| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
|
First published online August 6, 2004; 10.1104/pp.104.046086 Plant Physiology 135:2411-2423 (2004) © 2004 American Society of Plant Biologists Relocalization of Nuclear ALY Proteins to the Cytoplasm by the Tomato Bushy Stunt Virus P19 Pathogenicity Protein1,[w]Max-Planck-Institut für Züchtungsforschung, 50829 Cologne, Germany (J.F.U.); and Scottish Crop Research Institute, Invergowrie, Dundee DD2 5DA, United Kingdom (T.C., D.M., S.A.M.)
The P19 protein of tomato bushy stunt virus (TBSV) is a multifunctional pathogenicity determinant involved in suppression of posttranscriptional gene silencing, virus movement, and symptom induction. Here, we report that P19 interacts with the conserved RNA-binding domain of an as yet uncharacterized family of plant ALY proteins that, in animals, are involved in export of RNAs from the nucleus and transcriptional coactivation. We show that the four ALY proteins encoded by the Arabidopsis genome and two ALY proteins from Nicotiana benthamiana are localized to the nucleus. Moreover, and in contrast to animal ALY, all but one of the proteins are also in the nucleolus, with distinct subnuclear localizations. Infection of plants by TBSV or expression of P19 from Agrobacterium results in relocation of three of the six ALY proteins from the nucleus to the cytoplasm demonstrating specific targeting of the ALY proteins by P19. The differential effects on subcellular localization indicate that, in plants, the various ALY proteins may have different functions. Interaction with and relocalization of ALY is prevented by mutation of P19 at residues previously shown to be important for P19 function in plants. Down-regulation of expression of two N. benthamiana ALY genes by virus-induced gene silencing did not interfere with posttranscriptional gene silencing. Targeting of ALY proteins during TBSV infection may therefore be related to functions of P19 in addition to its silencing suppression activity.
The majority of plant viruses have a very small genome size (12 kb or less) and encode very few (less than 10) viral proteins. To be successful, virus infection relies on the interaction with and subversion of normal host cellular processes by specific viral proteins, many of which, it is now becoming clear, are multifunctional and target more than one host pathway. A good example is provided by the potyvirus HC-Pro protein, which was identified initially as an insect transmission factor (Govier and Kassanis, 1974  ). HC-Pro also functions as a protease involved in processing of the viral polyprotein in genome amplification in single cells, in systemic movement of the virus in plants, and as the determinant of synergism, in which mixed infections of a potyvirus together with a second, different virus result in symptoms that are much more severe than those produced by either virus alone (Carrington et al., 1989; Kasschau et al., 1997; Shi et al., 1997).
Recent studies have shown that the synergistic and movement functions of HC-Pro result from the interaction of this protein with a host defensive system, referred to as posttranscriptional gene silencing (PTGS), that is deployed by the plant in response to challenge by viruses (Anandalakshmi et al., 2000
Many plant viruses have been shown to encode proteins, such as potyvirus HC-Pro, that target the silencing process, weakening the host defense and enhancing virus infection. There is no amino acid sequence homology apparent between the 10 or more of these so-called silencing suppressor proteins that have been identified so far from different viruses, and it is possible that each targets a different part of the PTGS machinery (Moissiard and Voinnet, 2004
A well-studied silencing suppressor protein is the P19 protein encoded by Tomato bushy stunt virus (TBSV). In an infiltration assay, P19 was found to be one of the most effective suppressors of silencing and completely prevented the production/accumulation in plants of both short and long forms of siRNA (Hamilton et al., 2002
In addition, P19 is also known to be involved in several other aspects of viral infection. TBSV that does not express P19 is unable to move systemically in spinach, does move systemically in Nicotiana benthamiana but no longer induces systemic necrosis, does not induce local necrosis in Nicotiana tabacum, and has impaired local, cell-to-cell movement in pepper (Scholthof et al., 1995a To further understand how TBSV influences the host plant, we carried out a yeast two-hybrid analysis to identify plant proteins that interact with P19. From these studies, we have identified a family of plant ALY proteins that are targeted by the P19 silencing suppressor protein of TBSV in vivo. In plants, infection by TBSV or expression of the P19 protein alone causes intracellular redistribution of a subset of the ALY proteins from the nucleus to the cytoplasm, suggesting that P19 may affect aspects of RNA export from the nucleus. In addition, experiments were carried out to examine whether the P19-ALY interaction affects RNA silencing in the plant.
TBSV P19 Interacts with ALY RNA Export Factors in Yeast Two-Hybrid Screens
The TBSV P19 protein has been reported to suppress RNA silencing in Arabidopsis (Voinnet et al., 2003 Using information from the Arabidopsis genome sequencing project to design gene-specific 5' and 3' PCR primers, the complete coding region of each of the four Arabidopsis genes was amplified and cloned.
