|
|
||||||||
|
First published online August 6, 2004; 10.1104/pp.104.044859 Plant Physiology 135:2392-2397 (2004) © 2004 American Society of Plant Biologists Tobacco Mosaic Virus Regulates the Expression of Its Own Resistance Gene N1The Hebrew University of Jerusalem, Faculty of Agricultural, Food and Environmental Quality Sciences, Robert H. Smith Institute for Plant Science and Genetics, Virus Laboratory, Rehovot 76100, Israel
The N gene of tobacco (Nicotiana tabacum) is a typical resistance (R) gene engendering localization of tobacco mosaic virus (TMV) infection and the elicitation of a hypersensitive necrotic response. The consensus model for R gene-derived resistance is at the level of protein:protein interactions, in which proteins of the pathogen interact with already present receptor-like proteins produced by the plant's R genes. This article demonstrates, by quantitative real-time reverse transcription-PCR analysis, that in tobacco carrying the dominant allele N, a basal level of transcription indeed occurs in noninfected plants. However, accumulation of N-mRNA in infected plants indicates that transcription is stimulated by TMV infection (up to 38-fold in locally infected leaves and up to 165-fold in upper, noninoculated leaves). Potato virus Y infection did not result in accumulation of N-mRNA, indicating a specific TMV-related phenomenon. The possible uncoupling of viral restriction from necrosis is discussed.
Plants carry resistance (R) genes that often engender resistance to specific pathogens. The current consensus model is based on Flor's (1942
The tobacco (Nicotiana tabacum) resistance gene N is a typical R gene, introduced into tobacco from Nicotiana glutinosa (Holmes, 1938
Alternative splicing of the N gene's primary transcript is stimulated by TMV infection, and the two resultant proteins are required for full resistance (Dinesh-Kumar and Baker, 2000 This article indicates that N-gene transcription is also up-regulated by TMV infection.
Expression of the N Gene and Its Homologs in Tobacco Leaves
Tobacco carries a multitude of N-related gene sequences, which are probably clustered together (Whitham et al., 1994 We amplified, by RT-PCR, a 140-bp segment of the variable region from a total RNA preparation extracted from noninfected and TMV-infected leaves of tobaccoNN and obtained a single, homogenous band. No such band was observed by similarly amplifying RNA extracted from TMV-infected tobacconn (Fig. 1, top, lane 1). To determine that no other sequence of similar size was amplified along with the N-specific band, we performed a temperature-dissociation analysis (Fig. 1, bottom), which indicated that the amplified product was indeed a single band. Figure 2 shows that the sequence of the amplified product was identical to the published one (GenBank accession no. U15605), indicating N-gene specificity. Furthermore, as described below, the amplified PCR product, serving as a probe in northern analyses, hybridized to N-derived RNA. Hybridization to n-derived RNA was negligible, if at all (Fig. 3). We thus concluded that the aforementioned PCR product is N specific and that this sequence is not expressed by any other N-related gene. This amplicon was therefore selected for the quantitative analyses of N mRNA.
Expression of the N Gene in TobaccoNN and Tobacconn Northern-blot analyses were carried out with total RNA extracts from noninfected and TMV-infected tobaccoNN and tobacconn. The aforedescribed N-specific PCR product of the 3' variable region of N served as a probe. Figure 3 indicates that tobacconn hardly transcribe any detectable N sequence, while tobaccoNN did transcribe N mRNA. The northern analysis also indicated a basal level of N expression in noninoculated leaves, which was stimulated in locally infected leaves as well as in upper, noninfected ones.
