|
|
||||||||
|
First published online September 3, 2004; 10.1104/pp.104.042903 Plant Physiology 136:2862-2874 (2004) © 2004 American Society of Plant Biologists The Pepper Transcription Factor CaPF1 Confers Pathogen and Freezing Tolerance in Arabidopsis1Plant Genomics Laboratory (S.Y.Y., Y.-H.J., S.L., D.C.) and National Center for Genome Information (J.-H.K.), Korea Research Institute of Bioscience and Biotechnology, Yusung, Taejeon 305600, Korea; Department of Agricultural Biology, Chungnam National University, Taejeon 305764, Korea (S.Y.Y., S.H.Y.); and Department of Biology, Yonsei University, Seoul 120749, Korea (W.-T.K.)
An ERF/AP2-type transcription factor (CaPF1) was isolated by differential-display reverse transcription-PCR, following inoculation of the soybean pustule pathogen Xanthomonas axonopodis pv glycines 8ra, which induces hypersensitive response in pepper (Capsicum annuum) leaves. CaPF1 mRNA was induced under conditions of biotic and abiotic stress. Higher levels of CaPF1 transcripts were observed in disease-resistant tissue compared with susceptible tissue. CaPF1 expression was additionally induced using various treatment regimes, including ethephon, methyl jasmonate, and cold stress. To determine the role of CaPF1 in plants, transgenic Arabidopsis and tobacco (Nicotiana tabacum) plants expressing higher levels of CaPF1 were generated. Gene expression analyses of transgenic Arabidopsis and tobacco revealed that the CaPF1 level in transgenic plants affects expression of genes that contain either a GCC or a CRT/DRE box in their promoter regions. Furthermore, transgenic Arabidopsis plants expressing CaPF1 displayed tolerance against freezing temperatures and enhanced resistance to Pseudomonas syringae pv tomato DC3000. Disease tolerance was additionally observed in CaPF1 transgenic tobacco plants. The results collectively indicate that CaPF1 is an ERF/AP2 transcription factor in hot pepper plants that may play dual roles in response to biotic and abiotic stress in plants.
During their life cycle, plants have to deal with various environmental stress conditions. Biotic and abiotic stress factors cause adverse effects on the growth and productivity of crops. To adjust to changes in the environment, plants trigger rapid defense responses via a number of signal transduction pathways. A major target of signal transduction is the cell nucleus, where terminal signals lead to the transcriptional activation of numerous genes. Alterations in the expression of genes coding for transcription regulators greatly influence plant stress tolerance. In Arabidopsis, a number of transcription factor families, each containing a distinct type of DNA-binding domain, such as ERF/AP2, bZIP/HD-ZIP, Myb, WRKY, and several classes of zinc-finger domains, have been implicated in plant stress responses in view of the finding that their expression is induced or repressed under different stress conditions (Rushton and Somssich, 1998
Common regulatory components, including phytohormones, are involved in separate signaling pathways. Salicylic acid (SA), ethylene (ET), and jasmonic acid (JA) possibly act as secondary signals following pathogen attack and enhance the expression of many pathogen-responsive genes (Yang et al., 1997 Here, we report the characterization of cDNA encoding new pepper ERF, CaPF1 (Capsicum annuum pathogen and freezing tolerance-related protein 1), which binds to both GCC and CRT/DRE cis-elements. The GCC box and CRT/DRE element have similar core sequences, which are implicated in the activation of different signal transduction pathway-related genes. The issue of whether CaPF1 activates two distinct sets of genes that contain the GCC and/or CRT/DRE element in their promoter region and participates in two different stress tolerance events was investigated. In this article, we elucidate the function of this novel ERF, which may contribute to understanding the molecular mechanisms of cross-talk between biotic and abiotic stress signaling pathways.