Because Arabidopsis is not a susceptible host of TBSV, we proceeded to isolate ALY genes from N. benthamiana, a highly susceptible host for TBSV and many other viruses. Although no full-length sequences of ALY from Nicotiana species were identified by database searches, it was possible to assemble full-length sequences using tomato and potato expressed sequence tag (EST) sequences and design primers for amplification of N. benthamiana ALY genes. Two full-length cDNAs (NbAly615 and NbAly617) were amplified and cloned from N. benthamiana. There is variation in ALY gene number in animals with a single gene in humans, and two genes in mouse and Drosophila. By contrast, Arabidopsis contains four ALY genes, and from our analyses there are at least three clear ALY homologs in Solanaceous species and four or more ALY homologs in many monocots (Supplemental Fig. 1, available at www.plantphysiol.org). These findings indicate that there has been an expansion of the ALY gene family in plants, which may have provided the opportunity for diversification of expression patterns, location, and function. Phylogenetic analysis of the four Arabidopsis (At)ALY proteins revealed an overall sequence identity of 53% between AtALY1 and AtALY2 and 71% between AtALY3 and AtALY4 (Fig. 1). However, AtALY1 and AtALY2 have only between 35% to 37% sequence identity with AtALY3 and AtALY4. NbALY617 and NbALY615 most closely resembled AtALY1 and AtALY2 (60% and 57%, and 52% and 60% sequence identity, respectively). Nevertheless, it was not possible, using amino acid sequence alignment, to identify NbALY615 or NbALY617 as specific orthologs of any of the individual Arabidopsis ALY proteins.
Interaction with TBSV P19 Involves the RRM Domain of ALY
Using the yeast two-hybrid system, the interaction between TBSV P19 and each of the six proteins encoded by the full-length Arabidopsis and N. benthamiana ALY genes was reconfirmed, both when the bait protein was P19 and the prey protein was ALY, and in the reverse arrangement. In addition, P19 was also shown to interact in this system with ALY(REF) proteins from Drosophila and humans (Fig. 2A). Using the endogenous MEL1 gene as a second reporter, relative interaction strength was measured by a semiquantitative
ALY proteins are 30-kD proteins that have a highly conserved domain structure. This consists of short N-terminal and C-terminal motifs flanking two variable regions containing varying numbers of Arg-Gly-Gly (RGG) repeats embedded in nonconserved amino acid sequence. The central domain of the protein contains an RNA-binding domain (also referred to as an RNA-recognition motif [RRM]) that contains two more highly conserved subdomains, RNP1 and RNP2. The 41 clones of AtALY2 isolated from the library screen carried N-terminal deletions of different sizes. The most extensive deletion, which still could interact with P19, extended for 68 amino acids, and lacked the entire N-terminal conserved domain and two-thirds of the N-terminal variable domain. To further investigate which regions of ALY are responsible for the interaction with TBSV P19, a number of deletion mutants of the AtALY2 protein were constructed and tested in the yeast two-hybrid assay. These mutants lacked the C-terminal variable domain (mutant RS  ), the central RRM domain (mutant HS), both the central and C-terminal domains (mutant RH), or carried the RRM domain alone. In these tests, mutants HS and RH were unable to interact with the TBSV P19, but mutant RS and the RRM domain-only construct were able to interact with P19 (Fig. 3). These results demonstrate that P19 interacts with the central RRM domain of AtALY2, which is the most highly conserved region of the ALY proteins.
In Vitro Binding of the Arabidopsis ALY2 Protein to TBSV P19
The interaction between AtALY and TBSV P19 was also demonstrated using a gel overlay (far western) assay. We were unable efficiently to express full-length glutathione S-transferase (GST)-tagged ALY2, thus GST-tagged ALY2 RS
Different Subcellular Localization of ALY Proteins
ALY in other higher eukaryotes is known to localize to the nucleus. In a previous study, AtALY3 (DIP1) and AtALY4 (DIP2) were isolated in a yeast two-hybrid screen as interacting with the DNA-binding domain of poly(ADP-ribose) polymerase, and were also shown to be nuclear proteins (Storozhenko et al., 2001 Unexpectedly, and in contrast to the situation in animals, five of the six ALY proteins labeled the nucleolus in addition to the nucleoplasm (Fig. 5, A–G). Careful comparison of the localization pattern of the four different Arabidopsis ALY proteins revealed distinct differences in labeling. ALY2 labeled the nucleoplasm strongly with bright foci embedded in a speckled network but showed very little or no labeling of the nucleolus (Fig. 5B). ALY1, ALY3, and ALY4 labeled the nucleolus strongly (Fig. 5, A, D, and E). The nucleoplasm of ALY1 contained a small number of intensely staining bodies, whereas ALY4 exhibited less intense speckling. Nucleoplasmic labeling with ALY3 was less intense than with the other ALY proteins but consistently labeled a peripheral region of the nucleolus. Differences were also observed in the intranuclear labeling patterns of the two N. benthamiana ALY proteins (Fig. 5, F and G), although each was present in the nucleolus.