The primary transcripts of N are alternatively spliced, resulting in two types of mRNAs, both playing a role in N functions. However, the two transcripts differ in size by only 70 bases (Dinesh-Kumar and Baker, 2000
Real-time RT-PCR was employed to corroborate the results of the northern analysis indicating TMV-directed stimulation of N expression and to quantify the extent of that stimulation. The level of N transcripts was determined at various times following inoculation (20, 30, and 40 h in inoculated leaves and 24, 42, and 72 h and 10 d in upper leaves). One leaf of each tobaccoNN plant was inoculated with 100 µg/mL purified TMV. Real-time PCR analysis was performed with RNA extracted from inoculated leaves (localizing TMV infection) and noninoculated upper leaves of infected plants (the third leaf above the inoculated one which remained TMV-free). In inoculated leaves, N-mRNA accumulation was determined at times prior to the onset of necrosis. Necrosis did not develop in upper leaves, and samples from those leaves were collected up to 10 d postinoculation. A basal level of constitutive N-gene expression was noted in noninfected tobaccoNN (Fig. 3; Tables I and II). The level of mRNA in both locally infected and upper leaves increased with time of infection (Tables I and II). RT-PCR analysis did not result in any N-specific band when RNA from tobacconn (noninfected as well as 10 d after TMV inoculation) served as a template.
The real-time PCR results confirmed the northern analysis indications. A basal level of N expression occurs in tobaccoNN but not in tobacconn. In tobaccoNN, N-mRNA is accumulated approximately 30-fold in infected leaves and up to approximately 165-fold in upper leaves (Tables I and II), indicating stimulation of expression. In order to further ascertain that RT-PCR was carried out with the same quantity of template RNA in all samples, we checked the levels of another housekeeping gene (actin) in the same RNA samples used for the real-time PCR assays. RT-PCR was performed to only 22 cycles, so that it would not reach saturated levels for ethidium bromide detection. Figure 4 demonstrates that expression of actin was at about the same level in all samples.
The stimulation of N expression could be attributed to a TMV-specific response or to a nonspecific disease (or stress) response. In addressing this problem, similar experiments were carried out with Potato virus Y (PVY)-infected tobaccoNN. RNA extracts from 72-h PVY-infected tobaccoNN leaves were subjected to quantitative RT-PCR assays (Fig. 5). N-mRNA bands in both noninfected and PVY-infected assays became noticeable at the same cycle, indicating similar levels of N-mRNA accumulation. Consequently, it seems that the increase in N-mRNA accumulation is specific to TMV infection and is not a general response to stress or infection.
Since Nicotiana spp. carry sequences homologous to that of the tobaccoNN N gene, it was necessary to establish that we were specifically detecting only N expression. To that end, we compared tobacconn, which does not carry the N gene, to its isoline (tobaccoNN) harboring that gene. Northern-blot analysis indicated that tobacconn does not express N-derived mRNA, therefore interference from other N-related genes was not likely to occur when studying N expression. However, being such a crucial point, we corroborated this by RT-PCR as well. We chose the 3' variable region of N for amplification because it is present in both types of the alternatively spliced N-mRNA, and it is not part of any of the common R-gene domains, making interference from other R genes unlikely as well. The resultant RT-PCR product was shown to be homogenous (and by temperature-dissociation analysis also unique). The sequence of the RT-PCR product was identical to that segment of the N gene (Fig. 2).
The current consensus for R-gene activity is based on interactions between proteins. The product of the R gene is constitutively expressed, and following activation of the R protein by a product of the pathogen's avr gene, a pathway leading to resistance begins (Flor, 1942 The N gene is a representative of R genes that encode putative receptors. The results indicate constitutive expression of the N gene, as N-mRNA was detected in noninoculated tobaccoNN leaves. Therefore, possible interaction between a pre-existing N protein and an incoming viral-directed protein activator cannot be ruled out. Upon infection, however, the rate of N-mRNA accumulation increased considerably. In leaves that were actually inoculated with TMV, maximum N-mRNA accumulation (at 30 h after inoculation) was about 38-fold that of noninoculated leaves and leveled off at 40 h. At this point, the leaves started to show necrosis, and the cessation of mRNA stimulation may be attributed to the beginning of apoptosis. The lack of N-mRNA stimulation in PVY-infected tobaccoNN indicated that accumulation of N-mRNA is probably specific to TMV infection and not a general stimulation caused by other infections or stress.
It is particularly interesting to note the accumulation of N mRNA to higher levels in upper, noninoculated leaves. N-mRNA accumulation in upper leaves of TMV-infected plants was 165-fold higher than that in noninfected plants. Accumulation increased for 72 h and remained at an elevated level for at least 10 d. These leaves were TMV-free and did not develop necrosis. Moreover, they have been shown to develop resistance toward several viruses (Ross, 1961
Upon request, all novel materials described in this publication will be made available in a timely manner for noncommercial research purposes, subject to the requisite permission from any third-party owners of all or parts of material. Obtaining any permission will be the responsibility of the requestor.