Expression of CaPF1 during the Hypersensitive Response of Hot Pepper
During the selection of non-host resistance hypersensitive response (HR)-induced genes in pepper leaves using mRNA differential-display reverse transcription-PCR, we isolated a CaPF1 cDNA fragment with amino acid similarity to other functionally characterized ERF/AP2 family proteins. We examined whether cDNA expression was induced upon pathogen attack. Young pepper leaves (cv Bugang) were syringe infiltrated with a suspension containing either the soybean pustule pathogen Xanthomonas axonopodis pv glycines 8ra (Xag 8ra) or 1 mM MgCl2 as a control. Non-host HR was noted 18 h after inoculation with Xag 8ra. As shown in Figure 1A, CaPF1 mRNA was induced in both HR and non-HR tissue. However, the abundance and period of the induction were higher and longer, respectively, in HR-occurring tissues. To determine the specificity of CaPF1 in response to HR, we analyzed expression following host resistance-induced HR. Leaves of pepper cultivars ECW-20R (BS2/BS2) and ECW (bs2/bs2) were syringe infiltrated with the pepper bacterial spot pathogen Xanthomonas campestris pv vesicatoria race 3 (Xcv race3), which expresses the avrBS2 gene. Total RNA was extracted from inoculated leaves at different times after infection, and CaPF1 expression was analyzed by northern blotting. Susceptible pepper (cv ECW) infiltrated with Xcv race3 did not exhibit any visible responses until 36 h after infiltration, whereas resistant pepper (cv ECW-20R) developed HR lesions on infiltrated leaf tissues within 24 h (data not shown). Stronger CaPF1 expression was detected in incompatible interactions, while only mild expression was detected in compatible interactions (Fig. 1B). Pepper pathogenesis-related protein 4b (C.J. Park et al., 2001
These findings indicate that the CaPF1 expression observed after infection with the HR-inducible bacterial pathogen is consistent and associated with incompatible plant-pathogen interactions.
To isolate full-length cDNA, a partial cDNA fragment with sequence similarity to ERF/AP2 family proteins was used as a probe to screen a cDNA library previously constructed from C. annuum (S.Y. Yi, S.H. Yu, and D. Choi, unpublished data). Twelve positive clones were isolated and further analyzed by restriction enzyme digestion and DNA sequencing, resulting in the identification of seven clones with 1.4-kb cDNA inserts. Among these, 5 clones encoded a predicted full-length protein with an open reading frame of 369 amino acids and molecular mass of 41 kD. Nucleotide and protein database searches reveal that the CaPF1 protein contains a 57-amino acid region that constitutes a DNA-binding ERF/AP2 domain, which is highly conserved in members of the ERF/AP2 family of plant transcription factors. CaPF1 contains short clusters of basic residues similar to known nuclear localization sequences (for review, see Dingwall and Laskey, 1991
To explore further the evolutionary distance among the ERF/AP2 proteins, AP2 domains from different plant species that have relatively high amino acid sequence similarity with CaPF1 were subjected to construct phylogenic tree using the PhyloDraw program (version 0.8; Fig. 2A). Phylogenetic analysis with ERF/AP2 domain indicated that the CaPF1 is most similar to previously described ERF class B-2 subgroup (RAP2.3, RAP2.2, and RAP2.12; Sakuma et al., 2002
Genomic DNA isolated from pepper was digested with DraI, EcoRI, HindIII, or XbaI. The blot was hybridized to radioactively labeled CaPF1 cDNA (full length) or the 3' end fragment. Four to five fragments were detected with the CaPF1 full-length cDNA probe, while only a single band hybridized to the 3' end-specific probe (data not shown). This restriction pattern strongly suggests that the pepper genome contains a single copy of the CaPF1 gene, which belongs to a gene family. Tissue-specific expression of CaPF1 mRNA was analyzed by northern blotting in eight different tissues. The CaPF1 transcript was less abundant in dormant seeds than germinating seeds (data not shown). Lower levels of CaPF1 transcripts were detected in leaves and seedlings, whereas higher levels of transcripts were detected in floral organs and stem.
Ethylene plays important roles in a number of plant stress responses (including response to pathogens) and the expression of ERF genes, including ERF1 and AtERF1 (Solano et al., 1998
Similar to ET, SA, and methyl jasmonate (MJ) are important phytohormones involved in signaling in response to pathogen infections. To determine the possible involvement of the CaPF1 gene in SA and MJ signaling pathways, we examined mRNA expression after treatment with these hormones. As shown in Figure 3A, expression of CaPF1 mRNA was detected following treatment with MJ but not SA. The levels of MJ-regulated hot pepper proteinase inhibitor II (PinII) and SA-inducible pathogenesis-related protein I (PR1) genes (Lee et al., 2002
We additionally examined the expression of CaPF1 mRNA, following challenge with abiotic stress. The pepper dehydrin gene (Chung et al., 2003
The observed CaPF1 expression in diverse stress conditions signifies that the protein may function in the activation of numerous stress-responsive genes through binding to one or two cis-acting elements. To test this hypothesis, binding specificity of the CaPF1 protein to known ERF/AP2 factor-binding sequences, GCC box and CRT/DRE cis-element, was evaluated. The entire coding region of CaPF1 was expressed in Escherichia coli by translational fusion with a maltose-binding protein (MBP), and an electrophoretic mobility shift assay was performed. The MBP-CaPF1 fusion protein bound both the GCC-box sequence, and the CRT/DRE cis-element (Fig. 4). To determine the binding specificities, we performed a competition assay by adding unlabeled GCC box and CRT/DRE cis-element to the mobility shift assay. This led to decreased binding of MBP-CaPF1 to the labeled GCC box and CRT/DRE cis-element. Moreover, 50-fold excess of unlabeled GCC box and CRT/DRE DNA resulted in complete loss of binding of the labeled sequences to the MBP-CaPF1 protein. The addition of unlabeled CRT/DRE cis-element DNA (50x) to the binding assay decreased MBP-CaPF1 binding to labeled GCC-box DNA. However, addition of 5-fold excess of unlabeled GCC-box DNA resulted in complete loss of binding of the labeled CRT/DRE cis-element DNA to MBP-CaPF1 (Fig. 4). From these results, we conclude that the CaPF1 binds competitively to both the GCC box and CRT/DRE cis-element. Furthermore, binding specificity is higher with a combination of MBP-CaPF1 and GCC.