The GFP fusion of AtALY2 HS , lacking the central RRM domain necessary for interaction with TBSV P19 in yeast, was also localized to the nucleus rather than the nucleolus; however, the protein accumulated in large, irregular clumps inside the nucleus rather than being distributed throughout the nucleoplasm (Fig. 5C). The specific nuclear and nucleolar localizations of the ALY-GFP fusions were maintained regardless of which expression system was used (data not shown) and have also been demonstrated following expression in Arabidopsis cell cultures (J. Brown and P. Shaw, personal communication). The TBSV P19 was also expressed as a GFP fusion either using TRV or Agrobacterium (Fig. 5H). This protein had the same localization pattern as free GFP (data not shown) and was distributed throughout the cell.
In initial experiments, to corroborate that the interaction between ALY and P19 is biologically significant in plants, N. benthamiana plants were inoculated with TBSV, and systemically infected leaves were further infiltrated with Agrobacterium expressing AtALY2-GFP, which is the ALY protein that was isolated most frequently in the yeast two-hybrid screen. After 3 d, the infiltrated leaves were examined by confocal fluorescence microscopy. In these plants, some areas of epidermal cells contained the AtALY2-GFP protein that was restricted to nuclei. However, frequently, these areas of cells were flanked by other patches of epidermal cells in which the AtALY2-GFP protein was mostly absent from nuclei and was localized to the cytoplasm (Fig. 5, K [field view], I [close up]). In control experiments, the GFP fusion of the AtALY2 HS Furthermore, we used Agrobacterium to express the TBSV P19 protein and AtALY2-GFP protein together in N. benthamiana leaves by infiltration of mixed bacterial cultures. In this experiment also, AtALY2-GFP was relocalized from the nucleus to the cytoplasm (data not shown), demonstrating that the TBSV P19 protein is able to relocalize AtALY2-GFP in the absence of any other viral proteins. To examine whether virus infection in general, or infection specifically with TBSV was responsible for relocalization of ALY-GFP, the AtALY2-GFP protein was expressed from Agrobacterium in plants that were infected with a different virus, potato virus Y. In these plants, AtALY2-GFP remained in the nucleus, showing that redistribution of ALY is a specific effect of TBSV infection. Similarly, expression of the potato virus Y HC-Pro and cucumber mosaic virus 2b silencing suppressor proteins using Agrobacterium did not cause relocalization of AtALY2-GFP out of the nucleus (data not shown), showing that relocalization of ALY is not a general phenomenon related to interaction with silencing suppressor proteins and is specific to TBSV P19.
To examine whether the P19-ALY interaction caused relocalization of all of the ALY proteins, each of the five other cloned ALY proteins was fused to GFP and expressed with TBSV P19 in plants by agroinfiltration. Only two of the Arabidopsis ALY proteins (AtALY2-GFP and AtALY4-GFP) and one of the N. benthamiana ALY proteins (NbALY617-GFP) were relocalized by P19 from the nucleus into the cytoplasm by P19 (Fig. 5, I, K, and M; AtALY4-GFP data not shown). By contrast, AtALY1-GFP, AtALY3-GFP, and NbALY615-GFP were not detectably relocated into the cytoplasm by P19. Thus, in planta TBSV P19 targets only a subset of the ALY proteins for relocalization.
Previous analyzes of P19 showed that mutation of particular residues differentially affects P19 function in systemic infection, symptom production, and silencing suppression (Chu et al., 2000 The earlier experiments showed that wild-type P19 interacted strongly in yeast with one of the ALY proteins from N. benthamiana (NbALY617) and relocalized NbALY617-GFP from the nucleus (Fig. 5M). However, when we expressed the P19 mutant R72G in plants from Agrobacterium, we did not observe relocalization of NbALY617-GFP from the nucleus (Fig. 5N). Moreover, in the yeast two-hybrid system, P19 R72G showed a drastically weakened interaction with NbALY617 (Fig. 2B). Likewise, P19 R85G did not relocalize NbALY617-GFP in planta (Fig. 5O) and showed reduced interaction strength with NbALY617 in yeast. To rule out potential instability of the two P19 mutant proteins as the reason for their inability to relocalize NbALY617, western-blot analysis of agroinfiltrated leaves was carried out. This experiment confirmed that the wild-type and P19 mutant proteins were all expressed to easily detectable levels in infiltrated tissue, although there was perhaps a 4-fold increase in the accumulation of wild-type P19 protein as compared to the two mutant proteins (Fig. 6).
