|
|
||||||||
|
First published online September 3, 2004; 10.1104/pp.104.044594 Plant Physiology 136:2790-2805 (2004) © 2004 American Society of Plant Biologists The Fast and Transient Transcriptional Network of Gravity and Mechanical Stimulation in the Arabidopsis Root Apex1,[w]Department of Botany (J.M.K., R.S.-M., W.F.B., H.W.S.), and Kenan Institute for Engineering, Technology and Science (C.S.B.), North Carolina State University, Raleigh, North Carolina 276957612
Plant root growth is affected by both gravity and mechanical stimulation (Massa GD, Gilroy S [2003] Plant J 33: 435445). A coordinated response to both stimuli requires specific and common elements. To delineate the transcriptional response mechanisms, we carried out whole-genome microarray analysis of Arabidopsis root apices after gravity stimulation (reorientation) and mechanical stimulation and monitored transcript levels of 22,744 genes in a time course during the first hour after either stimulus. Rapid, transient changes in the relative abundance of specific transcripts occurred in response to gravity or mechanical stimulation, and these transcript level changes reveal clusters of coordinated events. Transcriptional regulation occurs in the root apices within less than 2 min after either stimulus. We identified genes responding specifically to each stimulus as well as transcripts regulated in both signal transduction pathways. Several unknown genes were specifically induced only during gravitropic stimulation (gravity induced genes). We also analyzed the network of transcriptional regulation during the early stages of gravitropism and mechanical stimulation.
Plants adapt their growth in response to environmental cues. Gravity is a constant force that guides the direction of plant growth. Mechanical stimuli such as wind, rain, and obstacles in the soil trigger changes in growth patterns (Braam and Davis, 1990
It is widely accepted that gravitropic stimulation by reorientation is perceived by sedimentation of starch-containing plastids (statoliths) in the columella cells of the root tip (Kiss et al., 1989
The transduction of the physical alterations within the cell (statolith settling) into a biochemical signal is not understood. Several different second messengers of the very early signal transduction events have been identified, including inositol-1,4,5-trisphosphate (IP3), pH, and Ca2+. The fastest responses were measured for phospholipase C-mediated changes of IP3 levels in the cereal pulvini of oat and maize. A transient 5-fold increase in IP3 within 10 s of gravity stimulation in the lower half of the pulvinus was detected (Perera et al., 1999
In addition to intracellular signal transduction, the signal must be transmitted intercellularly. In roots, the gravistimulus must be transferred from the sensing cells (columella) to the responding cells elsewhere in the plant. The classic theory holds that auxin is transported laterally and accumulates on the lower side of graviresponding tissue (Cholodny, 1926
The mechanical stimulation of the root tip affects its gravity sensing and response (Massa and Gilroy, 2003
Previous microarray analysis of Arabidopsis transcript abundance compared gravitropic stimulation to mechanical stimulation (Moseyko et al., 2002
We selectively monitored changes in the Arabidopsis root apex to eliminate potential masking of changes in the hypocotyl or tissue not directly involved in root gravitropism. Using whole-genome Arabidopsis GeneChips (Affymetrix), we monitored the time course of transcript abundance of 22,744 genes after gravity and mechanical stimulation. Here, we report on the earliest detected changes in transcript levels in the Arabidopsis root apices due to gravity and mechanical stimulation compared to stationary control plants. Some transcriptional changes in Arabidopsis apical root tissues occur prior to changes in auxin concentrations, while statolith sedimentation is still occurring (MacCleery and Kiss, 1999
Arabidopsis root apices (7.5 mm, 7-d-old dark-grown seedlings) were harvested to analyze their changes in transcript abundance over the entire genome (Affymetrix GeneChip ATH1) in response to gravity stimulation (135° reorientation) and transient mechanical stimulation (5 s mild movement in the horizontal plane) as shown in Figure 1. The 5 s mechanical stimulation in the horizontal plane was chosen to mimic the mechanical component of our gravity stimulation by reorientation. Root apices were harvested before (control, 0 time point) and 2, 5, 15, 30, and 60 min after the respective stimulus. RNA extraction of approximately 150 root apices (per experiment per time point) yielded approximately 2 µg of mRNA. We amplified the mRNA by two cycles of reverse transcription/in vitro transcription according to the Affymetrix protocol for small samples (GeneChip Eukaryotic Small Sample Target Labeling Assay Version II) prior to labeling, fragmentation, and hybridization. To halt transcription and other cellular activities at the precise time points and preserve RNA profile of each sample, we submerged plants in RNAlater (Ambion, Austin, TX; Paul et al., 2004
Gene Expression in the Arabidopsis Root Apex
Fluorescence intensities are a measure of relative abundance of transcripts present in a tissue. Using an arbitrary noise cutoff at a fluorescence intensity of
Relative transcript abundance, as reflected in average fluorescence intensities, was used to identify transcripts that showed significant changes (P < 0.01) in their abundance compared to vertical controls. We found 1,730 genes (7.6%) altered in transcript abundance after gravity stimulation, while 1,691 genes (7.5%) were altered in response to mechanical stimulation (Fig. 3; Supplemental Table II). Comparing the two lists of regulated genes, we found transcript levels of 65 genes exclusively up-regulated by gravity.
Mechanical stimulation exclusively affected the transcript levels of 26 genes. Sixteen of those showed increased transcript levels, while the abundance of 10 transcripts was reduced. Transcript levels of 1,641 genes showed similar changes during gravity and mechanical stimulation. A small set of 24 genes responded to both stimuli but with different behavior, i.e. up-regulated after gravity stimulation while down-regulated after mechanical stimulation. Following either stimulus, transcription of 111 genes that were below the detection limit (75 cutoff) in vertical control root apices showed significant increases in transcript abundance and are therefore considered stress-induced genes.