The following plants were used throughout the project: Nicotiana tabacum var. Samsun (referred to as tobacconn), developing systemic mosaic symptoms but not necrosis upon TMV infection, and N. tabacum var. Samsun NN (referred to as tobaccoNN), into which the N gene of Nicotiana glutinosa has been introgressed and which reacts locally upon TMV infection, restricting viral spread and causing local necrotic lesions. Tobacconn and tobaccoNN are, in fact, isolines of the tobacco var. Samsun. Information about the genetic makeup of these two tobacco variants is summarized in Sela (1981)
For RNA extraction, tissue samples were collected, immediately frozen in liquid nitrogen, and then kept at 80°C. Total RNA was extracted from these tissues using the RNeasy plant minikit (Qiagen, Valencia, CA), including the QIAshredder spin columns. RNase-free DNase was then added to the column, and after 40-min incubation with the DNase, the RNA was eluted with RNase-free water. About 3 µg of RNA was obtained from 100 mg of leaf tissue.
Measured amounts of RNA (100 ng for N-gene expression analyses and 100 pg for 18S rRNA internal controls) were subjected to one-step RT-PCR using the SYBR Green PCR master mix with Taqman reverse transcriptase (Applied Biosystems, Foster City, CA). Real-time RT-PCR was conducted in GeneAmp PCR System 5700 (Applied Biosystems). Precautions were taken to ascertain reliable quantitative results: Log-linear dilution curves were performed with primers for the N gene as well as with primers for the 18S rRNA. The selected amplicon was small (140 bp). The correlation value of the N-gene curve was 0.997221 and that of the 18S rRNA curve was 0.983780; both values and the difference between them were well within the allowable parameters. Reactions performed without reverse transcriptase or without template did not result in any product. PCR cycles were as follows: 1 cycle of 30 min at 48°C and 10 min at 95°C, followed by 40 cycles each of 15 s at 95°C, 30 s at 60°C, and 45 s at 72°C.
Each N-gene peak was given an arbitrary quantitative value correlated to the 18S rRNA peak, according to the formula
The following are the primers for all N-related RT-PCR assays, including real-time RT-PCR. Forward primer (bases 6,1196,144 of the N gene; GenBank accession no. U15605): 5'TTCTTTGTACCTTTTGCTGGCTTAT3'. Reverse primer (bases 6,2596,232 of the above): 5'CTCTGGTCCTTCTTTATACAACAAAC3'. Temperature-dissociation analysis (displayed by the GeneAmp 5700 system) confirmed the homogeneity of the PCR product (Fig. 1). The amplified region was from exon 4, which is not spliced out upon alternative splicing (Dinesh-Kumar and Baker, 2000
RT-PCR for the expression of actin was performed on 100 ng of RNA with the following primers. The forward primer was 5'GTCTGGTGATGGTGTTAGC3' (bases 4,2824,301 of accession no. X63603) and the reverse primer was 5'CCTATCAGCAATTCCAGGAAAC3' (bases 4,7564,735 of the above). For quantitative PCR, measured amounts (25 ng for N-gene expression analysis and 50 pg for 18S rRNA) of total RNA extracts of noninfected and PVY-infected tobaccoNN (72 h post inoculation) were subjected to RT-PCR with the same aforementioned primers used for real-time PCR. Samples were drawn at three-cycle intervals and analyzed by gel electrophoresis. The system was calibrated so that the appearance of the 18-rRNA-specific band in noninoculated and PVY-inoculated RNA extracts will not differ by more than a single cycle, ascertaining that similar levels of RNA were used as template in reactions from noninfected and PVY-infected leaves. The first cycle showing a visible band was indicative on the relative amount of RNA.
