, and carpels. The determination of the identity of these floral organs has been extensively studied in these two species using homeotic flower mutants (Carpenter and Coen, 1990Go; Schwarz-Sommer et al., 1990Go; Bowman et al., 1991Go), and these studies resulted in the formulation of the so-called ABC model (for review, see Coen and Meyerowitz, 1991Go). This model proposes that class A genes specify sepals and, together with class B genes, specify petals. Class B and C genes specify stamens, and C alone determines the identity of carpels. The model was later extended, both in Arabidopsis and Petunia, with the class D genes, necessary for ovule development and with class E genes (SEP genes), indispensable for the determination of petal, stamen, carpel, and ovule identity (Angenent et al., 1995Go; Colombo et al., 1995Go; Pelaz et al., 2000Go; Favaro et al., 2003Go; Ferrario et al., 2003Go; Pinyopich et al., 2003Go). The majority of the class A, B, C, D, and E homeotic genes belong to the MADS box transcription factor family and they are characterized by a typical modular structure. The MADS box (M), a highly conserved DNA-binding domain, is located at the N terminus. This domain is followed by a less conserved I region (I) and by the moderately conserved K box (K; keratin-like coiled-coil structure), both important for dimerization. The C terminus (C) is the most variable part and is involved in ternary complex formation and transcriptional activation (Egea-Cortines et al., 1999Go).

The ABC model has been shown to be widely applicable in dicot species (Pnueli et al., 1994Go; Kater et al., 1998Go; Berbel et al., 2001Go; Kater et al., 2001Go; Immink et al., 2003Go). Furthermore, MADS box genes that are homologous to the dicot ABC genes have also been identified in monocot species (Mena et al., 1995Go; Ambrose et al., 2000Go; Jeon et al., 2000aGo; Schmitz et al., 2000Go; Fornara et al., 2003Go; Xiao et al., 2003Go). Interestingly, the flower structure of these species is very different. The rice flower, for instance, develops in the outermost whorls two leaf-like structures, the lemma and the palea. Instead of the petals, lodicules develop, which are important structures for opening the flower during anthesis. Comparative studies have tried to give a satisfactory interpretation of the floral organs of rice flowers in respect to dicot flowers. The lodicules are mostly thought to represent the petals (Ambrose et al., 2000Go), the palea is considered to be the equivalent of the dicot sepals (Schmidt and Ambrose, 1998Go), and the lemma is considered to be a bract (Clifford, 1987Go). Investigations on the rice ABC genes have helped these comparative studies and also shown that these classes of genes have a similar function in rice flower development. Nevertheless, while B and C class genes in rice have been shown to control the development of the three inner whorls of the rice flower (Chung et al., 1995Go; Kang et al., 1995Go, 1998Go; Moon et al., 1999aGo; Kyozuka and Shimamoto, 2002Go; Xiao et al., 2003Go), as for their Arabidopsis homologs, the A function still remains controversial. AP1 of Arabidopsis is the best characterized class A gene, and its activity is necessary for the correct development of sepals and petals and for determining the identity of the flower meristems (Irish and Sussex, 1990Go; Mandel and Yanofsky, 1995Go). Furthermore AP1 is involved in the determination of inflorescence architecture together with the closely related FUL and CAL genes. AP1, FUL, and CAL act redundantly in the control of meristem identity, and only the ap1 ful cal triple-mutant plants exhibit a dramatic nonflowering phenotype, in which flower meristems are converted into leafy shoots (Ferrándiz et al., 2000Go).

In monocot species like barley (Hordeum vulgare) and wheat (Triticum aestivum), AP1-like genes have been demonstrated to be induced by vernalization in winter accessions and are probably involved in the floral transition (Trevaskis et al., 2003Go; Yan et al., 2003Go). In rice four MADS box genes (OsMADS20, OsMADS14, OsMADS15, and OsMADS18) show high sequence homology with AP1. Only for OsMADS14, functional studies have been reported by Jeon et al. (2000b)Go. They showed that ectopic expression of OsMADS14 in rice induced the development of shoot- or embryo-like structures from callus, on which subsequently abnormal flowers developed. Based on these results a real ortholog of AP1 has not yet been identified in rice.

Here we present the functional analysis of the rice MADS box gene OsMADS18 which belongs to the AP1/SQUA group of MADS box transcription factors (Moon et al., 1999bGo; Masiero et al., 2002Go; Pelucchi et al., 2002Go). OsMADS18 is widely expressed in all plant tissues. Overexpression of OsMADS18 in rice indicates a role in the acceleration of the differentiation program of the vegetative shoot meristems. The silencing of OsMADS18 using an RNA interference (RNAi) approach did not result in any visible phenotypic alteration, suggesting that a redundant background is able to compensate for the absence of OsMADS18.

The analysis of OsMADS18 in Arabidopsis revealed that some of the natural partners of AP1 are able to interact with OsMADS18, suggesting that OsMADS18, when overexpressed in Arabidopsis, can subtract AP1 protein partners from active transcription factor complexes. Although OsMADS18 appears not to be able to complement the AP1 function, it seems that the selectivity for protein partners is still conserved between these distantly related monocot and dicot MADS box proteins.


    RESULTS
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 

OsMADS18 Is an AP1/SQUA-Like MADS Box Gene

OsMADS18 is a rice MADS box transcription factor belonging to the AP1/SQUA clade of MADS box genes (Moon et al., 1999bGo; Pelucchi et al., 2002Go). An alignment of the amino acid sequences of OsMADS18 with FUL and AP1 of Arabidopsis, ZAP1 of maize, and other rice proteins belonging to the AP1/SQUA clade is presented in Figure 1. Interestingly, all the monocot proteins have a conserved sequence in the terminal part of the protein (LPPWML), which is also present in FUL but not in AP1 (Fig. 1; see also Litt and Irish, 2003Go; Vandenbussche et al., 2003Go). Furthermore, they lack the C-terminal amino acid motif (CFAA), present in AP1, which is recognized as the target for prenylation (Fig. 1). This sequence is likely to play an important role in the determination of the function and specificity of AP1 in Arabidopsis (Yalovsky et al., 2000Go). These data suggest that OsMADS18 and all other rice AP1/SQUA-type proteins are more closely related to FUL than to AP1.



View larger version (84K):
[in this window]
[in a new window]
 
Figure 1. Sequence alignment of AP1 and FUL of Arabidopsis; ZAP1 of maize; and OsMADS18, OsMADS14, OsMADS15, and OsMADS20 of rice. Black boxes indicate fully conserved residues, shaded boxes indicate similar and partially conserved residues. The MADS box region spans amino acids 1 through 58, the I region spans amino acids 61 through 93, and the K box spans amino acids 96 through 161.

 
Northern-blot analysis demonstrated that OsMADS18 transcripts could be detected in roots, leaves, inflorescences, and developing kernels (Masiero et al., 2002Go); however, expression analysis using seedlings showed that OsMADS18 is not expressed at early stages of plant development (Fig. 2). The transcripts are first detected in leaves 4 weeks after germination, and expression levels are increased when the plant reaches the reproductive stage (Fig. 2).



View larger version (34K):
[in this window]
[in a new window]
 
Figure 2. OsMADS18 expression in leaves. Northern-blot analysis using wild-type leaves at different developmental stages. 2w, Two weeks after germination; 3w, 3 weeks after germination; 4w, 4 weeks after germination; F, flowering time.

 
We analyzed by in situ expression experiments the spatial and temporal expression pattern in vegetative tissues and inflorescences. These experiments showed that after 30 d from germination the transcripts are present at high levels in the apical meristem and in the meristematic leaf primordia formed on its flanks. The same expression pattern was observed in the axillary vegetative meristems (Fig. 3A). Furthermore OsMADS18 is strongly expressed in adventitious root primordia formed at the base of the culm (Fig. 3B), but not in the parenchyma across which the adventitious root is elongating.



View larger version (55K):
[in this window]
[in a new window]
 
Figure 3. OsMADS18 expression analysis in vegetative and reproductive tissues by in situ hybridization. A, Axillary bud meristem 30 d after germination with meristematic leaf primordia. B, Adventitious root primordium protruding from the culm cortex 30 d after germination. C, Developing panicle at the early stage of secondary rachis-branch primordia differentiation. D, Close up of a flower primordium 50 d after germination. The hybridization signal is present in the meristematic domes of the flower and in the procambium forming the vascular bundle. v, Vegetative meristem; l, leaf primordium; s, secondary branch primordium; f, flower primordium; pc, procambium. A and B are bright field pictures, C and D are dark field pictures. Bars represent 100 µm in A and C, bars represent 50 µm in B and D.