A functionally diverse group of 65 genes showed increases in their transcript abundance during the first hour after gravity stimulation (Fig. 4; Supplemental Table II). We identified transcription factors (MYB, RingH2, KNAT1, HFR1, etc.), cell wall modifying enzymes (xyloglucan endotransglycosylases [XETs], pectinesterases), transporters (ions, sugar, purines), and genes involved in the response to other environmental stresses (dehydration, cold, pathogen response). Unknown genes ("expressed," "hypothetical") absent in vertical control samples that showed up-regulation after gravity stimulation were categorized as gravity induced genes. Genes showing transcripts present in the vertical control conditions, followed by significant increases in relative abundance, were categorized as gravity regulated genes. Genes down-regulated in a gravity-specific manner were not observed in any of the experiments.
Time-resolved cluster analysis identified groups of genes with distinct temporal expression patterns (Fig. 4). Transcript levels of several genes were strongly increased by 2 min, while for other genes, increases in transcript abundance were not detectable until 30 min after gravity stimulation. A cluster of five genes coding for a pentacyclic triterpene synthase (AtPEN1; At5g48010), an expressed protein (At2g16005), a Cys protease (At4g11310), S-adenosyl-L-Met:carboxymethyltransferase (SAMT)-homolog (At5g38020), and a major latex related protein (At4g23670) were up-regulated more than 3-fold within 2 min and remained at high transcript levels until 30 min. These transcripts were thereafter down-regulated to control levels by 60 min after gravity stimulation. During mechanical stimulation their transcript abundance showed a delayed and transient increase with smaller amplitude (Fig. 4). AtPEN1 is known to be involved in sterol biosynthesis, and its fast up-regulation during gravitropism might be important for the synthesis of brassinosteroids, which are involved in gravitropic signal transduction in maize roots (Kim et al., 2000
Most of the transcripts classified here as gravity specific in their regulation showed transient increases in their abundance after 5 to 15 min of reorientation. Among those gravity-specific regulated genes classified as transcription factors, the basic HLH protein HFR1 has been shown to be required for activation of a group of phytochrome A-mediated photoresponses in Arabidopsis (Kim et al., 2002 To validate the microarray data, specifically those fast and transient changes in gravity-specific gene expression, we generated sequence-specific primers and performed real-time reverse transcription (RT)-PCR on a third independent biological replicate. Real-time RT-PCR with isoform specific primers for AtPEN1 (At5g48010), major latex protein (MLP; At4g23670), Cys proteinase (CP; At4g11310), the homeobox-Leu zipper protein ATHB-12 (At3g61890), bet vI protein family (At1g70830), and a cyclic nucleotide-regulated ion channel (CNGC2; At5g15410) confirmed the relative abundance and temporal changes for the transcript levels of these genes following gravity stimulation (Fig. 5, only MLP and CP shown).
Specific Responses to Mechanical Stimulation
Mechanical stimulation was sensed by the root apex and led to significant changes in transcript abundance of 1,696 genes, of which 26 were specifically regulated under mechanical stimulation and not by gravity (Fig. 6; Supplemental Table II). In addition to nine transcripts with unknown function, we found a mitochondrial proton-ATPase (At1g78020), a putative sulfate transporter (At3g15990), a putative cytochrome P450 (At3g14650), and a wound-induced protein (At4g10270) to be up-regulated within 2 min after mechanical stimulation. Rapid decreases in the abundance of mRNA after mechanical stimulation were observed for genes encoding a cyclic nucleotide regulated K+-channel (CNGC14; At2g24610), an expansin (EXP18; At1g62980), a RING-finger transcription factor (At2g20030), a sugar transporter (ERD6; At1g08900), and a member of the thaumatin family, which are involved in pathogen response (At5g40020). None of those genes have been shown to be involved in the response to any thigmotropic stimulus before. Several genes we expected to find in this category, i.e. "touch" genes (Braam and Davis, 1990
A Transcriptional Network Common to Gravitational and Mechanical Stimulation
Considering the similarity in growth responses and signaling events (Sistrunk et al., 1994
In addition to their biological process, we analyzed the subcellular localization of those genes commonly regulated by both stimuli using the Gene Ontology for cellular component (http://www.Arabidopsis.org/tools/bulk/go/index.jsp). Approximately one-third of the genes were predicted to be membrane or membrane-associated proteins. In addition to the 20% of regulated genes whose proteins were predicted to be localized to the plastid, we found 29 and 13 genes to be significantly increased in their transcript abundance that are encoded on the plastid and mitochondrial chromosomes, respectively. These genes code for subunits of the ATPase (atpB), NADH-dehydrogenase, cytochrome b6, several subunits of PSII as well as some small and large ribosomal subunits, RNA polymerase (rpoA and C2), and three hypothetical proteins (ycf1, ycf2) on the plastid chromosome. On the mitochondrial genome, only the NADH-dehydrogenase subunits 1, 2, 3, and 5 were up-regulated in addition to 9 open reading frames.