Silencing of Two ALY Genes in N. benthamiana by VIGS Does Not Affect Subsequent Transgene Silencing or Virus Cross-Protection
The disruption of the P19-ALY interaction by mutations in P19 that drastically affect many of its functions suggests that this interaction is important for some aspect of viral infection. To begin to examine whether the interaction with ALY affects the silencing suppression activity of P19, we carried out experiments to silence ALY expression in N. benthamiana. Transgenic plants expressing the GFP protein were inoculated with TRV carrying fragments of both NbALY615 and NbALY617 (TRV-615/617), producing a systemic infection and virus-induced gene silencing (VIGS) of the endogenous NbALY615 and NbALY617 genes. Reverse transcription (RT)-PCR was used to show that in these plants after 3 weeks, NbALY615 and NbALY617 mRNAs were either absent or very significantly reduced compared to a control mRNA (ubiquitin; Fig. 7A). Control plants were either mock inoculated or inoculated with TRV carrying part of the Arabidopsis PDS gene (TRV-PDS; Yu et al., 2003
One manifestation of RNA silencing is the phenomenon of cross-protection, where infection of a plant by a virus leads to the induction of PTGS and protection from further reinfection by a virus having the same or very similar RNA sequence (Ratcliff et al., 1999 ). To test whether cross-protection was affected by reduced levels of ALY, nontransgenic N. benthamiana plants were either mock-inoculated or inoculated with TRV-PDS or with TRV-615/617. The plants were maintained for 3 weeks to allow for systemic VIGS of ALY to be established. Two upper leaves of each plant were reinoculated with TRV expressing GFP (TRV-GFP), and 3 d later the plants were examined under UV light for GFP fluorescence. All four plants that were initially mock-inoculated displayed large, strongly fluorescent green lesions on all leaves that were secondarily inoculated with TRV-GFP, showing that these plants were fully susceptible to TRV infection. However, all 8 plants initially inoculated with the control virus TRV-PDS and all 12 plants initially inoculated with TRV-615/617 were completely lacking TRV-GFP-induced fluorescent lesions (data not shown). Thus, silencing of NbALY615 and NbALY617 by VIGS did not prevent the establishment of cross-protection in N. benthamiana.
Finally, we examined whether expression of ALY would affect the silencing or suppression of silencing of a transiently expressed mRNA. Thus, an Agrobacterium culture containing a binary plasmid expressing the
The identification of host proteins that physically interact with virus proteins is an important step in understanding how viruses make use of host components to carry out their life cycle and how the host attempts to fight against virus infection. Here, we show that a family of plant proteins, homologous to ALY/REF RNA export factors from Drosophila and mammals, is specifically targeted by the TBSV P19 pathogenicity protein. Interaction with ALY proteins from Arabidopsis and N. benthamiana was demonstrated both in vivo and in vitro, the interaction domain was mapped to a central domain conserved in plants and animals, and P19 was shown to alter subcellular localization of a subset of ALY proteins in planta. Interaction in yeast between TBSV P19 and a partial clone of a tobacco ALY homolog, referred to as Hin19, was also described in a recent article (Park et al., 2004 ).
In Arabidopsis, the family of ALY proteins consists of four members. AtALY3 and AtALY4 previously were shown to bind to the DNA-binding domain of poly(ADP-Rib) polymerase and were denoted as DIP1 and DIP2, respectively (Storozhenko et al., 2001
The function of ALY in plants is not known. GFP tagging of the Arabidopsis and N. benthamiana ALY proteins showed that they are all localized to the nucleus but that there are distinct patterns of subnuclear distribution. AtALY2 localizes to granular bodies in the nucleoplasm but is absent from the nucleolus. This pattern corresponds to that seen with human ALY, which was located in speckles in the nucleoplasm, where it colocalized with splicing factors (Zhou et al., 2000
In addition to a nucleoplasmic localization, AtALY1, AtALY3, AtALY4, NbALY615, and NbALY617 were found to accumulate in the nucleolus. This is different from the distribution seen for ALY in animals and might reflect an involvement in plant-specific processes. Also, the precise intranuclear distribution differed for each of the four Arabidopsis ALY proteins, suggesting that the different ALY family members may have specific functions. Nucleoli of plants and animals are known to differ in their structural organization, and a vectorial model has been proposed for plant nucleoli in which successive biochemical steps in rRNA maturation and ribosome biogenesis occur in concentric layers enveloping the transcription sites (Brown and Shaw, 1998
In animals, ALY is a nuclear shuttling protein that moves out of the nucleus during RNA transport but is reimported rapidly back into the nucleus, so that at steady state it is detectable only in the nucleus. Fractionation experiments determined that P19 accumulates mostly in the cell cytoplasm (Scholthof et al., 1995a Interestingly, infection of plants by TBSV, as well as expression of TBSV P19 protein alone from Agrobacterium, specifically altered the subcellular localization of a subset of the ALY proteins. AtALY2-GFP, AtALY4-GFP, and NbALY617-GFP were relocalized out of the nucleus into the cytoplasm. A truncated version of AtALY2-GFP lacking the central RRM domain, which is necessary for interaction with P19 in yeast, was retained in the nucleus and was not relocalized to the cytoplasm following coexpression in plants with P19. These results provide evidence for a dynamic localization of AtALY2, AtALY4, and NbALY617 and support the view that targeting by the P19 protein interferes with their shuttling between the nucleus and cytoplasm. We suggest that the interaction between P19 and these ALY proteins most likely takes place in the cytoplasm and prevents reimport of ALY into the nucleus. However, it is possible that some P19 could enter the nucleus, bind to ALY in the nucleus, and be exported to the cytoplasm as a protein complex. In yeast, all six plant ALY homologs interacted with P19; however, only the three strongest interactors were relocalized by P19 in planta. The correlation between interaction strength and the relocalization of ALY proteins in vivo might point to a competition for binding sites between P19 and endogenous factors. This suggests that P19 interaction with ALY inhibits the normal cellular function of ALY. Alternatively, relocalization of ALY by P19 could be indicative of the recruitment of ALY activity to the region of the cell where P19 functions. Differential relocalization of ALY is further evidence that the various ALY family members probably have different functions in the cell, only some of which are directly relevant to the TBSV infection process.