Overexpression of CaPF1 in Arabidopsis Affects Expression of PR and COR Genes
ERF/AP2s are unique to the plant kingdom and have been characterized in different plants, including Arabidopsis, tomato, soybean, and tobacco. They all possess a number of features in common, such as induction by biotic and abiotic stresses and mediation of the expression of GCC box or CRT/DRE box-containing genes such as PDF1.2 in Arabidopsis. Because pepper is a very recalcitrant species in terms of genetic transformation (Li et al., 2000
To evaluate the role of ectopically expressed CaPF1 in stress-responsive gene expression of transgenic Arabidopsis, northern-blot analysis was performed using genes containing the GCC box (PDF 1.2) and CRT/DRE element (COR47, COR6.6, and COR78/RD29) in their promoter regions as probes. All the genes tested were constitutively expressed in selected transgenic Arabidopsis lines. Earlier studies show that the expression of PDF1.2 and GST genes in Arabidopsis is dependent on the functions of the JA and ET signaling pathways (Zhou and Goldsbrough, 1993
CaPF1 Overexpression Confers Tolerance to Pathogens and Freezing in Transgenic Plants As shown in Figure 5, the expression of CaPF1 in Arabidopsis led to constitutive expression of the stress-related genes. This raised the possibility that stress tolerance is activated in these plants. The CaPF1 plants were first tested in disease tolerance. Three CaPF1 T3 generation transgenic Arabidopsis lines (lines 3, 8, and 22) were tested for resistance against P. syringae pv tomato DC3000 that infects wild-type Arabidopsis Col-0. Leaf bacterial numbers were determined at 0, 3, and 5 d after inoculation. All three plants displayed reduced disease lesion and leaf bacterial numbers compared with the control plant. At 3 d postinoculation, the overexpression of CaPF1 reduces bacterial numbers by 5- to 10-fold (data not shown). As depicted in Figure 6B, 10- to 100-fold reduction in bacterial numbers were detected at 5 d after inoculation in CaPF1 transgenic leaves compared with empty vector-transformed control plants. To confirm the role of CaPF1 in disease tolerance, transgenic tobacco plants were also generated. Tobacco plants were transformed with the same vector construct used in Arabidopsis study. From 16 independent transgenic lines conformed by northern- and Southern-blot analysis with the transgene probe, 7 lines (lines 2, 3, 6, 9, 12, 13, and 19) with a single insertion of the transgene were selected for further analyses. We observed that all selected seven transgenic lines (T0 progenies of CaPF1 transgenic tobacco plants; lines 2, 3, 6, 9, 12, 13, and 19) constitutively expressed pathogenesis-related genes, such as PR2, 3, 4, and 5, in absence of pathogen attack (Fig. 7A). Next, we tested for resistance of transgenic tobacco plants (lines 2, 3, and 6) against P. syringae pv tabaci that infects wild-type tobacco. All three transgenic tobacco lines displayed reduced lesions and leaf bacterial numbers compared with control plants transformed with empty vector (Fig. 7, B and C).