In addition to those genes that exhibited specific changes only after gravity or mechanical stimulation, we found 24 transcripts that were regulated by either stimulus but with different effects on their transcript abundance (Fig. 8; Supplemental Table II). Opposite regulation of transcript levels was identified, where the same gene shows increases in transcript abundance after one stimulus and a decrease after the other stimulus. An example of this is for a putative isoform of geranyl diphosphate synthase (At1g78510; Fig. 8A), which is transiently down-regulated after gravity stimulation while transiently up-regulated after mechanical stimulation. Transcript levels of a member of the Leu-rich repeat disease resistance protein family (At3g20820; Supplemental Table II) showed the reverse regulation with a transient increase after gravity stimulation and a decrease after mechanical stimulation. Some genes exhibited a different temporal sequence in transcript regulation between both stimuli. For example, the transcript level of an ATP-binding cassette transporter (At1g17840) showed a transient increase within the first 30 min after reorientation and showed a significantly delayed response to mechanical stimulation (Fig. 8B). By contrast, transcript levels for ribonuclease RNS3 (At1g26820) were immediately down-regulated upon mechanical stimulation, while a much smaller change in transcript levels after gravity stimulation was only observed after 15 min (Fig. 8C). These differentially responding genes provide insight into early signal transduction events in either stimulus.
Regulators of Gene Expression Involved in Mechanical and Gravity Sensing Changes in gene expression comprise changes in the relative rates of transcription, translation, and degradation of its mRNA. Approximately 15% of all transcripts regulated by either stress were classified as transcriptional regulators according to their molecular function. Proteins involved in activation or repression of transcription (chromatin modification, histones, transcription factors, RNA-polymerases) were found to be regulated. Only a few proteins are known to function in RNA stability and degradation. The mRNA levels of ribonuclease RNS3 (At1g26820) decreased after either stimulus with different kinetics (Fig. 8C). Most genes involved in chromatin organization and modification, such as DNA helicase, chromomethylase, chromosome condensation protein, histones H2A and H3, DNA gyrase, SNF2 domain helicases, SET-domain regulators, and replication factors, were down-regulated. Increased abundance was detected for some specific histone isoforms (H1, H2B, and H3.2), RNA polymerase subunits (nuclear and plastid isoforms), a sigma-related factor, a homolog to chromodomain-helicases, and a high mobility group 2-related protein. For most of these proteins, the specific functions are unknown. Based on the homology, it can be speculated that some chromatin modification takes place after either stimulus to regulate gene expression on the chromosomal level. The largest group of transcripts regulated after either stimulus are transcription factors. Transcription factors have been classified into families according to their structure and domain composition. Only specific isoforms of each family showed regulation during either or both stresses (Fig. 9). Most isoforms of those families showed increases in their transcript abundance. Only one group of zinc-finger transcription factors containing a Cys-His-rich domain was identified for which all regulated isoforms showed a decrease in their abundance. These Cys-His-rich domain zinc-finger proteins contain short domains rich in Cys and His and probably bind one or two zinc ions (renamed DC1 for divergent D1, IPR004146). This plant-specific Cys-His-rich domain is found in 159 Arabidopsis proteins and its function is unknown.
Regulation of Cell Wall Loosening
Cell wall composition and extensibility change during gravitropism, and genes regulating cell wall loosening are activated after touch stimulation (Gibeaut et al., 1990
Involvement and Temporal Sequence of Hormonal Regulation
Several of the genes regulated by reorientation and mechanical stimulation have been assigned to functional categories relating to hormone synthesis or hormone regulated gene expression. Auxin-responsive genes (small auxin up-regulated RNA [SAUR], IAAs) were regulated (up and down) immediately and exhibited changes in transcript abundance within 2 min after either stimulus (Fig. 11). Very rapid (25 min) induction of transcription had been shown previously for exogenously applied auxin (McClure and Guilfoyle, 1989
Notably, the abundance of 28 transcripts encoding proteins involved in brassinosteroid synthesis or gene regulation was shown to respond to both stimuli (Supplemental Table II). Pentacyclic triterpene synthase (ATPEN1) is a known key step in steroid biosynthesis (Benveniste, 2004
To detect potential cis-acting elements among a cluster of coregulated genes, we performed analyses using MotifSampler to find overrepresented motifs in the 2-kb upstream sequence of a set of gravity induced transcripts that were greatly up-regulated prior to 2 min (Thijs et al., 2002
We have analyzed the effects of gravity and mechanical stimulation on transcript abundance in Arabidopsis root apices. We observed fast and transient changes in transcript levels throughout the first hour of gravity and mechanical stimulation in functionally diverse groups, such as transcription factors, cell wall modifying enzymes, transporters, kinases, phosphatases, hormone metabolism, and cell cycle. The results suggest both the relative abundance and specific timing of events are important for establishment of gene expression cascades for either stimulus since most of the transcripts abundance changes we observed were transient. We identified 1,665 transcripts whose abundance was significantly altered as a result of both the gravity and mechanical stimulation. This reflects the large degree (96% of regulated transcripts) of overlap between responses to the two abiotic stimuli. Many transcripts we observed to be regulated by gravity or mechanical stimulation are regulated by other stresses, such as drought, cold, light, and biotic stimulation by pathogens as well. Many of these events, along with thigmotropism and gravitropism, involve cell wall modification and cell elongation. This overlapping response between and within biotic and abiotic stresses shows there is a core set of genes whose expression is regulated in response to a wide array of specific stress stimuli. Also, a smaller specific subset of genes accounting for only 4% of regulated genes is shown to be induced exclusively through gravitropic stimulation, while only approximately 2% of all regulated transcripts are shown to be regulated exclusively through mechanical stimulation. We hypothesize that this small number of stimuli-specific regulated genes are necessary in the establishment of the first events in complex gene cascades that then branch out and act through a general set of stress-regulated genes to result in cell elongation and wall modification.