It was shown previously that substitution in P19 of the Arg at position 72 (R72) with Gly (R72G) affects many properties of the virus, including silencing suppression activity, cell-to-cell and long distance movement, and development of necrotic symptoms (Chu et al., 2000
Recently, examination of the structure of P19 showed that both Arg residues form salt bridges with Glu residues in the N terminus of the protein, near to the conserved Trp cap residues. The R72G mutation particularly was predicted to bury a charged residue within the protein structures and to affect the structural integrity of the protein (Vargason et al., 2003 The R85G mutation might be structurally less affected, allowing P19(R85G) to retain some of its activities, although it was unable to relocalize NbALY617-GFP.
The mechanism for silencing suppression is not fully understood, although during TBSV infection, P19 is known to significantly reduce free siRNAs in the cell, preventing their incorporation into the RNA-induced silencing complex (Lakatos et al., 2004
Our experiments have shown that the interaction between P19 and ALY in the highly susceptible host N. benthamiana may not be connected with the known roles of the P19 protein in this plant: silencing suppression and systemic necrosis. However, the possible role of ALY in TBSV movement in this or other plant species remains to be investigated.
In animals, ALY or ALY-associated proteins are specifically targeted by viral proteins. For example, the nucleoprotein of Influenza A virus binds to UAP56, a DEAD-box helicase that itself interacts with ALY, to stimulate virus-encoded RNA polymerase activity (Momose et al., 2001
Although some of the more obvious functions of plant viral proteins have been identified, it is clear that many of these proteins are multifunctional and interact with the host cellular machinery in subtle and sophisticated ways. This is particularly the case for viral pathogenicity proteins, many of which recently have been shown to act as suppressors of RNA silencing, although how this activity relates to the effects these proteins often have on virus movement and symptom development is not understood. Our discovery that the TBSV P19 pathogenicity protein relocalizes some but not all of the plant ALY proteins from the nucleus to the cytoplasm offers us a way to understand in better detail how this virus co-opts plant processes to its own aims.
Cloning of TBSV P19
The 19 K gene was cloned from an uncharacterized T-46 isolate of TBSV from the Scottish Crop Research Institute virus collection using PCR primers homologous to the BS3 isolate of TBSV (Luis-Areteaga et al., 1996
The TBSV P19 gene was inserted into pAS2.1 (CLONTECH, Palo Alto, CA) previously modified by the insertion of an attR-cassette (Invitrogen) to allow recombinational cloning using the Gateway system (Invitrogen). This plasmid was transformed into yeast strain PJ69-4A and used as a bait for yeast two-hybrid screenings, employing an improved interaction mating protocol described previously (Soellick and Uhrig, 2001
The Arabidopsis ALY genes were amplified by RT-PCR from poly(A+) RNA isolated from leaves of young plants. The ALY1 gene was amplified with primers 579 (AAAACATGTCGACTGGATTAGATATGTCTC) and 580 (GGGAATTCTTAGTTTGTCTCCATATCTCCAGAATG), ALY2 using primers 577 (AAAACATGTCAGGTGCTTAGATATGTC) and 578 (GGGAATTCTAACTTGTTTCCATTGCCTCTTTGTGG), ALY3 with primers 573 (AAAACATGTCAGACGCTTTGAATATGACTC) and 574 (GGGAATTCCTTAAGAGATGTTCATAGCTTCAGCATG), and ALY4 with primers 575 (AAAACATGTCTGGAGCATTGAATATGACTC) and 576 (GGGAATTCTTAAGAGGTGTTCATGGCATCAGCGTG). These primers added an NcoI-compatible BspLU11I restriction site at the translation start codon of each gene, and an EcoRI site downstream of the translation termination codon. The full-length genes were cloned into pGemT-easy (Promega, Madison, WI) for sequencing and then recloned into pENTR4 for further manipulation.