Total RNA was extracted from noninoculated and TMV-inoculated tobacconn leaves and from noninoculated and TMV-inoculated tobaccoNN leaves, as well as from upper, noninoculated leaves of locally infected tobaccoNN. Formaldehyde was added to the RNA to 1.8% and warmed to 65°C. The RNA, 15 µg per lane (in light of the real-time PCR results, only 1.5 µg of RNA was loaded in the case of upper leaves of inoculated plants), was electrophoresed on a 1.2% agarose gel at 70 V, 4°C with stirring. The previously described amplified N-RNA product was digoxigenin labeled and served as a probe for hybridization. Detection was performed with the DIG luminescent detection kit (Roche Diagnostics GmbH, Mannheim, Germany). RNA sizes were estimated by comparison to electrophoresed RNA Molecular Weight Markers I (Roche). Hybridization was carried out at high stringency (0.1x SSC; 65°C).
We thank the Wolfson Foundation for the use of facilities contributed to the Plant Science Institute. Received April 28, 2004; returned for revision May 10, 2004; accepted May 10, 2004.
1 This work was supported by the TEVEL consortium and by the Minerva Otto Warburg Center for Agricultural Biotechnology. Article, publication date, and citation information can be found at www.plantphysiol.org/cgi/doi/10.1104/pp.104.044859. * Corresponding author; e-mail sela{at}agri.huji.ac.il; fax 97289473402.
Abbink TEM, Tjernberg PA, Bol JF, Linthorst HJM (1998) Tobacco mosaic virus helicase domain induces necrosis in N gene-carrying tobacco in the absence of virus replication. Mol Plant Microbe Interact 11: 12421246 Antignus Y, Sela I, Harpaz I (1975) A phosphorus-containing fraction associated with antiviral activity in Nicotiana spp. carrying the gene for localization of infection. Physiol Plant Pathol 6: 159168
Antignus Y, Sela I, Harpaz Y (1977) Further studies on the biology of an antiviral factor (AVF) from virus-infected plants and its association with the N-gene of Nicotiana species. J Gen Virol 35: 107116 Bent AF (1996) Plant disease resistance genes: function meets structure. Plant Cell 8: 17571771[CrossRef][Web of Science][Medline] Bozarth RF, Ross AF (1964) Systemic resistance induced by localized virus infection: extent of change in uninfected plant parts. Virology 24: 446455[CrossRef][Web of Science][Medline] De Wit PJGM (1997) Pathogen avirulence and plant resistance: a key role for recognition. Trends Plant Sci 2: 452458[CrossRef]
Dinesh-Kumar SP, Baker B (2000) Alternatively spliced N resistance gene transcripts: their possible role in tobacco mosaic virus resistance. Proc Natl Acad Sci USA 97: 19081913
Dinesh-Kumar SP, Wai-Hong T, Baker BJ (2000) Structure-function analysis of tobacco mosaic virus resistance gene N. Proc Natl Acad Sci USA 97: 1478914794
Edelbaum E, Ilan N, Grafi G, Sher N, Stram Y, Novick D, Tal N, Sela I, Rubinstein M (1990) Purification and characterization of two antivirally active proteins from tobacco by monoclonal antibodies to human
Ellis JG, Lawerence GJ, Luck JE, Dodds PN (1999) Identification of regions in alleles of the flax rust resistance gene L that determines difference in gene-for-gene specificity. Plant Cell 11: 495506 Erickson FL, Holzberg S, Calderon-Urrea A, Handly V, Axtell M, Corr C, Baker B (1999) The helicase domain of the TMV replicase proteins induces the N-mediated defense response in tobacco. Plant J 18: 6775[CrossRef][Web of Science][Medline] Flor HH (1942) Inheritance of pathogenicity in a cross between physiological races 22 and 24 of Melampsora lini. Phytopathology 32: 5 Flor HH (1956) The complementary genic systems in flax and flax rust. Adv Genet 8: 2954[Web of Science] Gera A, Loebenstein G, Salomon R, Franck A (1990) Inhibitor of virus replication from protoplasts of a hypersensitive tobacco cultivar infected with tobacco mosaic virus is associated with a 23-K protein species. Phytopathology 80: 7881 Greenberg JT, Guo A, Klessig DF, Ausubel FM (1994) Programmed cell death in plants: a pathogen-triggered response activated coordinately with multiple defense functions. Cell 77: 551563[CrossRef][Web of Science][Medline] Holmes FO (1938) Inheritance of resistance to tobacco mosaic disease in tobacco. Phytopathology 28: 553561[Web of Science] Jin HL, Liu YD, Yang KY, Kim CY, Baker B, Zhang SQ (2003) Function of a mitogen-activated protein kinase pathway in N gene-mediated resistance in tobacco. Plant J 33: 719731[CrossRef][Web of Science][Medline] Keen NT (1992) The molecular biology of disease resistance. Plant Mol Biol 19: 109122[CrossRef][Medline] Lamb CJ (1994) Plant disease resistance genes in signal perception and transduction. Cell 76: 419422[CrossRef][Web of Science][Medline]
Lee FS, Vallee BL (1990) Modular mutagenesis of human placental ribonuclease inhibitor, a protein with leucine-rich repeats. Proc Natl Acad Sci USA 87: 18791883 Loebenstein G (1963) Further evidence on systemic resistance induced by localized necrotic virus infections in plants. Phytopathology 53: 306308[Web of Science] Loebenstein G, Ross FA (1963) An extractable agent, induced in uninfected tissues by localized virus infections, that interferes with infection by tobacco mosaic virus. Virology 20: 507517[Medline] Matthieu HAJJ, Cozijnsen TJ, De Wit PJGM (1994) Host resistance to fungal tomato pathogen lost by a single base-pair change in an avirulence gene. Nature 367: 384386[CrossRef][Medline] Padgett HS, Beachy RN (1993) Analysis of tobacco mosaic virus strain capable of overcoming N-gene-mediated resistance. Plant Cell 5: 577586[Abstract] Richter TE, Ronald PC (2000) The evolution of disease resistance. Plant Mol Biol 42: 195204[CrossRef][Web of Science][Medline] Ross AF (1961) Systemic acquired resistance induced by localized virus infection in plants. Virology 14: 340358[CrossRef][Web of Science][Medline] Sela I (1981) Plant-virus interactions related to resistance and localization of viral infections. Adv Virus Res 26: 201237[Medline] Sela I (1986) Preparation and measurement of an antiviral protein found in tobacco cells after infection with tobacco mosaic virus. Methods Enzymol 11: 734744 Sela I, Appelbaum SW (1962) Occurrence of an antiviral factor in virus-infected plants. Virology 17: 543548[Medline] Sela I, Harpaz I, Birk Y (1964) Separation of a highly active antiviral factor from virus-infected plants. Virology 22: 446451[Medline] Sela I, Hauschner A, Mozes R (1978) The mechanism of stimulation of the antiviral factor (AVF) in Nicotiana leaves. Virology 89: 16[Medline]
Suzuki N, Choe HR, Nishida Y, Yamawakikataoka Y, Ohnishi S, Tamaoki T, Kataoka T (1990) Leucine-rich repeats and carboxyl terminus are required for interaction of yeast adenylate cyclase with RAS proteins. Proc Natl Acad Sci USA 87: 87118715 van der Ackerveken GFJM, Vossen P, De Wit PJGM (1993) The avr9 gene race-specific elicitor of Cladosporium fulvum is processed by endogenous and plant proteases. Plant Physiol 103: 9196[Abstract] van der Biezen EA, Freddie CT, Kahn K, Parker JE, Jones JDG (2002) Arabidopsis RPP4 is a member of the RPP5 multigene family of TIR-NB-LRR genes and confers downy mildew resistance through multiple signaling components. Plant J 29: 439451[CrossRef][Web of Science][Medline]
Warren RF, Henk A, Mowery P, Holub E, Innes RW (1998) A mutation within the leucine-rich repeat domain of the Arabidopsis disease resistance gene RPS5 partially suppresses multiple bacterial and downy mildew resistance genes. Plant Cell 10: 14391452 Whitham S, Dinesh-Kumar SP, Choi D, Hehl R, Corr C, Baker B (1994) The product of the tobacco mosaic virus resistance gene N: similarity to Toll and the Interleukin-2 receptor. Cell 78: 11011115[CrossRef][Web of Science][Medline] This article has been cited by other articles:
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ASPB Publications | PLANT PHYSIOLOGY® | THE PLANT CELL | |
|---|---|---|---|