We focused in this study on characterizing differences and mutuality of early transcriptional responses to gravity and mechanical stimulation in Arabidopsis root apical tissue by analyzing steady-state transcript abundances and their temporal changes. Steady-state transcript abundance of each mRNA is determined by the rate of its transcription and the rate of its degradation. Therefore, the fast and transient regulation of several clusters of genes after either stimulus would require tight control for the regulation of both transcription and degradation. The analysis of changes in transcript abundance during gravitropic and mechanical signal transduction does not allow us to distinguish between the relative changes of synthesis versus stability of specific transcripts in our experimental design. Instability of mRNA facilitates fast changes in mRNA levels that result in transient and tightly controlled regulation of gene expression. Sequence elements like the downstream element in the 3' untranslated region of SAUR have been shown to determine fast degradation of its mRNA (McClure et al., 1989
Interpretation of previous studies of gravity-induced changes in transcript abundance are limited by the GeneChip (8 K) available at the time, the tissue sample (whole seedlings), the mode of mechanical stimulation (360° rotation within 10 s), and the time points (15 and 30 min) analyzed (Moseyko et al., 2002
One of the mysteries of gravitropic signal perception and transduction is how the cell distinguishes its position within the organ and with respect to the vector of gravity. The differential growth response with faster elongation rates on the upper versus the lower side of the tissue, which causes downward bending (in roots), is transduced by a concentration gradient of auxin (Went and Thimann, 1937 More detailed molecular and biochemical analyses are in progress on many of the stimuli-specific regulated transcripts in an effort to elucidate their function in the response mechanism of gravity and mechanical stimulation. Localization and mutant analyses will allow us to determine whether these particular genes are necessary for gravity sensing and/or response. In addition, identification of the effectors regulating fast and transient gravity-specific gene expression will aid us in determining the initial signal transduction events responsible for gravity sensing in plant root tips.
We have shown here that a fast and transient network of transcriptional regulation controls the response to gravitropic and mechanical stimulation in Arabidopsis root apices. Transcript abundance of several genes was specifically up- or down-regulated within less than 2 min after stimulation. Only a small number of transcripts showed stimulus-specific changes in their abundance, while the majority (approximately 96%) of all regulated transcripts responded to both stimuli. Except for some auxin-induced genes, nothing is known about the mechanisms of regulation of transcript abundance after gravity or mechanical stimulation. Second messengers known to be involved in gravitropic signal transduction like IP3, Ca2+, pH, reactive oxygen species, and the cytoskeleton could be directly or indirectly involved in the transcriptional regulation. Our future research will focus on higher temporal and spatial resolution of gravity-induced transcript abundance changes and identify the mechanisms of regulation for gravity-specific regulated gene expression.
Plant Growth and Experimental Design Wild-type (Col-O) Arabidopsis seeds (Lehle, Round Rock, TX) were presterilized in 30% bleach and washed five times in sterile water. Sterile seeds were sown to square (100 mm x 100 mm x 15 mm) petri dishes (Becton-Dickinson, Franklin Lakes, NJ) containing 4.3 g/L Murashige and Skoog salts (Invitrogen, Carlsbad, CA), 0.5 g/L MES salt (Sigma, St. Louis), 10 g/L Suc (Sigma), and 8 g/L agar type M (Sigma), pH 5.7. Plates and seeds were wrapped in aluminum foil, vernalized horizontally at 4°C for 48 h and placed vertically in a 22°C growth chamber for 7 d. Approximately 18 h prior to the experiment, plants were removed from foil, randomized, divided into groups (mechanical and gravity stimulation), and allowed to acclimate to dark room conditions (22°C, dim green light; bandpass, 525 ± 15 nm). Plants were subjected to gravity stimulation by slowly rotating plates into a device designed to hold plates in 135° orientation. Mechanical stimulation of plants was performed by gentle vertical oscillation of a set of plates in each time point for a period of 5 s within the gravity vector plane. Harvesting prior to (0 min) and 2 min, 5 min, 15 min, 30 min, and 60 min after either stimulus was carried out by pouring approximately 15 mL of RNAlater (Ambion) directly onto the plates. Approximately 0.75 cm of each root was cut on a chilled microscope slide from root tip toward stem and stored in approximately 40 µL of RNAlater at 20°C. Microarray analysis was carried out on two independent experiments, and the results were confirmed by real-time PCR on a third independent experiment.
Root apices of 7-d-old dark grown Arabidopsis seedlings were submerged for approximately 3 s in RNAlater (Ambion), immediately rinsed with water, stained for approximately 10 s in trypan blue (0.4% solution in phosphate buffer saline, Mediatech CELLGRO; Herndon, VA), and again rinsed in water. We used a Carl Zeiss microscope (AXIOSKOP 40; Jena, Germany) and the program Auxio Vision 3.1 to process and analyze all the samples.
Homogenization of tissue was performed using FastRNA (Qbiogen, Carlsbad, CA) lysing matrix and tube to which 400 µL of RLT extraction buffer and apical root tissue was added (settings: 2 cycles x 30 s on speed 6). The resulting lysis buffer and matrix were poured directly into a Qiashredder column and processed according to the Plant + Fungi protocol in the RNeasy plant minikit manual (Qiagen, Valencia, CA). Purified RNA was eluted from the column using 20 µL of water.