Database searches did not identify any ALY sequences from Nicotiana benthamiana or other Nicotiana species, thus a search was carried out of potato and tomato EST databases using a combination of the original mouse ALY gene and the four corresponding Arabidopsis ALY homologs (At5g59950 [ALY1], At5g02530 [ALY2], At1g66260 [ALY3], and At5g37720 [ALY4]), which were used in a BLAST search against a CAP3 (Huang and Madan, 1999
The RRM domain of the AtALY2 gene is flanked by a HindIII restriction site (nt 325) and a SapI restriction site (nt 580). Deleting the sequence between these sites created mutant HS
The full-length Arabidopsis ALY2 gene and the HS
The four Arabidopsis and two N. benthamiana ALY genes were PCR amplified using primers to add a NcoI site at the translation initiation codon and a XbaI site in place of the termination codon. The GFP gene was PCR amplified using primers to add a XbaI site immediately upstream of the translation initiation codon and a KpnI site immediately after the termination codon. The PCR fragments were cloned in a three-part ligation into the TRV expression vector, TRV-GFPc (MacFarlane and Popovich, 2000
For expression by agroinfiltration, the AtALY2-GFP, AtALY2 HS
For analysis of P19 expression, three discs (collected using the cap of an Eppendorf tube, approximately 60 mg tissue) were excised from leaves of N. benthamiana plants 3 d after infiltration with agrobacteria carrying binary plasmids containing wild-type or mutant P19 genes. The leaf discs were frozen in liquid nitrogen, homogenized with a micropestle, and extracted with 120 µL of buffer (7 M guanidine-HCl, 1 mM EDTA, 5 mM DTT, 20 mM Tris-Cl, pH 7.5). After extraction, the samples were equilibrated in 8 M urea/20 mM Tris-Cl, pH 7.2, and boiled for 5 min, and 20-µL aliquots were separated by electrophoresis through a 10% polyacrylamide/SDS gel. The proteins were transferred to PVDF membrane and probed with a mouse monoclonal antibody (1:20,000 dilution) specific for the TBSV P19 protein. Secondary probing used a hydrogen peroxidase-conjugated goat anti-mouse antibody (catalog no. 172-1011, 1:1,000 dilution; Bio-Rad, Cambridge, MA), followed by chemiluminescent detection using the ECL system (Amersham Bioscience, Buckinghamshire, UK). Equivalent loading of total proteins in each sample was examined by staining of the blotted membrane using Ponceau Red.
Mutations were introduced into the TBSV P19 gene cloned in pENTR4 using the QuikChange kit (Stratagene, La Jolla, CA). Primers 603 (GGAAAGTTGTATTTAAGGGATATCTCAGATACG) and 604 (CGTATCTGAGATATCCCTTAAATACAACTTTCC) introduce a single base change that replaces the Arg residue at position 72 with Gly. Primers 605 (GGAAACTTCATTGTACGGAGTCCTTGGATCTTGG) and 606 (CCAAGATCCAAGGACTCCGTACAATGAAGTTTCC) were used to replace Arg 85 with Gly. The mutant P19 genes were recombined into pAS-attR for yeast two-hybrid screening, and into pLX222-attR, a binary vector, for transformation into A. tumefaciens strain LBA4404 and infiltration into plants for transient expression.
A 295-nt fragment at the N terminus of the NbALY615 gene (EMBL accession no. AJ697695) was amplified with oligonucleotide primers (ACTCCATGGATCTCTCGACGATT and TGAGCATGCTCGAGTTTGAAATGAGGAGC) to add 5' NcoI and 3' XhoI sites. Similarly, a 345-nt fragment at the N terminus of the NbALY617 gene (EMBL accession no. AJ697696) was amplified with oligonucleotide primers (CCCTCGAGATGGCTGAGGCAGCTTTGGATATG and GGGGGTACCGAGAAGAGCTCCTTGATATCC) to add 5' XhoI and 3' KpnI sites. The ALY fragments were ligated in tandem into the TRV vector (TRV-GFPc; MacFarlane and Popovich, 2000 Silencing of the NbALY615 and NbALY617 genes was assessed by a qualitative RT-PCR assay. Leaf samples were collected and RNA isolated using the RNeasy kit as directed by the manufacturer (Qiagen, Valencia, CA). RNA samples were reverse transcribed using an oligo(dT) primer and MMLV reverse transcriptase according to standard procedures. PCR was carried out for 28 cycles, shown by experimentation to be within the range of exponential amplification. NbALY615-specific primers (TGCAGAGGCAGCTATCAAGA and TGGAGCAGGATTTGGATTTC) amplified a 142-nt fragment of the gene located outside of the region carried by TRV-615/617. Similarly, NbALY617-specific primers (GGAAGCCGATGAAGATTGAA and GATCAGTTCTGGGACCTCCA) amplified a 111-nt fragment of the gene located outside of the region carried by TRV-615/617. As a control, primers (AGCTGAGGGGAGGAATG and GCAACCTAGAAACCACC) from the Nicotiana tabacum ubiquitin gene (accession no. U66264) were used that also amplified a 250-nt region of the N. benthamiana ubiquitin gene.