 
After the floral transition, as the inflorescence develops, OsMADS18 transcripts are localized in the developing panicle at the early stage of secondary rachis-branch primordia differentiation. OsMADS18 is not expressed in the elongating inflorescence branches but is restricted to the meristematic domes that will subsequently give rise both to spikelets and to secondary branches (Fig. 3C). The transcript is also present in the procambium of the rachis branches and in all floral organ primordia (Fig. 3D). These analyses show that OsMADS18 is expressed in all parts of the plant with high expression levels in the roots and flower meristems.


OsMADS18 Functional Analysis in Rice by RNAi and Overexpression Approaches

RNAi-Mediated Silencing of OsMADS18
We used an RNAi-based approach to silence OsMADS18 in rice. A specific portion of the OsMADS18 cDNA, lacking the highly conserved MADS box and part of the I region, was cloned in antisense and sense orientation in an RNAi expression cassette, under the control of the cauliflower mosaic virus (CaMV) 35S promoter. The construct was transformed into rice by Agrobacterium-mediated transformation. A total of 31 independent hygromycin-resistant calli were obtained. For each of these calli one regenerated plant was analyzed in detail. The RNAi approach proved to be very efficient in silencing OsMADS18 since 60% of the lines showed reduction of transcript levels to various degrees (Fig. 4). For more than 80% of these lines OsMADS18 mRNAs could not be detected by northern-blot analysis while the remaining 20% still expressed OsMADS18, although very weakly. Both the 31 T0 plants and the T1 progeny of 10 selected transformants were normal in development. No visible alterations were observed in panicle and flower morphology. Furthermore, we analyzed these plants for differences in flowering time under inductive short day (12 h light/12 h dark) and noninductive long day (16 h light/8 h dark) conditions. This analysis showed that the flowering time of the RNAi plants is comparable to wild-type plants (data not shown). These observations suggest that other genes are possibly redundant with OsMADS18. Possible candidates for such a role, as inferred from phylogenetic analysis, are OsMADS14, OsMADS15, and/or OsMADS20 (Lee et al., 2003Go).



View larger version (49K):
[in this window]
[in a new window]
 
Figure 4. Expression analysis on OsMADS18 RNAi primary transformants. Total RNA was extracted from leaves of regenerated plants and used for northern-blot analysis. Hybridization was done using a probe specific for OsMADS18. Each lane represents an independent transformant. p1E and p4D are samples taken from two independent plants transformed with the empty vector. RNA quality and equal loading was checked by ethidium bromide staining (lower section).

 
Overexpression of OsMADS18 in Rice
To address the function of OsMADS18 in rice we constructed an overexpression cassette, fusing the OsMADS18 coding sequence with the strong CaMV35S promoter. Twenty-seven independent transgenic lines that overexpressed the transgene at different levels were identified (data not shown). Four of these plants that showed the highest levels of OsMADS18 expression remained very small in size and flowered at 105 d after germination compared to wild-type plants which flower at 140 d after germination (Fig. 5A). Two of them (501S and 1102S) were selected for further studies. Expression analysis of progeny plants of line 501S and 1102S demonstrated that OsMADS18 overexpression segregated with the early flowering phenotype (data not shown).



View larger version (83K):
[in this window]
[in a new window]
 
Figure 5. Analysis of 35S:OsMADS18 plants. A, Transgenic plants overexpressing OsMADS18 (a and c) flower earlier compared to wild type (b). The arrows indicate the emerging inflorescences of the transgenic plants. B and C, Stereomicroscope images of a wild-type (B) and 35S:OsMADS18 seedling (C) 5 d after germination. The leaves of the transgenic plant are enclosed in the coleoptile (C), whereas hypocotyl elongation and leaf expansion have already occurred in the wild type (B). Bars represent 1 mm. D, Mean length of adventitious roots (first row), and mean length of the culm (second row) of wild-type (gray columns) and 35S:OsMADS18 lines (black columns) after 7, 10, 15, 20, 25, and 30 d from germination. Bars indicate the SEs of the means.

 
In order to test whether OsMADS18 overexpression affected only the transition to flowering or had a broader effect on rice development, we carried out a detailed morphological analysis on plants, ranging from 0 to 30 d after germination (Fig. 5D). The first effects can already be observed 5 d after germination (Fig. 5, B and C). At this time leaves of transgenic plants are still enclosed by the coleoptile, while wild-type leaves are already emerging from it. After 7 d from germination wild-type plants are about 12 mm long while the transgenic 501S and 1102S plants are 5.5 mm on average (Fig. 5D). Lines 501S and 1102S stay smaller than wild-type plants and this effect is due to a lower rate of internode elongation (Fig. 6, D–G) and a reduction in the length of the leaf sheath. Despite this difference, leaf number is comparable between wild-type and transgenic lines. Regardless of this deficiency in elongation ability, mutant lines form axillary meristems earlier than wild-type plants. These axillary buds are visible in lines overexpressing OsMADS18 after 7 d from germination (Fig. 6, A and B), whereas in wild-type plants these buds develop only after 15 d from germination (Fig. 6C and Supplemental Fig. 1, available at www.plantphysiol.org). Furthermore, in the leaves of the transgenic plants the aerenchyma differentiates earlier than in wild-type plants and the aerenchyma cavities are larger (Fig. 6, A and B).



View larger version (208K):
[in this window]
[in a new window]
 
Figure 6. Histological analysis of 35S:OsMADS18 transgenic plants (A, D, F, and H) and of wild-type plants (B, C, E, G, and I) at various days from germination. A to C, H, and I are transverse sections, D to G are longitudinal sections. A and B, Axillary bud (arrow) differentiated in 35S:OSMADS18 lines (A) and not in the wild-type plants (B) after 7 d (sections at the same distance from the shoot apex). The differentiation of aerenchyma (a) is more precocious in transgenic than in wild-type plants. C, The axillary bud (arrow) is present in the wild type after 15 d. D and E (day 30), Internodes are shorter in the 35S:OSMADS18 lines (D) compared to the wild type (E). The arrows show the meristematic regions of the nodes. F and G, Close-up pictures of D and E, showing the shoot region with two apical nodes at higher magnification. H and I, Comparison between the adventitious roots of transgenic plants (H) and wild type (I). Root cortex aerenchyma (a) is more developed in transgenic plants. (Bars represent 100 µm in A–E and G; bars represent 50 µm in F and H–I).

 
We also monitored the effects on root development in the transgenic lines 501S and 1102S. Microscopic analysis revealed that the adventitious root primordia develop at the same time as in wild-type plants although their number was reduced in these transgenic lines. Furthermore, at early stages the adventitious root elongation in lines 501S and 1102S is slower compared to wild-type plants (Fig. 5D; Supplemental Table I).

The differences between wild-type and transgenic lines are more evident shortly after germination but, as the plants proceed in development, the developmental gap between wild-type and transgenic lines is progressively reduced (Fig. 5D; Supplemental Table I). After 30 d from germination the number and length of adventitious roots in wild-type and transgenic lines are comparable although in the transgenic lines the aerenchyma is still at a more advanced stage of development (Fig. 6, H and I).


Expression of OsMADS18 in Arabidopsis Causes an ap1 Mutant Phenotype

AP1/SQUA-like genes, when overexpressed, generally cause an early flowering phenotype. To investigate whether OsMADS18 also induces early flowering in Arabidopsis we ectopically expressed OsMADS18 in this heterologous system. No significant effect on flowering time was observed, however, surprisingly, 10% of the plants (of a total of 100 transformants) showed floral phenotypes that were very similar to the ap1 mutant (Fig. 7H; Irish and Sussex, 1990Go; Bowman et al., 1993Go). The mildest phenotypes show only a reduction in sepal and petal size (Fig. 7B). The result is that the pistil is not enclosed by the perianth organs and protrudes from the flower. Plants having an intermediate phenotype have flowers that in the first whorl develop leaf-like organs bearing stellate trichomes, which is typical for cauline leaves (Fig. 7C), while wild-type sepals have simple trichomes (Fig. 7A).