Amplified complementary RNA was synthesized according to Affymetrix GeneChip eukaryotic small sample target labeling assay II (Affymetrix; https://www.affymetrix.com/support/technical/technotes/smallv2_technote.pdf). Double-stranded cDNAs were synthesized from 100 ng of total RNA using oligo(dT)24 containing T7 RNA polymerase promoter sequence with SuperScript II RT (Invitrogen). Complementary RNAs were transcribed from entire cDNA pellet using Megascript T7 RNA polymerase (Ambion). A second cycle of cDNA synthesis was performed to amplify cRNA where the first strand of cDNA was synthesized using random primers with SuperScript II RT (Invitrogen). The RNA template was removed by treatment with RNaseH, and T7 labeled-oligo(dT)24 was annealed to the cDNA. Second strand of the cDNA was synthesized, and the entire cDNA pellet was used to synthesize biotin-labeled cRNA using T7 RNA polymerase (ENZO Biochem, Farmingdale, NY). Ten micrograms of fragmented biotin labeled cRNA containing hybridization controls (BioB, BioC, BioD, cre1-1) was hybridized to an Affymetrix ATH1 whole-genome array for 16 h at 45°C. The arrays were washed and stained with a streptavidin R phycoerythrin conjugate (Molecular Probes, Eugene, OR) on a GeneChip Fluidics Station 400 (Affymetrix) and scanned with an argon-ion laser with a 488-nm emission and a 570-nm detection (GeneArray scanner; Agilent, Palo Alto, CA).
Microarray data were analyzed using MAS5 (Affymetrix). Scanned arrays were normalized to baseline array with median overall expression using dCHIP (Li and Wong, 2001
Total RNA was extracted from roots using Qiashredder and RNeasy plant mini kit (Qiagen). Residual DNA was removed by performing an on-column digestion using a DNA-free kit (Ambion). cDNA was synthesized according to the Taqman RT kit protocol (ABI, Foster City, CA) on 300 ng of RNA and dT16-oligonucleotide as primer. Following synthesis, cDNA samples were diluted to 1,000 pg/µL with DNase/RNase-free water. PCR primers were designed using OligoAnalyzer 3.0 (http://biotools.idtdna.com/biotools) to create amplicons 80 to 120 bp in length from regions within 500 bp from the 3' end of cDNA. Primers used had the following characteristics: melting temperature between 55°C to 60°C, 3' G/C clamp, 40% to 60% G/C content overall, and matching only desired tentative consensus sequence in The Institute for Genomic Research tgi database (http://tigrblast.tigr.org/tgi/). The primers are F_At2g40880_GTTATGCAAAGGATCCAGTGAGCC, R_At2g40880_CAAACATTGCCCTCCATACAAATC, F_At4g23670_TACAAGAGCTGGAAGAGCGAGAAC, and R_At4g23670_GTCATGTTCGCCTTCGTGAACAAC. No-RT controls were used on each 96-well plate to ensure that no genomic DNA was carried over. To ensure consistent tissue collection, RNA extraction, and RT, we used the housekeeping control Actin8 primers designed around the 3' end of the cDNA (5'-CTTTCCGGTTACAGCGTTTG-3' and 5'-GAAACGCGGATTAGTGCCT-3').
PCR was performed using an ABI7900HT sequence detection system set to the following conditions: activation of Taq 95°C for 10 min, denaturing 40 cycles at 95°C of 15 s, and annealing and extension 60° for 1 min. The following reagents were combined with each sample and control: 15.5 µL of SYBR Green PCR master mix (ABI), 2.5 µL of primers (0.2 µM), and 4.5 µL of cDNA (0.001 µM). Data were analyzed using ABI SDS software (ABI), and gene expression data were calculated using the 2^
Base sequences (DNA) 2,000 bp upstream of transcription start site corresponding to very early gravity induced genes, At2g16005, At4g11310, At4g23670, At5g38020, and At5g48010, were queried from The Arabidopsis Information Resource (TAIR), and a search for overrepresented sequences was performed according to Thijs et al. (2002) Upon request, all novel materials described in this publication will be made available in a timely manner for noncommercial research purposes, subject to the requisite permission from any third-party owners of all or parts of the material. Obtaining any permissions will be the responsibility of the requestor.
We thank Nina Allen, Eric Davies, Gloria Muday, Imara Perera, Niki Robertson, and Ron Sederoff for stimulating discussions. Received April 30, 2004; returned for revision May 28, 2004; accepted May 30, 2004.
1 This work was supported by the National Aeronautics and Space Administration (grant no. NAG 21566).
[w] The online version of this article contains Web-only data. Article, publication date, and citation information can be found at www.plantphysiol.org/cgi/doi/10.1104/pp.104.044594. * Corresponding author; e-mail heike_winter{at}ncsu.edu; fax 9195157801.