Silencing of ALY was established in N. benthamiana plants expressing GFP. Upper leaves of these plants were then infiltrated with an Agrobacterium culture carrying a binary vector with a 35SP/GFP/NosT cassette to induce silencing of the GFP transgene as described before (Voinnet and Baulcombe, 1997
For overexpression studies, nontransgenic N. benthamiana plants were infiltrated with a culture of Agrobacterium containing the binary plasmid pGPTV(+35,+NosT) expressing GUS (Canto et al., 2002
Upon request, all novel materials described in this publication will be made available in a timely manner for noncommercial research purposes, subject to the requisite permission from any third-party owners of all or parts of the material. Obtaining any permissions will be the responsibility of the requestor. Sequence data from this article have been deposited with the EMBL/GenBank data libraries under accession numbers AJ697695 and AJ697696.
We thank Maud Swanson for excellent technical assistance. We thank John Brown for careful reading of the manuscript, Klaus Salchert and Csaba Koncz for the Arabidopsis cDNA library, David Baulcombe for seeds of the 16c line of N. benthamiana expressing GFP, Elisa Izaurralde for the clone of Drosophila ALY, and Adrian Whitehouse for the human ALY clone. We also thank Herman Scholthof and Jozsef Burgyan for providing us with antibodies against P19. Received May 10, 2004; returned for revision June 3, 2004; accepted June 3, 2004.
1 This work was supported by the Scottish Executive Environment and Rural Affairs Department and by The Royal Society (ESEP grant no. 12822 to J.F.U. and S.A.M.). 
2 These authors contributed equally to the paper.
[w] The online version of this article contains Web-only data. Article, publication date, and citation information can be found at www.plantphysiol.org/cgi/doi/10.1104/pp.104.046086. * Corresponding author; e-mail s.macfarlane{at}scri.sari.ac.uk; fax 44–1382–562426.
Anandalakshmi R, Marathe R, Ge X, Herr JM Jr, Mau C, Mallory A, Pruss G, Bowman L, Vance VB (2000) A calmodulin-related protein that suppresses posttranscriptional gene silencing in plants. Science 290: 142–144
Brown JWS, Shaw PJ (1998) Small nucleolar RNAs and pre-rRNA processing in plants. Plant Cell 10: 649–657
Bruhn L, Munnerlyn A, Grosschedl R (1997) ALY, a context-dependent coactivator of LEF-1 and AML-1, is required for TCR
Campbell RE, Tour O, Palmer AE, Steinbach PA, Baird GS, Zacharias DA, Tsien RY (2002) A monomeric red fluorescent protein. Proc Natl Acad Sci USA 99: 7877–7882 Canto T, Cillo F, Palukaitis P (2002) Generation of siRNAs by T-DNA sequences does not require active transcription or homology to sequences in the plant. Mol Plant Microbe Interact 15: 1137–1146[Medline] Carrington JC, Cary SM, Parks TD, Dougherty WG (1989) A second proteinase encoded by a plant potyvirus genome. EMBO J 8: 365–370[ISI][Medline] Cerutti H (2003) RNA interference: travelling in the cell and gaining functions? Trends Biochem Sci 19: 39–46
Chen IB, Sciabica KS, Sandri-Goldin RM (2002) ICP27 interacts with the RNA export factor Aly/REF to direct Herpes simplex virus type 1 intronless mRNAs to the TAP export pathway. J Virol 76: 12877–12889 Chen MH, Sheng J, Hind G, Handa AK, Citovsky V (2000) Interaction between the tobacco mosaic virus movement protein and host cell pectin methylesterases is required for vital cell-to-cell movement. EMBO J 19: 913–920[CrossRef][ISI][Medline] Chu M, Desvoyes B, Turina M, Noad R, Scholthof HB (2000) Genetic dissection of tomato bushy stunt virus p19-protein-mediated host-dependent symptom induction and systemic invasion. Virology 266: 79–87[CrossRef][ISI][Medline] Denli AM, Hannon GJ (2003) RNAi: an ever-growing puzzle. Trends Biochem Sci 28: 196–201[CrossRef][ISI][Medline]
Gillespie T, Boevink P, Haupt S, Roberts AG, Toth R, Valentine T, Chapman S, Oparka KJ (2002) Functional analysis of a DNA-shuffled movement protein reveals that microtubules are dispensable for the cell-to-cell movement of Tobacco mosaic virus. Plant Cell 14: 1207–1222 Govier DA, Kassanis B (1974) A virus-induced component of plant sap needed when aphids acquire potato virus Y from purified preparations. Virology 61: 420–426[CrossRef][Medline] Hamilton A, Vionnet O, Chappell L, Baulcombe D (2002) Two classes of short interfering RNA in RNA silencing. EMBO J 21: 4671–4679[CrossRef][ISI][Medline]