View larger version (57K):
[in this window]
[in a new window]
 
Figure 7. OsMADS18 overexpression in Arabidopsis. A, Wild-type flower. B, Weakly affected flower showing reduction in the size of petals and sepals. C, Weakly affected flower in which normal petals develop and sepals are converted into leaf-like structures that differentiate stellate trichomes (arrow). D and E, Strongly affected flowers that develop a new flower at the axil of a first whorl organ. F, Severe flower phenotype in which first whorl organs develop carpelloid characteristics. Stigmatic papillae are evident at the tip of the organs and ovules develop along their margins. G, Tertiary and quaternary flowers arise at the axil of the first whorl organs in most affected flowers. H, An ap1-10 mutant flower.

 
Around 5% of the plants showed more severe phenotypes. Some of the first-whorl organs were homeotically converted to carpelloid organs on which ovules developed (Fig. 7F). In these severely affected flowers the petals were, in general, completely absent (Fig. 7, E and F). Frequently the most affected plants had flowers from which extra flowers arose from the axils of the first whorl organs (Fig. 7) and this pattern was reiterated producing tertiary and even quaternary flowers (Fig. 7G).


In CaMV35S:OsMADS18 Arabidopsis Plants AP1 Expression Is Not Affected

One of the possible explanations for the ap1 phenotypes that we observed in the Arabidopsis plants that expressed OsMADS18 could be that in these transgenic plants the expression of the endogenous AP1 gene is repressed. To verify this possibility we performed a reverse transcription (RT)-PCR analysis to check for the expression of AP1 in these transgenic plants. Figure 8 shows the RT-PCR products obtained using RNA extracted from transgenic and control wild-type flowers. These analyses show that AP1 expression is not affected in these transgenic plants.



View larger version (39K):
[in this window]
[in a new window]
 
Figure 8. RT-PCR on leaves of wild-type and transgenic 35S:OsMADS18 plants. 1, OsMADS18 overexpressing line showing no visible phenotype. 2 to 4, OsMADS18 overexpressing lines showing flower phenotypes described in Figure 7D, F, and G, respectively. +, positive control.

 

OsMADS18 Interacts With MADS Box Factors That Form Dimers With AP1

Another possible explanation for the observed ap1 phenotype in the OsMADS18-expressing Arabidopsis plants is that the OsMADS18 protein interacts with proteins that normally dimerize with AP1, since OsMADS18 shows significant sequence homology over a large part of the protein (Fig. 1). When these OsMADS18-containing protein complexes are not fully functional, this interaction could result in a dominant negative ap1 mutant phenotype.

Yeast Two-Hybrid Assay Using OsMADS18 as a Bait
Recently we used OsMADS18 for a yeast two-hybrid screen to identify proteins that interact with this MADS box factor (Masiero et al., 2002Go). The complete OsMADS18 open reading frame, with the exception of the Met initiation codon, was cloned in the vector GAL4-BD in frame with the DNA-binding domain of GAL4. This construct was used to screen a rice cDNA expression library made from RNA extracted from leaf, inflorescence, and developing kernel tissues (see Masiero et al., 2002Go). This yeast two-hybrid screen resulted in the identification of the MADS box factors OsMADS24, OsMADS45, OsMADS6, and OsMADS47. The interaction between OsMADS18 and OsMADS6 has been reported previously by Moon et al. (1999b)Go, which used OsMADS6 as a bait. Apart from the MADS box encoding cDNAs, an additional non-MADS box clone was isolated encoding a CCAAT-binding protein complex subunit, NF-YB (Masiero et al., 2002Go). OsMADS24 (also called OsMADS8) and OsMADS45 (also called OsMADS7) are the rice MADS box factors that show high sequence identity with the Arabidopsis SEP proteins. Whereas OsMADS6 shows the highest homology with AGL6, and OsMADS47 is similar to SVP and AGL24 from Arabidopsis (Ma et al., 1991Go; Greco et al., 1997Go; Moon et al., 1999bGo; Hartmann et al., 2000Go; Pelaz et al., 2000Go; Yu et al., 2002Go; Michaels et al., 2003Go). All the MADS box clones isolated by the two-hybrid screen were partial cDNAs. OsMADS24 and OsMADS45 lacked sequences corresponding to 8 and 10 amino acids, respectively, at the N terminus of the MADS domain. The longest OsMADS6 clone that we isolated started at nucleotide 204, lacking the whole MADS domain and part of the I region. The longest clone obtained for OsMADS47 lacked the whole MADS domain and the I region. These observations indicate that, at least for these MADS box proteins, the K region is probably sufficient to establish the interaction.

To confirm the interaction between OsMADS18 and its putative partners, the complete open reading frames of OsMADS47, OsMADS24, OsMADS45, and OsMADS6 were cloned in frame with the activation domain of GAL4 in the vector GAL4-AD. The plasmids obtained were named 47-AD, 24-AD, 45-AD, and 6-AD. Yeast strain PJ694A (James et al., 1996Go) was cotransformed with the binding domain vector containing OsMADS18 (18-BD) and one of each of the activation domain vectors (47-AD, 24-AD, 45-AD, and 6-AD). Yeast strain PJ694A allows selection for three different reporter genes: adenine, His, and LacZ. The yeast transformants obtained were all able to activate each of the reporter genes. When selected for activation of the HIS3 reporter, different concentrations of 3AT were added to the media to examine the stability of the interaction. Each of the OsMADS18 partners was able to grow on medium containing high concentrations of 3AT (5 mM), indicating that all the interactions were stable (Table I).


View this table:
[in this window]
[in a new window]
 
Table I. OsMADS18 interactions tested with yeast two-hybrid assays

 
To investigate whether OsMADS18 was able to form homodimers the OsMADS18 open reading frame was also cloned as an activation domain fusion protein. Both the 18-BD and 18-AD vectors were introduced into PJ694A and their interaction was assayed by growth on selective media and by {beta}-galactosidase assays. The lack of activation of the markers showed that OsMADS18 is not able to form homodimers (Table I).

In Vitro Confirmation of Two-Hybrid Interactions
In order to confirm the observed yeast two-hybrid interactions with OsMADS18, coimmunoprecipitation experiments between OsMADS18 and its partner OsMADS24 were performed (Fig. 9). OsMADS24 was produced by in vitro transcription-translation, including 35S-Met, whereas OsMADS18 was expressed in Escherichia coli as a thioredoxin (TRX) fusion protein. The protein extracts containing the 35S-labeled OsMADS24 and the TRX-OsMADS18 fusion protein were mixed with G protein and antibodies raised against the thioredoxin domain. A control incubation was performed using a mixture lacking OsMADS18. The protein G-agarose was washed several times and proteins were subsequently separated by SDS-polyacrylamide gel-electrophoresis. Labeled OsMADS24 was detected by autoradiography only when OsMADS18 was present in the protein mixture, indicating that OsMADS24 specifically interacts with OsMADS18.



View larger version (52K):
[in this window]
[in a new window]
 
Figure 9. In vitro binding of OsMADS18 and OsMADS24. OsMADS18 was produced in E. coli as a TRX fusion protein, and OsMADS24 was translated in vitro in the presence of 35S-Met. OsMADS18 and OsMADS24 were mixed and loaded on a G protein anti-TRX antibody column. The flow-through was collected and the column was washed several times. A control experiment was performed without adding OsMADS18. The protein G-protein complex was separated by SDS-PAGE and 35S-Met labeled OsMADS24 was detected by autoradiography. A, L, 35S-Met labeled OsMADS24 in vitro translation product. B1, Protein G protein complex. FT1, Flow-through fraction. B, Control column. B2, Protein G protein complex. FT2, Flow-through fraction.

 
OsMADS18 Interacts with SEP Proteins from Arabidopsis
As reported by Pelaz et al. (2001)Go proteins interacting with AP1 are SEP3, SVP, AGL24, and SOC1. SEP3 is the strongest interactor and is necessary for normal petal development (Honma and Goto, 2001Go; Pelaz et al., 2001Go). To confirm that OsMADS18 can indeed interact with protein partners of AP1 we tested by two-hybrid assays whether OsMADS18 interacts with SEP3. These assays showed that OsMADS18 indeed forms dimers with SEP3 of Arabidopsis (Table I). Furthermore, we tested also SEP1 and SEP2, which are highly homologous to SEP3. In these assays only SEP1 shows a clear interaction with OsMADS18. When we checked AP1 for interactions with the SEP proteins we obtained the same result: AP1 interacts only with SEP1 and SEP3 and not with SEP2 (Table II). It could well be that the interaction with SEP2 is somehow less stable in yeast, which might be different in plant cells.