Aida M, Ishida T, Fukaki H, Fujisawa H, Tasaka M (1997) Genes involved in organ separation in Arabidopsis: an analysis of the cup-shaped cotyledon mutant. Plant Cell 9: 841857 Arabidopsis Genome Initiative (2000) Analysis of the genome sequence of the flowering plant Arabidopsis thaliana. Nature 408: 796815[CrossRef][Medline] Bennett MJ, Marchant A, Green HG, May ST, Ward SP, Millner PA, Walker AR, Schulz B, Feldmann KA (1996) Arabidopsis AUX1 gene: a permease-like regulator of root gravitropism. Science 273: 948950[Abstract] Benveniste P (2004) Biosynthesis and accumulation of sterols. Annu Rev Plant Physiol Plant Mol Biol 55: 429457[CrossRef][Medline]
Birnbaum K, Shasha DE, Wang JY, Jung JW, Lambert GM, Galbraith DW, Benfey PN (2003) A gene expression map of the Arabidopsis root. Science 302: 19561960 Blancaflor EB (2002) The cytoskeleton and gravitropism in higher plants. Plant Growth Regul 21: 120136
Blancaflor EB, Fasano JM, Gilroy S (1998) Mapping the functional roles of cap cells in the response of Arabidopsis primary roots to gravity. Plant Physiol 116: 213222 Braam J, Davis RW (1990) Rain-, wind-, and touch-induced expression of calmodulin and calmodulin-related genes in Arabidopsis. Cell 60: 357364[CrossRef][Web of Science][Medline]
Brock TG, Kaufman PB (1988) Altered growth response to exogenous auxin and gibberellic acid by gravistimulation in pulvini of Avena sativa. Plant Physiol 87: 130133 Chaban CI, Kordyum EL, Demkiv OT, Khorkavtsiv OY, Khorkavtsiv YD (1999) The gravireaction of ceratodon protonemata treated with gibberellic acid. Adv Space Res 24: 717721[Medline]
Chen R, Hilson P, Sedbrook J, Rosen E, Caspar T, Masson PH (1998) The Arabidopsis thaliana AGRAVITROPIC 1 gene encodes a component of the polar-auxin-transport efflux carrier. Proc Natl Acad Sci USA 95: 1511215117 Cholodny N (1926) Beitraege zur Analyse der geotropischen Reaktion. Jahrb Wiss Bot 65: 447459 Chuck G, Lincoln C, Hake S (1996) KNAT1 induces lobed leaves with ectopic meristems when overexpressed in Arabidopsis. Plant Cell 8: 12771289[Abstract] Collings DA, Zsuppan G, Allen NS, Blancaflor EB (2001) Demonstration of prominent actin filaments in the root columella. Planta 212: 392403[CrossRef][Medline]
Eisen MB, Spellman PT, Brown PO, Botstein D (1998) Cluster analysis and display of genome-wide expression patterns. Proc Natl Acad Sci USA 95: 1486314868 Evans ML, Moore R, Hasenstein KH (1986) How roots respond to gravity. Sci Am 255: 112119[Medline] Fasano JM, Massa GD, Gilroy S (2002) Ionic signaling in plant responses to gravity and touch. J Plant Growth Regul 21: 7188[Medline]
Fasano JM, Swanson SJ, Blancaflor EB, Dowd PE, Kao T-H, Gilroy S (2001) Changes in root cap pH are required for the gravity response of the Arabidopsis root. Plant Cell 13: 907922
Fizames C, Munos S, Cazettes C, Nacry P, Boucherez J, Gaymard F, Piquemal D, Delorme V, Commes T, Doumas P, et al (2004) The Arabidopsis root transcriptome by serial analysis of gene expression. Gene identification using the genome sequence. Plant Physiol 134: 6780 Friml J, Wisniewska J, Benkova E, Mendgen K, Palme K (2002) Lateral relocation of auxin efflux regulator PIN3 mediates tropism in Arabidopsis. Nature 415: 806809[Medline]
Gibeaut DM, Karuppiah N, Chang SR, Brock TG, Vadlamudi B, Kim D, Ghosheh NS, Rayle DL, Carpita NC, Kaufman PB (1990) Cell wall and enzyme changes during the graviresponse of the leaf-sheath pulvinus of oat (Avena sativa). Plant Physiol 94: 411416 Golan A, Tepper M, Soudry E, Horwitz BA, Gepstein S (1996) Cytokinin, acting through ethylene, restores gravitropism to Arabidopsis seedlings grown under red light. Plant Physiol 112: 901904[Abstract] Guilfoyle TJ (1995) Auxin regulated gene expression and gravitropism in plants. ASGSB Bull 8: 3945[Medline]
Gus-Mayer S, Naton B, Hahlbrock K, Schmelzer E (1998) Local mechanical stimulation induces components of the pathogen defense response in parsley. Proc Natl Acad Sci USA 95: 83988403
Gutierrez RA, Ewing RM, Cherry JM, Green PJ (2002) Identification of unstable transcripts in Arabidopsis by cDNA microarray analysis: rapid decay is associated with a group of touch- and specific clock-controlled genes. Proc Natl Acad Sci USA 99: 1151311518 Hendricks CL, Ross JR, Pichersky E, Noel JP, Zhou ZS (2004) An enzyme-coupled colorimetric assay for S-adenosylmethionine-dependent methyltransferases. Anal Biochem 326: 100105[CrossRef][Web of Science][Medline]
Higo K, Ugawa Y, Iwamoto M, Korenaga T (1999) Plant cis-acting regulatory DNA elements (PLACE) database: 1999. Nucleic Acids Res 27: 297300
Iliev EA, Xu W, Polisensky DH, Oh MH, Torisky RS, Clouse SD, Braam J (2002) Transcriptional and posttranscriptional regulation of Arabidopsis TCH4 expression by diverse stimuli. Roles of cis regions and brassinosteroids. Plant Physiol 130: 770783
Joo JH, Bae YS, Lee JS (2001) Role of auxin-induced reactive oxygen species in root gravitropism. Plant Physiol 126: 10551060 Juniper BE, Groves S, Landausc B, Audus LJ (1966) Root cap and perception of gravity. Nature 209: 93[CrossRef]