Hamilton AJ, Baulcombe DC (1999) A species of small anti-sense RNA in posttranscriptional gene silencing in plants. Science 286: 950–952 Hammond SM, Bernstein E, Beach D, Hannon GJ (2000) An RNA-directed nuclease mediates post-transcriptional gene silencing in Drosophila cells. Nature 404: 293–296[CrossRef][Medline]
Havelda Z, Hornyik C, Crescenzi A, Burgyan J (2003) In situ characterisation of Cymbidium ringspot tombusvirus infection-induced posttranscriptional gene silencing in Nicotiana benthamiana. J Virol 77: 6082–6086
Hiriart E, Farjot G, Gruffat H, Nguyen MVC, Sergeant A, Mante E (2003) A novel nuclear export signal and a REF interacting domain both promote mRNA export by the Epstein-Barr virus EB2 protein. J Biol Chem 278: 335–342
Huang X, Madan A (1999) CAP3: a DNA sequence assembly program. Genome Res 9: 868–877 Kasschau KD, Carrington JC (2001) Long-distance movement and replication maintenance functions correlate with silencing suppression activity of potyviral HC-Pro. Virology 285: 71–81[CrossRef][Medline] Kasschau KD, Cronin S, Carrington JC (1997) Genome amplification and long-distance movement functions associated with the central domain of tobacco etch potyvirus helper component-proteinase. Virology 228: 251–262[CrossRef][Medline] Lakatos L, Szittya G, Silhavy D, Burgyán J (2004) Molecular mechanism of RNA silencing suppression mediated by p19 protein of tombusviruses. EMBO J 23: 876–884[CrossRef][ISI][Medline] Lazo PS, Ochoa AG, Gascon S (1978) Alpha-Galactosidase (melibiase) from Saccharomyces carlsbergensis: structural and kinetic properties. Arch Biochem Biophys 191: 316–324[CrossRef][ISI][Medline] Le Hir H, Izaurralde E, Maquat LE, Moore MJ (2000b) The spliceosome deposits multiple proteins 20-24 nucleotides upstream of mRNA exon-exon junctions. EMBO J 19: 6860–6869[CrossRef][ISI][Medline]
Le Hir H, Moore MJ, Maquat LE (2000a) Pre-mRNA splicing alters mRNP composition: evidence for stable association of proteins at exon-exon junctions. Genes Dev 14: 1098–1108 Luis-Areteaga M, Rodriguez-Cerezo E, Fraile A, Saez E, Garcia-Arenal F (1996) Different tomato bushy stunt virus strains cause disease outbreaks on solanaceous crops in Spain. Phytopathology 86: 535–542 MacFarlane SA, Popovich AH (2000) Expression of foreign proteins in roots from tobravirus vectors. Virology 267: 29–35[CrossRef][Medline] Maule A, Leh V, Lederer C (2002) The dialogue between viruses and hosts in compatible interactions. Curr Opin Plant Biol 5: 279–284[CrossRef][Medline] Moissiard G, Voinnet O (2004) Viral suppression of RNA silencing in plants. Mol Plant Pathol 5: 71–82
Momose F, Basler CF, O'Neill RE, Iwamatsu A, Palese P, Nagata K (2001) Cellular splicing factor RAF-2p48/NPI-5/BAT1/UAP56 interacts with the influenza virus nucleoprotein and enhances viral RNA synthesis. J Virol 75: 1899–1908 Park J-W, Faure-Rabasse S, Robinson MA, Desvoyes B, Scholthof HB ( |
TOP
ABSTRACT
RESULTS
-galactosidase assay. In this test, NbALY617 and AtALY2 interacted the most strongly with P19 (
-glucuronidase (GUS) gene was infiltrated into N. benthamiana plants either alone or mixed with other cultures expressing ALY2 and/or P19. Expression of ALY2 did not interfere with the silencing of GUS or the suppression of silencing by P19 (data not shown). As we do not have an antibody to ALY, we were not able to confirm that ALY2 was expressed in these experiments. However, in parallel experiments using fluorescently tagged ALY and P19 proteins, whose expression was confirmed by confocal microscopy, silencing of GUS mRNA was not affected by the presence of ALY1-GFP or ALY2-GFP. In addition, coexpression with ALY2-GFP did not affect the suppression of GUS silencing induced by P19 tagged with monomeric red fluorescent protein (P19-mRFP; Supplemental Fig. 2A), despite the delocalization to the cytoplasm of ALY2-GFP induced by P19-mRFP (Supplemental Fig. 2B).