View this table:
[in this window]
[in a new window]
 
Table II. AP1 interaction tested by yeast two-hybrid

 
To investigate further the evolutionary conservation of the AP1 and OsMADS18 interactions we also tested AP1 for interaction with the rice homologs of SEP3 (Table II). These assays showed that AP1 makes stable interactions with OsMADS24 and OsMADS47. These results indicate that AP1 and OsMADS18 each form heterodimers that are conserved between monocot and dicot plants.


    DISCUSSION
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 

OsMADS18 Belongs to the FUL Lineage of MADS Box Transcription Factors

In our effort to isolate and study MADS box genes involved in flower development and floral transition, we started with the functional characterization of OsMADS18. Phylogenetic reconstruction placed OsMADS18 in the AP1/SQUA clade, in close relationship to AP1 and FUL from Arabidopsis and SQUA from Antirrhinum. Recently, Litt and Irish (2003)Go showed that the monocot lineage evolved only FUL-like proteins, while AP1-like proteins seem to be characteristic of the eudicot (eu) clade. Differences in the C-terminal domain are responsible for this splitting since FUL-like sequences present a highly conserved hydrophobic box (L/MPPWML), which cannot be found in the euAP1 clade. The euAP1 lineage instead shows two typical conserved motifs, RRNaLaLT/NLa and a farnesylation domain (CFAT/A) that terminates the protein (Litt and Irish, 2003Go; Vandenbussche et al., 2003Go). OsMADS18 shows the typical FUL-like LPPWML motif and lacks the ending farnesylation box supporting for a derivation from the FUL-lineage. Farnesylation was shown to be important for the correct function of AP1 both in vivo and in vitro, but it is interesting to note that the absence of a farnesylation domain in FUL-like proteins from both monocots and dicots doesn't seem to alter their ability to complement the AP1 function in an ap1 mutant background (Yalovsky et al., 2000Go; Berbel et al., 2001Go; Gocal et al., 2001Go; Jang et al., 2002Go).

OsMADS18 is widely expressed in rice, as revealed by expression analysis in flowering plants (Pelucchi et al., 2002Go). Detailed expression analysis during early stages of plant development showed that the OsMADS18 transcripts are present in all tissues analyzed and accumulate to higher levels in organs that retain meristematic characteristics like the adventitious root meristems, primary and axillary shoot meristems, secondary inflorescence branches meristems and in the procambial strand region. The expression in the flower meristem and in the floral organ primordia is common for members of the AP1/SQUA subfamily of MADS box genes (Huijser et al., 1992Go; Mandel et al., 1992Go; Mena et al., 1995Go; Moon et al., 1999bGo; Kyozuka et al., 2000Go). Furthermore, the expression of OsMADS18 in the roots and procambium is similar to that reported for LtMADS1 of Lolium temulentum and of SaMADSB of Sinapsis alba (Menzel et al., 1996Go; Gocal et al., 2001Go) and suggests a role of this gene in the specific development of these tissues.

OsMADS18 transcripts can be detected in rice leaves only after 4 weeks from germination, and the increase in steady state mRNA levels correlates with the progressive acquisition of flowering competence. Also in other monocot species, like barley and wheat, the switch to the reproductive stage is marked by an increase in expression of AP1/SQUA-like genes. In winter accessions of wheat, Triticum monococcum, and barley, the WAP1, TmAP1, and BM5 genes, respectively, show a marked increase in transcript levels during the induction of the reproductive phase (Trevaskis et al., 2003Go; Yan et al., 2003Go). In spring accessions of wheat and barley that do not require a cold treatment to flower, the expression of these genes is independent of a cold treatment. Since rice is a subtropical species it does not require a vernalization treatment. Nevertheless, also in rice we observed increased levels in OsMADS18 expression when plants are in the reproductive phase. These observations confirm the idea that in monocot species increased levels of AP1/SQUA-like gene transcripts are important for the floral transition (Jeon et al., 2000bGo; Trevaskis et al., 2003Go; Yan et al., 2003Go). Despite this general behavior of this class of genes during the floral transition, the pathways that lead to the change in their expression are probably different, since in vernalization-dependent species their expression is regulated by cold, whereas in subtropical species like rice other pathways are probably regulating the AP1/SQUA-like genes.


Functional Analysis of OsMADS18 Reveals a Role in the Promotion of Flowering in Rice

Since increased expression of AP1/SQUA-like genes in monocots is correlated with the floral transition we investigated whether alterations in OsMADS18 expression caused changes in flowering time. Transgenic rice plants overexpressing OsMADS18 showed an early flowering phenotype with a heading date that was anticipated 5 weeks when compared to the wild type. All rice MADS box genes belonging to the AP1/SQUA subfamily characterized so far, have been shown to cause early flowering when overexpressed (Chung et al., 1994Go; Kang et al., 1997Go; Jeon et al., 2000bGo). This effect is similar to that shown by genes such as AP1 and FUL when ectopically expressed in Arabidopsis (Mandel and Yanofsky, 1995Go; Ferrándiz et al., 2000Go). Thus OsMADS18 retains the ability, as other AP1/SQUA-like genes, to induce flowering although it is not clear from these experiments whether flowering is promoted directly by OsMADS18 or through repression of a negative regulator.

Ectopic expression of OsMADS18 induced precocious initiation of axillary shoot meristems. This observation together with the early transition to flowering suggests that OsMADS18 is able to promote the differentiation program of the vegetative shoots. This effect is not maintained for the entire life cycle but is progressively reduced, and when the plants are at 30 d after germination there is almost no difference anymore between the wild-type and transgenic plants. Assuming that OsMADS18 is able to stimulate shoot differentiation, its ectopic expression at early stages of plant development (when OsMADS18 normally is not expressed) might cause the observed acceleration. Whereas at later stages when OsMADS18 is normally expressed, the overexpression of this gene has no significant effect.

Silencing of OsMADS18 through an RNAi approach did not result in any phenotypic effect when compared to wild-type plants. Although RNAi-based gene silencing is very effective in rice, as already reported by Hayama et al. (2003)Go and Xiao et al. (2003)Go, the redundancy with other members of the AP1/SQUA subfamily may have masked the role of OsMADS18. Possible candidates for redundancy are OsMADS14, OsMADS15, and/or OsMADS20 (Moon et al., 1999bGo; Kyozuka et al., 2000Go; Jang et al., 2002Go; Lee et al., 2003Go).


Overexpression of OsMADS18 in Arabidopsis Causes an ap1 Mutant Phenotype

By expression of OsMADS18 in Arabidopsis we investigated whether this rice gene can stimulate flowering, as has been shown for the SQUA-like genes AP1 and FUL (Mandel and Yanofsky, 1995Go; Ferrándiz et al., 2000Go). In Arabidopsis plants overexpressing AP1 the inflorescence shoot meristems are converted into flower meristems and the plants flower dramatically early compared to wild type (Mandel and Yanofsky, 1995Go). When OsMADS18 was expressed in Arabidopsis, flowering occurred at the same time as wild type but, strikingly, 10% of the plants showed a flower phenotype closely resembling that of ap1 (Irish and Sussex, 1990Go; Bowman et al., 1993Go).

Although the severity of the observed phenotypes varied between the different transgenic lines, their phenotypes were always similar to those previously described for ap1 mutants (Bowman et al., 1993Go; Schultz and Haughn, 1993Go).

The ap1 mutant phenotype observed in plants expressing OsMADS18 is not due to silencing of AP1, since AP1 is normally expressed in these transgenic plants. Since AP1 forms ternary complexes to exploit its functions, OsMADS18 might interact with the same partners as AP1 giving rise to inactive complexes and acting as a dominant negative factor. It has been reported that AP1 interacts with SEP proteins, SVP and AGL24 (Pelaz et al., 2001Go). Interestingly, OsMADS18 shares the same kind of protein partners in rice as AP1 has in Arabidopsis. OsMADS18 can interact in yeast with OsMADS24 and OsMADS45 (SEP-like), OsMADS47 (SVP/AGL24-like), and OsMADS6 (AGL6-like, although an interaction between AGL6 and AP1 has never been reported).