Kim JY, Yuan Z, Jackson D (2003) Developmental regulation and significance of KNOX protein trafficking in Arabidopsis. Development 130: 43514362
Kim SK, Chang SC, Lee EJ, Chung WS, Kim YS, Hwang S, Lee JS (2000) Involvement of brassinosteroids in the gravitropic response of primary root of maize. Plant Physiol 123: 9971004 Kim YM, Woo JC, Song PS, Soh MS (2002) HFR1, a phytochrome A-signalling component, acts in a separate pathway from HY5, downstream of COP1 in Arabidopsis thaliana. Plant J 30: 711719[CrossRef][Web of Science][Medline] Kiss JZ, Hertel R, Sack FD (1989) Amyloplasts are necessary for full gravitropic sensitivity in roots of Arabidopsis thaliana. Planta 177: 198206[CrossRef][Web of Science][Medline] Kiss JZ, Wright JB, Caspar T (1996) Gravitropism in roots of intermediate-starch mutants of Arabidopsis. Physiol Plant 97: 237244[CrossRef][Medline] Knight MR, Campbell AK, Smith SM, Trewavas AJ (1991) Transgenic plant aequorin reports the effects of touch and cold-shock and elicitors on cytoplasmic calcium. Nature 352: 524526[CrossRef][Medline]
Lee JS, Chang WK, Evans ML (1990) Effects of ethylene on the kinetics of curvature and auxin redistribution in gravistimulated roots of Zea mays. Plant Physiol 94: 17701775 Lee YH, Oh HS, Cheon CI, Hwang IT, Kim YJ, Chun JY (2001) Structure and expression of the Arabidopsis thaliana homeobox gene Athb-12. Biochem Biophys Res Commun 284: 133141[CrossRef][Web of Science][Medline] Legue V, Blancaflor E, Wymer C, Perbal G, Fantin D, Gilroy S (1997) Cytoplasmic free Ca2+ in Arabidopsis roots changes in response to touch but not gravity. Plant Physiol 114: 789800[Abstract]
Lescot M, Dehais P, Thijs G, Marchal K, Moreau Y, Van de Peer Y, Rouze P, Rombauts S (2002) PlantCARE, a database of plant cis-acting regulatory elements and a portal to tools for in silico analysis of promoter sequences. Nucleic Acids Res 30: 325327
Li C, Wong WH (2001) Model-based analysis of oligonucleotide arrays: expression index computation and outlier detection. Proc Natl Acad Sci USA 98: 3136
Lincoln C, Long J, Yamaguchi J, Serikawa K, Hake S (1994) A knotted1-like homeobox gene in Arabidopsis is expressed in the vegetative meristem and dramatically alters leaf morphology when overexpressed in transgenic plants. Plant Cell 6: 18591876 Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25: 402408[CrossRef][Web of Science][Medline] Lomax TL (1997) Molecular genetic analysis of plant gravitropism. Gravit Space Biol Bull 10: 7582[Medline]
Long JC, Zhao W, Rashotte AM, Muday GK, Huber SC (2002) Gravity-stimulated changes in auxin and invertase gene expression in maize pulvinal cells. Plant Physiol 128: 591602
MacCleery SA, Kiss JZ (1999) Plastid sedimentation kinetics in roots of wild-type and starch-deficient mutants of Arabidopsis. Plant Physiol 120: 183192
Madlung A, Behringer FJ, Lomax TL (1999) Ethylene plays multiple nonprimary roles in modulating the gravitropic response in tomato. Plant Physiol 120: 897906 Massa GD, Fasano JM, Gilroy S (2003) Ionic signaling in plant gravity and touch responses. Gravit Space Biol Bull 16: 7182[Medline] Massa GD, Gilroy S (2003) Touch modulates gravity sensing to regulate the growth of primary roots of Arabidopsis thaliana. Plant J 33: 435445[CrossRef][Web of Science][Medline] McClure BA, Guilfoyle T (1987) Characterization of a class of small auxin-inducible soybean polyadenylated RNAs. Plant Mol Biol 9: 611623[CrossRef][Web of Science]
McClure BA, Guilfoyle T (1989) Rapid redistribution of auxin-regulated RNAs during gravitropism. Science 243: 9193
McClure BA, Hagen G, Brown CS, Gee MA, Guilfoyle TJ (1989) Transcription, organization, and sequence of an auxin-regulated gene-cluster in soybean. Plant Cell 1: 229239
Moore R, Dickey K (1985) Growth and graviresponsiveness of primary roots of Zea mays seedlings deficient in abscisic acid and gibberellic acid. J Exp Bot 36: 17931798
Moseyko N, Zhu T, Chang HS, Wang X, Feldman LJ (2002) Transcription profiling of the early gravitropic response in Arabidopsis using high-density oligonucleotide probe microarrays. Plant Physiol 130: 720728 Muday GK, Lomax TL, Rayle DL (1995) Characterization of the growth and auxin physiology of roots of the tomato mutant, diageotropica. Planta 195: 548553[Web of Science][Medline]
Mullen JL, Wolverton C, Ishikawa H, Evans ML (2000) Kinetics of constant gravitropic stimulus responses in Arabidopsis roots using a feedback system. Plant Physiol 123: 665670
Newman TC, Ohme-Takagi M, Taylor CB, Green PJ (1993) DST sequences, highly conserved among plant SAUR genes, target reporter transcripts for rapid decay in tobacco. Plant Cell 5: 701714
Ottenschlager I, Wolff P, Wolverton C, Bhalerao RP, Sandberg G, Ishikawa H, Evans M, Palme K (2003) From the cover: gravity-regulated differential auxin transport from columella to lateral root cap cells. Proc Natl Acad Sci USA 100: 29872991
Parker KE, Briggs WR (1990) Transport of IAA during gravitropism in intact maize coleoptiles. Plant Physiol 94: 17631769
Paul AL, Schuerger AC, Popp MP, Richards JT, Manak MS, Ferl RJ (2004) Hypobaric biology: Arabidopsis gene expression at low atmospheric pressure. Plant Physiol 134: 215223