The two-hybrid screen for OsMADS18 partners in rice resulted in isolation of partial proteins although none of the sequences lacked the regions corresponding to the K box. We dissected the OsMADS18 domains to identify those important for dimerization and confirmed that only those containing a K box were able to interact with OsMADS18 partners (Supplemental Table II). This confirms previous reports that the K box is important for MADS box protein dimerization (Krizek and Meyerowitz, 1996Go; Fan et al., 1997Go; Moon et al., 1999bGo; Lim et al., 2000Go; Pelaz et al., 2001Go; Yang et al., 2003Go). The fact that OsMADS18 interacts with the same type of protein partners as AP1, together with the observation that the K box is highly conserved between AP1 and OsMADS18, strongly suggested that OsMADS18 also interacts with partners of AP1. To verify this possibility we tested the interaction between the SEP proteins and OsMADS18. These experiments demonstrated that OsMADS18 strongly interacts with SEP1 and SEP3 while no interaction was found between OsMADS18 and SEP2. Interestingly in our experiments also AP1 could not interact with SEP2.

It is very likely that the observed ap1 phenotype is caused by the formation of complexes between OsMADS18 and AP1 partners, which might be able to bind to the same target genes as those containing AP1. However, those containing OsMADS18 are probably functionally inactive, blocking the binding of the functional AP1 complexes. In this scenario the dominant negative effect is not due to the subtraction of SEP proteins from active complexes but more likely involves competition between active and nonactive complexes on the promoters of AP1 target genes.

The dominant negative effect is not observed in rice flowers when we overexpressed OsMADS18 since the complexes formed with OsMADS18 are functional, activating the natural set of target genes. Furthermore, the fact that we do not observe any floral phenotypic effect indicates that the increased OsMADS18 mRNA levels do not interfere with normal flower development.

As OsMADS18 is able to interact with at least a subset of the AP1 partners in yeast we demonstrated that AP1 can, vice versa, interact with OsMADS24 and OsMADS45 but not with OsMADS6. It's clear from these experiments that, although different in expression pattern, OsMADS18 and AP1 still retain the ability to interact with phylogenetically related partners. The analysis of conserved interactions can be used to compare putative functional homologs as already demonstrated for other rice MADS box factors (Moon et al., 1999aGo; Favaro et al., 2002Go; Immink and Angenent, 2002Go).

It seems likely that a parallel exists between complexes formed in rice and Arabidopsis and, although their functionality cannot be fully restored when corresponding partners are exchanged, they strongly indicate their evolutionary common origin.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 

Plant Material

For the overexpression and RNAi-mediated silencing of OsMADS18, the indica cultivar Cypressus and the japonica cultivar Nipponbare were used, respectively. Overexpression of OsMADS18 in Arabidopsis was carried out in the Wassilewskjia ecotype.


Production and Growth of Transgenic Plants

Transformation of rice (Oryza sativa) was carried out by cocultivation of Agrobacterium tumefaciens and embryogenic scutellum-derived calli from mature rice seeds as described by K. D'Halluin and E. Gobel (1992; Publication of the International Application under the Patent Cooperation Treaty WO 92/09696) and by Hiei et al. (1994)Go. Regenerated rice plants were grown in greenhouse with a light/dark cycle of 12 h/12 h. Supplementary artificial light was provided. The temperature was artificially maintained at 28°C during the day and at 22°C by night.

Arabidopsis was transformed according to the floral dip method as described by Clough and Bent (1998)Go. The plants were grown at 22°C under long-day conditions (16 h light/8 h dark).


Sequence Analysis

Protein sequences were aligned using the multiple alignment mode of the ClustalX software (ver. 1.83), visualized and edited with the GENEDOC utilities (ver. 2.3.000; www.psc.edu/biomed/genedoc).


Plasmids Construction

OsMASD18 cDNA was amplified with primers OL13 and OL14 (OL13, GAATTCGGGAGAGGGCCGGTGC; OL14, GTCGACTCATGTGTGACTTGTCCGGAG) to introduce the cloning sites EcoRI and SalI. Amplification was followed by digestion, and the DNA fragment was cloned in pBDGAL4 (18-BD). The bait includes the complete coding sequence of OsMADS18, excluding the initial Met. The bait deletions of OsMADS18 were also generated by PCR, subsequently digested and cloned in pBDGAL4 as described by Masiero et al. (2002)Go.

The complete OsMADS18-coding region was cloned in pET32a to produce the recombinant protein (TRX-OsMADS18), using oligos OL13 and OL14. OsMADS18 was fused in frame with thioredoxin at the N-terminal domain and with a tail of 6 His residues. This plasmid was used to transform Escherichia coli strain BL21 (DE3) plysS. The overexpression system based on the T7 promoter was used to produce the recombinant protein (Studier et al., 1990Go). The TRX-OsMADS18 recombinant protein was purified using an affinity Ni-column (Qiagen, Valencia, CA).

To construct the 35S:OsMADS18 overexpression plasmid, BstXI and NheI cloning sites were introduced in the OsMADS18 cDNA by means of PCR. The entire coding region of OsMADS18 was fused as a BstXI-NheI fragment in the sense orientation to the 61-bp fragment of the leader sequence from the chlorophyll a/b binding protein gene (cab22L) from petunia (Harpster et al., 1988Go), to the 535-bp fragment of the CaMV35S promoter, and the 265-bp CaMV 35S terminator sequence fragment at the 3' end. The 35S:OsMADS18 chimeric gene was introduced into the plant transformation vector pTCV0254 derived from pGSV1 (Cornelissen and Vandewiele, 1989Go). PTCV0254 contains a 567-bp fragment of the bialophos resistance gene (BAR) of Streptomyces hydroscopicus under the control of the CaMV 35S promoter (Denecke et al., 1989Go) between the left and right T-DNA borders.

To construct the OsMADS18 RNAi plasmid a specific portion of OsMADS18 (corresponding to nucleotide position 83–280) was amplified with OL668 (GGGGACAAGTTTGTACAAAAAAGCAGGCTTACTGGAGCCAAATACTGAG) and OL669 (GGGGACCACTTTGTACAAGAAAGCTGGGTCAAGTCACACATGAAGGCATCTG). The product of the amplification was cloned into the binary vector pFRH using the Gateway Cloning Technology (Invitrogen, Carlsbad, CA).


Northern-Blot Analysis and RT-PCR

Total RNA was extracted from rice tissues as described by Verwoerd et al. (1989)Go. For northern-blot analysis 10 µg of glyoxal-denatured (1.5 M) total RNA was electrophorized and blotted onto Hybond N+ membranes (Amersham, Buckinghamshire, UK). A 3' gene-specific fragment of OsMADS18 was used for hybridization. Probes were labeled using the Random Priming DNA labeling kit supplied by Roche (Basel). Blots were hybridized as described by Colombo et al. (1998)Go. For RT-PCR analysis, cDNA was produced according to the SuperScript First-Strand Synthesis System (Invitrogen).


Morphological Analysis

For the histological analysis, wild-type seeds and 35S:OsMADS18 seeds were sterilized according to Hiei et al. (1994)Go and plated on Murashige and Skoog medium, supplemented with 1% (w/v) Suc and 0.8% (w/v) agar (pH 5.8). The seeds were cultured for 40 d at 28°C under 12-h light/d. The germinated seedlings were sampled at 7, 10, 15, 20, 25, and 30 d after germination, fixed in 70% ethanol, dehydrated through a graded ethanol series, and subsequently embedded in paraffin and sectioned at 8 µm. The sections were stained with 0.05% toluidine blue or with eosin and Carazzi's haemalum. A DAS Leica DMRB microscope and a Leica MZ8 stereomicroscope were used for the analyses (Wetzler, Germany). Differences between the mean number of roots and mean length of roots and stems were evaluated at least three times with similar results.


In Situ Hybridization

Developing inflorescences of wild-type plants (O. sativa L. cv Nipponbare) were fixed and embedded in paraffin as described by Lopez-Dee et al. (1999)Go. Digoxygenin-labeled (DIG) gene-specific antisense RNA probes were generated by in vitro transcription following the instructions of the in vitro transcription kit (Roche). Hybridization and immunological detection were performed as described by Lopez-Dee et al. (1999)Go.