Perera IY, Heilmann I, Boss WF (1999) Transient and sustained increases in inositol 1,4,5-trisphosphate precede the differential growth response in gravistimulated maize pulvini. Proc Natl Acad Sci USA 96: 58385843
Perera IY, Heilmann I, Chang SC, Boss WF, Kaufman PB (2001) A role for inositol 1,4,5-trisphosphate in gravitropic signaling and the retention of cold-perceived gravistimulation of oat shoot pulvini. Plant Physiol 125: 14991507
Philippar K, Fuchs I, Luthen H, Hoth S, Bauer CS, Haga K, Thiel G, Ljung K, Sandberg G, Bottger M, et al (1999) Auxin-induced K+ channel expression represents an essential step in coleoptile growth and gravitropism. Proc Natl Acad Sci USA 96: 1218612191 Philosoph-Hadas S, Meir S, Rosenberger I, Halevy AH (1996) Regulation of the gravitropic response and ethylene biosynthesis in gravistimulated snapdragon spikes by calcium chelators and ethylene inhibitors. Plant Physiol 110: 301310[Abstract] Pickard BG, Ding JP (1993) The mechanosensory calcium-selective ion channel: key component of a plasmalemmal control centre? Aust J Plant Physiol 20: 439459[Web of Science][Medline]
Plieth C, Trewavas AJ (2002) Reorientation of seedlings in the earth's gravitational field induces cytosolic calcium transients. Plant Physiol 129: 786796
Rood SB, Kaufman PB, Abe H, Pharis RP (1987) Gibberellins and gravitropism in maize shoots: endogenous gibberellin-like substances and movement and metabolism of [3H]Gibberellin A20. Plant Physiol 83: 645651
Scott AC, Allen NS (1999) Changes in cytosolic pH within Arabidopsis root columella cells play a key role in the early signaling pathway for root gravitropism. Plant Physiol 121: 12911298 Sedbrook J, Boonsirichai K, Chen R, Hilson P, Pearlman R, Rosen E, Rutherford R, Batiza A, Carroll K, Schulz T, et al (1998) Molecular genetics of root gravitropism and waving in Arabidopsis thaliana. Gravit Space Biol Bull 11: 7178[Medline] Shulaev V, Silverman P, Raskin I (1997) Airborne signalling by methyl salicylate in plant pathogen resistance. Nature 385: 718721 Sistrunk ML, Antosiewicz DM, Purugganan MM, Braam J (1994) Arabidopsis TCH3 encodes a novel Ca2+ binding protein and shows environmentally induced and tissue-specific regulation. Plant Cell 6: 15531565[Abstract] Souer E, van Houwelingen A, Kloos D, Mol J, Koes R (1996) The no apical meristem gene of petunia is required for pattern formation in embryos and flowers and is expressed at meristem and primordia boundaries. Cell 85: 159170[CrossRef][Web of Science][Medline] TAIR (2004) The Arabidopsis Information Resource. http://www.arabidopsis.org (February 25, 2004) Takada S, Hibara K, Ishida T, Tasaka M (2001) The CUP-SHAPED COTYLEDON1 gene of Arabidopsis regulates shoot apical meristem formation. Development 128: 11271135[Abstract] Tasaka M, Kato T, Fukaki H (1999) The endodermis and shoot gravitropism. Trends Plant Sci 4: 103107[CrossRef][Web of Science][Medline] Tasaka M, Kato T, Fukaki H (2001) Genetic regulation of gravitropism in higher plants. Int Rev Cytol 206: 135154[Web of Science][Medline] Thijs G, Marchal K, Lescot M, Rombauts S, De Moor B, Rouze P, Moreau Y (2002) A Gibbs sampling method to detect overrepresented motifs in the upstream regions of coexpressed genes. J Comput Biol 9: 447464[CrossRef][Web of Science][Medline] Went FW, Thimann KV (1937) Phytohormones. Macmillan, New York Xu W, Purugganan MM, Polisensky DH, Antosiewicz DM, Fry SC, Braam J (1995) Arabidopsis TCH4, regulated by hormones and the environment, encodes a xyloglucan endotransglycosylase. Plant Cell 7: 15551567[Abstract]
Yamada K, Lim J, Dale JM, Chen H, Shinn P, Palm CJ, Southwick AM, Wu HC, Kim C, Nguyen M, et al (2003) Empirical analysis of transcriptional activity in the Arabidopsis genome. Science 302: 842846
Yang KY, Kim YM, Lee S, Song PS, Soh MS (2003) Overexpression of a mutant basic helix-loop-helix protein HFR1, HFR1-DeltaN105, activates a branch pathway of light signaling in Arabidopsis. Plant Physiol 133: 16301642
Yoder TL, Zheng H-Q, Todd P, Staehelin LA (2001) Amyloplast sedimentation dynamics in maize columella cells support a new model for the gravity-sensing apparatus of roots. Plant Physiol 125: 10451060 Young LM, Evans ML (1996) Patterns of auxin and abscisic acid movement in the tips of gravistimulated primary roots of maize. Plant Growth Regul 20: 253258[Medline]
Young LM, Evans ML, Hertel R (1990) Correlations between gravitropic curvature and auxin movement across gravistimulated roots of Zea mays. Plant Physiol 92: 792796
Zubieta C, Ross JR, Koscheski P, Yang Y, Pichersky E, Noel JP (2003) Structural basis for substrate recognition in the salicylic acid carboxyl methyltransferase family. Plant Cell 15: 17041716 Zurek DM, Clouse SD (1994) Molecular cloning and characterization of a brassinosteroid-regulated gene from elongating soybean (Glycine max L.) epicotyls. Plant Physiol 104: 161170[Abstract] Related articles in Plant Physiol.:
This article has been cited by other articles:
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ASPB Publications | PLANT PHYSIOLOGY® | THE PLANT CELL | |
|---|---|---|---|