Yeast Two-Hybrid Screening

Yeast strain HF7c, used for the library screening, was supplied by CLONTECH Laboratories (Palo Alto, CA; Feilotter et al., 1994Go). The two-hybrid screen was carried out as previously reported by Davies et al. (1996)Go. For the library transformation 60 µg of DNA was used. The interactions between OSMADS18 and its partners were confirmed in yeast strain PJ69-4A (James et al., 1996Go). PJ69-4A was also used to test the bait deletions of OsMADS18 against 24-AD, 45-AD, 47-AD, and 6-AD. The lacZ test was performed according to Davies et al. (1996)Go.


Coimmunoprecipitation

The TNT-coupled Reticulocyte Lysate system (Promega, Madison, WI) was used to make in vitro translated proteins, and 35S-Met was incorporated to label the protein. To perform coimmunoprecipitation experiments protein G-agarose was used since anti-thioredoxin antibodies have high affinity for it. The conditions employed for coimmunoprecipitation were reported previously by Goto and Meyerowitz (1994)Go.


Distribution of Materials

Upon request, all novel materials described in this publication will be made available in a timely manner for noncommercial research purposes.


    ACKNOWLEDGMENTS
 
We thank Dr. Marten Denekamp for providing the pFRH RNAi binary vector.

Received April 22, 2004; returned for revision May 25, 2004; accepted May 25, 2004.


    FOOTNOTES
 
1 This work was supported in part by the EU grants Cereal Gene Tags (QLG2–CT–2001–01453) and Conflow (QLK5–CT–2001–01412) and by the national grants Cofin '98 and Ateneo 2003. L.P. was supported by a European Community postdoctoral fellowship (QLK5–CT–2000–52129). Back

2 These authors contributed equally to the paper. Back

3 Present address: DSM Food Specialties, P.O. Box 1, 2600 MA Delft, The Netherlands. Back

4 Present address: Max-Planck-Institute für Züchtungforschung, Carl-von-Linne-Weg 10, 50829 Köln, Germany. Back

5 Present address: Plant Development and Reproduction, Plant Research International B.V., P.O. Box 16, 6700 AA Wageningen, the Netherlands. Back

[w] The online version of this article contains Web-only data. Back

Article, publication date, and citation information can be found at www.plantphysiol.org/cgi/doi/10.1104/pp.104.045039.

* Corresponding author; e-mail martin.kater{at}unimi.it; fax 0039–02–50315044.


    LITERATURE CITED
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 
Ambrose BA, Lerner DR, Ciceri P, Padilla CM, Yanofsky MF, Schmidt RJ (2000) Molecular and genetic analyses of the Silky1 gene reveal conservation in floral organ specification between eudicots and monocots. Mol Cells 5: 569–579[CrossRef][Web of Science][Medline]

Angenent GC, Franken J, Busscher M, van Dijken A, van Went JL, Dons HJ, van Tunen AJ (1995) A novel class of MADS box genes is involved in ovule development in petunia. Plant Cell 7: 1569–1582[Abstract]

Berbel A, Navarro C, Ferrándiz C, Cañas LA, Madueño F, Beltrán JP (2001) Analysis of PEAM4, the pea AP1 functional homologue, supports a model for AP1-like genes controlling both floral meristem and floral organ identity in different plant species. Plant J 25: 441–451[CrossRef][Web of Science][Medline]

Bowman JL, Alvarez J, Weigel D, Meyerowitz EM, Smyth DR (1993) Control of flower development in Arabidopsis thaliana by APETALA1 and interacting genes. Development 119: 721–743[Abstract]

Bowman JL, Smyth DR, Meyerowitz EM (1991) Genetic interactions among floral homeotic genes of Arabidopsis. Development 112: 1–20[Abstract]

Carpenter R, Coen ES (1990) Floral homeotic mutations produced by transposon-mutagenesis in Antirrhinum majus. Genes Dev 4: 1483–1493[Abstract/Free Full Text]

Chung YY, Kim SR, Finkel D, Yanofsky MF, An G (1994) Early flowering and reduced apical dominance result from ectopic expression of a rice MADS box gene. Plant Mol Biol 26: 657–665[CrossRef][Web of Science][Medline]

Chung YY, Kim SR, Kang HG, Noh YS, Park MC, Finkel D, An G (1995) Characterization of two rice MADS box genes homologous to GLOBOSA. Plant Sci 109: 45–56[CrossRef]

Clifford HT (1987) Spikelets and floral morphology. In TR Soderstrom, K Hilu, CS Campbell, ME Barkworth, eds, Grass Systematics and Evolution. Smithsonian Institute Press, Washington DC

Clough SJ, Bent AF (1998) Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J 16: 735–743[CrossRef][Web of Science][Medline]

Coen ES, Meyerowitz EM (1991) The war of the whorls: genetic interactions controlling flower development. Nature 353: 31–37[CrossRef][Medline]

Colombo L, Franken J, Koetje E, van Went J, Dons HJ, Angenent GC, van Tunen AJ (1995) The petunia MADS box gene FBP11 determines ovule identity. Plant Cell 7: 1859–1868[Abstract]

Colombo L, Marziani G, Masiero S, Wittich PE, Schmidt RJ, Sari-Gorla M, Pé ME (1998) BRANCHED SILKLESS mediates the transition from spikelet to floral meristem during Zea mays ear development. Plant J 16: 355–363[CrossRef][Web of Science]

Cornelissen M, Vandewiele M (1989) Nuclear transcriptional activity of the tobacco plastid psbA promoter. Nucleic Acids Res 17: 19–29[Abstract/Free Full Text]

Davies B, Egea-Cortines M, de Andrade Silva E, Saedler H, Sommer H (1996) Multiple interactions amongst floral homeotic MADS box proteins. EMBO J 15: 4330–4343[Web of Science][Medline]

Denecke J, Gossele V, Botterman J, Cornelissen M (1989) Quantitative analysis of transiently expressed genes in plant cells. Methods Mol Cell Biol 1: 19–27

Egea-Cortines M, Saedler H, Sommer H (1999) Ternary complex formation between the MADS box proteins SQUAMOSA, DEFICIENS and GLOBOSA is involved in the control of floral architecture in Antirrhinum majus. EMBO J 18: 5370–5379[CrossRef][Web of Science][Medline]

Fan HY, Hu Y, Tudor M, Ma H (1997) Specific interactions between the K domains of AG and AGLs, members of the MADS domain family of DNA binding proteins. Plant J 12: 999–1010[CrossRef][Web of Science][Medline]

Favaro R, Immink RGH, Ferioli V, Bernasconi B, Byzova M, Angenent GC, Kater M, Colombo L (2002) Ovule-specific MADS box proteins have conserved protein-protein interactions in monocot and dicot plants. Mol Genet Genomics 268: 152–159[CrossRef][Web of Science][Medline]

Favaro R, Pinyopich A, Battaglia R, Kooiker M, Borghi L, Ditta G, Yanofsky MF, Kater MM, Colombo L (2003) MADS box protein complexes control carpel and ovule development in Arabidopsis. Plant Cell 15: 2603–2611[Abstract/Free Full Text]

Feilotter HE, Hannon GJ, Ruddel CJ, Beach D (1994) Construction of an improved host strain for two hybrid screening. Nucleic Acids Res 22: 1502–1503[Free Full Text]

Ferrándiz C, Gu Q, Martienssen R, Yanofsky MF (2000) Redundant regulation of meristem identity and plant architecture by FRUITFUL, APETALA1 and CAULIFLOWER. Development 127: 725–734[Abstract]

Ferrándiz C, Liljegren SJ, Yanofsky MF (2000) Negative regulation of the SHATTERPROOF genes by FRUITFUL during Arabidopsis fruit development. Science 289: 436–438[Abstract/Free Full Text]

Ferrario S, Immink RGH, Shchennikova A, Busscher-Lange J, Angenent GC (2003) The MADS box gene FBP2 is required for SEPALLATA function in petunia. Plant Cell 15: 914–925[Abstract/Free Full Text]

Fornara F, Marziani G, Mizzi L, Kater M, Colombo L (2003) MADS box genes controlling flower development in rice. Plant Biol 5: 16–22

Gocal GFW, King RW, Blundell CA, Schwartz OM, Andersen CH, Weigel D (2001) Evolution of floral meristem identity genes: analysis of Lolium temulentum genes related to APETALA1 and LEAFY of Arabidopsis. Plant Physiol 125: 1788–1801[Abstract/Free Full Text]

Goto K, Meyerowitz EM (1994) Function and regulation of the Arabidopsis floral homeotic gene PISTILLATA. Genes Dev 8: 1548–1556[Abstract/Free Full Text]

Greco R, Stagi L, Colombo L, Angenent GC, Sari-Gorla M, Pè ME (1997) MADS box genes expressed in developing inflorescences of rice and sorghum. Mol Gen Genet 253: 615–623[CrossRef][Web of Science][Medline]

Harpster MH, Townsend JA, Jones JDG, Bedbrook J, Dunsmuir P (1988) Relative strengths of the 35S califlower mosaic virus, 1', 2', and nopaline synthase promoters in transformed tobacco sugarbeet and oilseed rape callus tissue. Mol Gen Genet 212: 182–190[CrossRef][Medline]

Hartmann U, Höhmann S, Nettesheim K, Wisman E, Saedler H, Huijser P (2000) Molecular cloning of SVP: a negative regulator of the floral transition in Arabidopsis. Plant J 21: 351–360[CrossRef][Web of Science][Medline]

Hayama R, Yokoi S, Tamaki S, Yano M, Shimamoto K (2003) Adaptation of photoperiodic pathways produces short-day flowering in rice. Nature 422: 719–722[CrossRef][Medline]

Hiei Y, Komari T, Kubo T (1994) Transformation of rice mediated by Agrobacterium tumefaciens. Plant Mol Biol 35: 205–218

Honma T, Goto K (2001) Complexes of MADS box proteins are sufficient to convert leaves into flower organs. Nature 409: 525–529[CrossRef][Medline]

Huijser P, Klein J, Lonnig WE, Meijer H, Saedler H, Sommer H (1992) Bracteomania, an inflorescence anomaly, is caused by the loss of function of the MADS box gene squamosa in Antirrhinum majus. EMBO J 11: 1239–1249[Web of Science][Medline]

Immink RGH, Angenent GC (2002) Transcription factors do it together: the hows and whys of studying protein-protein interactions. Trends Plant Sci 7: 531–534[CrossRef][Web of Science][Medline]

Immink RGH, Ferrario S, Busscher-Lange J, Kooiker M, Busscher M, Angenent GC (2003) Analysis of the petunia MADS box transcription factor family. Mol Genet Genomics 268: 598–606[Web of Science][Medline]

Irish VF, Sussex IM (1990) Function of the apetala-1 gene during Arabidopsis floral development. Plant Cell 2: 741–753[Abstract/Free Full Text]

James P, Halladay J, Craig EA (1996) Genomic libraries and a host strain designed for highly efficient two-hybrid selection in yeast. Genetics 144: 1425–1436[Abstract]

Jang S, An K, Lee S, An G (2002) Characterization of tobacco MADS box genes involved in floral initiation. Plant Cell Physiol 43: 230–238[Abstract/Free Full Text]

Jeon JS, Jang S, Lee S, Nam J, Kim C, Lee SH, Chung YY, Kim SR, Lee YH, Cho YG, et al (2000a) leafy hull sterile1 is a homeotic mutation in a rice MADS box gene affecting rice flower development. Plant Cell 12: 871–884[Abstract/Free Full Text]

Jeon JS, Lee S, Jung KH, Yang WS, Yi GH, Oh BG, An G (2000b) Production of transgenic rice plants showing reduced heading date and plant height by ectopic expression of rice MADS box genes. Mol Breed 6: 581–592[CrossRef]

Kang HG, Jang S, Chung JE, Cho YG, An G (1997) Characterization of two rice MADS box genes that control flowering time. Mol Cells 7: 559–566[Web of Science][Medline]

Kang HG, Jong-Seong J, Lee S, An G (1998) Identification of class B and class C organ identity genes from rice plants. Plant Mol Biol 38: 1021–1029[CrossRef][Web of Science][Medline]

Kang HG, Noh YS, Chung YY, Costa MA, An K, An G (1995) Phenotypic alterations of petal and sepal by ectopic expression of a rice MADS box gene in tobacco. Plant Mol Biol 29: 1–10[CrossRef][Web of Science][Medline]

Kater MM, Colombo L, Franken J, Busscher M, Masiero S, van Lookeren Campagne MM, Angenent GC (1998) Multiple AGAMOUS homologs from cucumber and petunia differ in their ability to induce reproductive organ fate. Plant Cell 10: 171–182[Abstract/Free Full Text]

Kater MM, Franken J, Carney KJ, Colombo L, Angenent GC (2001) Sex determination in the monoecious species cucumber is confined to specific floral whorls. Plant Cell 13: 481–493[Abstract/Free Full Text]

Krizek BA, Meyerowitz EM (1996) Mapping the protein regions responsible for the functional specificities of the Arabidopsis MADS domain organ-identity proteins. Proc Natl Acad Sci USA 93: 4063–4070[Abstract/Free Full Text]

Kyozuka J, Kobayashi T, Morita M, Shimamoto K (2000) Spatially and temporally regulated expression of rice MADS box genes with similarity to Arabidopsis class A, B and C genes. Plant Cell Physiol 41: 710–718

Kyozuka J, Shimamoto K (2002) Ectopic expression of OsMADS3, a rice ortholog of AGAMOUS, caused a homeotic transformation of lodicules to stamens in transgenic rice plants. Plant Cell Physiol 43: 130–135[Abstract/Free Full Text]

Lee S, Kim J, Son JS, Nam J, Jeong DH, Lee K, Jang S, Yoo J, Lee J, Lee DY, et al (2003) Systematic reverse genetic screening of T-DNA tagged genes in rice for functional genomic analyses: MADS box genes as a test case. Plant Cell Physiol 44: 1403–1411[Abstract/Free Full Text]

Lim J, Moon YH, An G, Jang SK (2000) Two rice MADS domain proteins interact with OsMADS1. Plant Mol Biol 44: 513–527[CrossRef][Web of Science][Medline]

Litt A, Irish VF (2003) Duplication and diversification in the APETALA1/FRUITFULL floral homeotic gene lineage: implications for the evolution of floral development. Genetics 165: 821–833[Abstract/Free Full Text]

Lopez-Dee ZP, Wittich PE, Pé ME, Rigola D, del Buono I, Sari Gorla M, Kater MM, Colombo L (1999) OsMADS13, a novel rice MADS box gene expressed during ovule development. Dev Genet 25: 237–244[CrossRef][Web of Science][Medline]

Ma H, Yanofsky MF, Meyerowitz EM (1991) AGL1-AGL6, an Arabidopsis gene family with similarity to floral homeotic and transcription factor genes. Genes Dev 5: 484–495[Abstract/Free Full Text]

Mandel MA, Gustafson-Brown C, Savidge B, Yanofsky MF (1992) Molecular characterization of the Arabidopsis floral homeotic gene APETALA1. Nature 360: 273–277[CrossRef][Medline]

Mandel MA, Yanofsky MF (1995) A gene triggering flower formation in Arabidopsis. Nature 377: 522–524[CrossRef][Medline]

Masiero S, Imbriano C, Ravasio F, Favaro R, Pelucchi N, Sari Gorla M, Mantovani R, Colombo L, Kater MM (2002) Ternary complex formation between MADS box transcription factors and the histone fold protein NF-YB. J Biol Chem 277: 26429–26435[Abstract/Free Full Text]

Mena M, Mandel MA, Lerner DR, Yanofsky MF, Schmidt RJ (1995) A characterization of the MADS box gene family in maize. Plant J 8: 845–854[CrossRef][Web of Science][Medline]

Menzel G, Apel K, Melzer S (1996) Identification of two MADS box genes that are expressed in the apical meristems of the long-day plant Sinapsis alba in transition to flowering. Plant J 9: 399–408[CrossRef][Web of Science][Medline]

Michaels SD, Ditta G, Gustafson-Brown C, Pelaz S, Yanofsky M, Amasino RM (2003) AGL24 acts as a promoter of flowering in Arabidopsis and is positively regulated by vernalization. Plant J 33: 867–874[CrossRef][Web of Science][Medline]

Moon YH, Jung JH, Kang HG, An G (1999a) Identification of a rice APETALA3 homologue by yeast two-hybrid screening. Plant Mol Biol 40: 167–177[CrossRef][Web of Science][Medline]

Moon YH, Kang HG, Jung JY, Jeon JS, Sung SK, An G (1999b) Determination of the motif responsible for interaction between the rice APETALA1/AGAMOUS-LIKE9 family proteins using a yeast two-hybrid system. Plant Physiol 120: 1193–1203[Abstract/Free Full Text]

Pelaz S, Ditta GS, Baumann E, Wisman E, Yanofsky MF (2000) B and C floral organ identity functions require SEPALLATA MADS box genes. Nature 405: 200–203[CrossRef][Medline]

Pelaz S, Gustafson-Brown C, Kohalmi SE, Crosby WL, Yanofsky MF (2001) APETALA1 and SEPALLATA3 interact to promote flower development. Plant J 26: 385–394[CrossRef][Web of Science][Medline]

Pelucchi N, Fornara F, Favalli C, Masiero S, Lago C, Pè ME, Colombo L, Kater MM (2002) Comparative analysis of rice MADS box genes expressed during flower development. Sex Plant Reprod 15: 113–122[CrossRef]

Pinyopich A, Ditta GS, Savidge B, Liljegren SJ, Baumann E, Wisman E, Yanofsky MF (2003) Assessing the redundancy of MADS box genes during carpel and ovule development. Nature 424: 85–88[CrossRef][Medline]

Pnueli L, Hareven D, Broday L, Hurwitz C, Lifschitz E (1994) The TM5 MADS box gene mediates organ differentiation in the three inner whorls of tomato flowers. Plant Cell 6: 175–186[Abstract]

Purugganan MD, Rounsley SD, Schmidt RJ, Yanofsky MF (1995) Molecular evolution of flower development: diversification of the plant MADS box regulatory gene family. Genetics 140: 345–356[Abstract]

Schmidt RJ, Ambrose BA (1998) The blooming of grass flower development. Curr Opin Plant Biol 1: 60–67[CrossRef][Web of Science][Medline]

Schmitz J, Franzen R, Ngyuen TH, Garcia-Maroto F, Pozzi C, Salamini F, Rohde W (2000) Cloning, mapping and expression analysis of barley MADS box genes. Plant Mol Biol 42: 899–913[CrossRef][Web of Science][Medline]

Schultz EA, Haughn GN (1993) Genetic analysis of the floral initiation process (FLIP) in Arabidopsis. Development 119: 745–765[Abstract]

Schwarz-Sommer Z, Huijser P, Nacken W, Saedler H, Sommer H (1990) Genetic control of flower development by homeotic genes in Antirrhinum majus. Science 250: 931–936[Abstract/Free Full Text]

Studier FW, Rosenberg AH, Dunn JJ, Dubendorf JW (1990) Use of T7 DNA polymerase to direct expression of cloned genes. Methods Enzymol 185: 60–89[Medline]

Trevaskis B, Bagnall DJ, Ellis MH, Peacock WJ, Dennis ES (2003) MADS box genes control vernalization-induced flowering in cereals. Proc Natl Acad Sci USA 100: 13099–13104[Abstract/Free Full Text]

Vandenbussche M, Theissen G, Van de Peer Y, Gerats T (2003) Structural diversification and neo-functionalization during floral MADS box genes evolution by C-terminal frameshift mutations. Nucleic Acids Res 31: 4401–4409[Abstract/Free Full Text]

Verwoerd TC, Dekken BMM, Hoekema A (1989) A small scale procedure for the rapid isolation of plant RNAs. Nucleic Acids Res 17: 2362[Free Full Text]

Xiao H, Wang Y, Liu D, Wang W, Li X, Zhao X, Xu J, Zhai W, Zhu L (2003) Functional analysis of the rice AP3 homologue OsMADS16 by RNA interference. Plant Mol Biol 52: 957–966[CrossRef][Web of Science][Medline]

Yalovsky S, Rodriguez-Conception M, Bracha K, Toledo-Ortez G, Gruissem W (2000) Prenylation of the floral transcription factor APETALA1 modulates its function. Plant Cell 12: 1257–1266[Abstract/Free Full Text]

Yan L, Loukoianov A, Tranquilli G, Helguera M, Fahima T, Dubcovsky J (2003) Positional cloning of the wheat vernalization gene VRN1. Proc Natl Acad Sci USA 100: 6263–6268[Abstract/Free Full Text]

Yang Y, Fanning L, Jack T (2003) The K domain mediates heterodimerization of the Arabidopsis floral organ identity proteins, APETALA3 and PISTILLATA. Plant J 33: 47–59[CrossRef][Web of Science][Medline]

Yu H, Xu Y, Tan EL, Kumar PP (2002) AGAMOUS-LIKE 24, a dosage-dependent mediator of the flowering signals. Proc Natl Acad Sci USA 99: 16336–16341[Abstract/Free Full Text]




This article has been cited by other articles:


Home page
J Exp BotHome page
F. Fornara, V. Gregis, N. Pelucchi, L. Colombo, and M. Kater
The rice StMADS11-like genes OsMADS22 and OsMADS47 cause floral reversions in Arabidopsis without complementing the svp and agl24 mutants
J. Exp. Bot., May 2, 2008; (2008) ern083v1.
[Abstract] [Full Text] [PDF]


Home page
Plant Cell PhysiolHome page
M.-K. Chen, I-C. Lin, and C.-H. Yang
Functional Analysis of Three Lily (Lilium longiflorum) APETALA1-like MADS Box Genes in Regulating Floral Transition and Formation
Plant Cell Physiol., May 1, 2008; 49(5): 704 - 717.
[Abstract] [Full Text] [PDF]


Home page
Plant Cell PhysiolHome page
H. Adam, F. Ouellet, N. A. Kane, Z. Agharbaoui, G. Major, Y. Tominaga, and F. Sarhan
Overexpression of TaVRN1 in Arabidopsis Promotes Early Flowering and Alters Development
Plant Cell Physiol., August 1, 2007; 48(8): 1192 - 1206.
[Abstract] [Full Text] [PDF]


Home page
Plant CellHome page
N. Shitsukawa, C. Tahira, K.-i. Kassai, C. Hirabayashi, T. Shimizu, S. Takumi, K. Mochida, K. Kawaura, Y. Ogihara, and K. Murai
Genetic and Epigenetic Alteration among Three Homoeologous Genes of a Class E MADS Box Gene in Hexaploid Wheat
PLANT CELL, June 1, 2007; 19(6): 1723 - 1737.
[Abstract] [Full Text] [PDF]


Home page
J Exp BotHome page
H. Adam, S. Jouannic, Y. Orieux, F. Morcillo, F. Richaud, Y. Duval, and J. W. Tregear
Functional characterization of MADS box genes involved in the determination of oil palm flower structure
J. Exp. Bot., April 1, 2007; 58(6): 1245 - 1259.
[Abstract] [Full Text] [PDF]


Home page
Plant Cell PhysiolHome page
N. Hirose, N. Makita, M. Kojima, T. Kamada-Nobusada, and H. Sakakibara
Overexpression of a Type-A Response Regulator Alters Rice Morphology and Cytokinin Metabolism
Plant Cell Physiol., March 1, 2007; 48(3): 523 - 539.
[Abstract] [Full Text] [PDF]


Home page
J Exp BotHome page
M. M. Kater, L. Dreni, and L. Colombo
Functional conservation of MADS-box factors controlling floral organ identity in rice and Arabidopsis
J. Exp. Bot., October 1, 2006; 57(13): 3433 - 3444.
[Abstract] [Full Text] [PDF]


Home page
J Exp BotHome page
S. Ciannamea, K. Kaufmann, M. Frau, I. A. N. Tonaco, K. Petersen, K. K. Nielsen, G. C. Angenent, and R. G. H. Immink
Protein interactions of MADS box transcription factors involved in flowering in Lolium perenne
J. Exp. Bot., October 1, 2006; 57(13): 3419 - 3431.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
N. A. Kane, J. Danyluk, G. Tardif, F. Ouellet, J.-F. Laliberte, A. E. Limin, D. B. Fowler, and F. Sarhan
TaVRT-2, a Member of the StMADS-11 Clade of Flowering Repressors, Is Regulated by Vernalization and Photoperiod in Wheat
Plant Physiology, August 1, 2005; 138(4): 2354 - 2363.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow All Versions of this Article:
135/4/2207    most recent
pp.104.045039v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via ISI Web of Science (26)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fornara, F.
Right arrow Articles by Kater, M. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fornara, F.
Right arrow Articles by Kater, M. M.
Agricola
Right arrow Articles by Fornara, F.
Right arrow Articles by Kater, M. M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
ASPB Publications PLANT PHYSIOLOGY® THE PLANT CELL
Copyright © 2004 by the American Society of Plant Biologists