For the freezing tolerance test, transgenic (lines 3 and 8) and control Arabidopsis plants were grown in soil at 25°C for 3 weeks. Plants were transferred to 6°C for 24 h and returned to a 25°C growth chamber for 1 week. As a result of two independent experiments, 65% of CaPF1 transgenic Arabidopsis survived. In the same condition, only 17% of nontransgenic Arabidopsis survived (Fig. 8A). To quantify the increase in freezing tolerance, electrolyte leakage was measured following freezing treatment. Electrolyte leakage from frozen and thawed tissues is a sensitive indicator of loss of integrity of the plasmalemma and has been commonly used to assay freezing injury (for review, see Calkins and Swanson, 1990
These results indicate that overexpression of CaPF1 confers disease and freezing tolerance in transgenic plants, presumably via activation of the signaling pathway that involves the expression of PR and COR genes.
ERF factors are a subfamily of ERF/AP2 transcription factor that is only present in the plant kingdom. In Arabidopsis, 124 ERF proteins were annotated (Riechmann et al., 2000
CaPF1 contains a highly conserved ERF domain. However, outside the ERF domain, little sequence similarity exists between CaPF1 and other known ERF proteins (Fig. 2). In vitro sequence-specific DNA-binding activity of ERF domain-containing proteins is well documented. ERF proteins and Pti5 and 6 specifically interact with GCC boxes present in the promoter regions of PR genes (Ohme-Takagi and Shinshi, 1995
JERF1 (AY044235) and NtDRF1 (AY286010) have the most similarity in amino acid sequence of CaPF1 protein. Interestingly, the three ERFs (CaPF1, JERF1, and NtDRF1) contain a novel, highly conserved N-terminal motif of unknown function (MCGGAIISD; Fig. 2B). Tournier et al. (2003)
ERF family of genes plays various roles in plant growth, development, and response to different environmental stress factors (Okamuro et al., 1997
CaPF1 transcripts are up-regulated during an incompatible interaction between pepper and bacterial pathogens (Fig. 1). One possible role of CaPF1 in response to pathogens is the orchestration of the correct temporal response in defense-related gene expression. In plants, pathogen infection generates multiple defense-response signaling pathways. One is mediated by SA, which culminates in the activation of pathogenesis-related protein genes. Signaling through the synergistic action of JA and ET is also involved in stress responses of plants and operates in a SA-independent fashion. The JA/ET pathway involves the induction of PR3, PR4, and PDF1.2 (Moller and Chua, 1999
The CaPF1 transcript level is not responsive to ABA (Fig. 3A), like other ERF/AP2-type transcription factors (Liu et al., 1998
The hypothesis that CaPF1 may play a role in biotic/abiotic stress resistance in plants is supported by the results of CaPF1-overexpressing transgenic Arabidopsis and tobacco plants. Overexpression of CaPF1 resulted in constitutive overexpression of stress-related genes such as PR and COR and stress tolerance under normal growth condition. It has been reported that overexpression of the Pti4, an ERF/AP2-type factor of tomato, in Arabidopsis activated the expression of GCC box-containing PR genes and exhibited increased resistance against pathogens (Gu et al., 2002
Recent studies in molecular and genomic analyses on the complex cascades of gene expression in abiotic stress response identified specificity and cross-talk in stress signaling (Shinozaki and Yamaguchi-Shinozaki, 2000
Isolation of CaPF1 cDNA and Sequence Analysis
The hot pepper (Capsicum annuum) cDNA library was constructed from mRNA prepared from 8-week-old plants inoculated with Xanthomonas axonopodis pv glycines and screened with a random prime-labeled CaPF1 differential-display reverse transcription-PCR fragment (421 bp) as a probe. Plaques (5 x 104) were screened at 42°C using the hybridization and washing conditions described by Choi et al. (1996)
Arabidopsis (ecotype Colombia) and tobacco plants (Nicotiana tabacum cv Xanthi nc) were grown in a chamber (16 h of light and 8 h of darkness at 25°C). For growth under sterile conditions, Arabidopsis and tobacco seeds were surface-sterilized with 70% ethanol for 15 min, washed three times in sterile water, and grown on Murashige and Skoog (DUCHEFA, Haarlem, The Netherlands) medium. To determine temporal expression of the CaPF1 gene during bacterial pathogen inoculation or chemical (ethephon, MJ, SA, and ABA) treatment, treated pepper leaf samples were collected as described in previous procedures (Lee et al., 2002
Genomic DNA was isolated from mature leaves of pepper cv Bugang as described in a previous report (Choi et al., 1996
The coding region of CaPF1 was cloned into pMAL (New England Biolabs, Beverly, MA) and expressed in Escherichia coli BL21 cells (Amersham Pharmacia). A MBP-CaPF1 fusion protein was purified using amylose resin, according to the manufacturer's instructions (New England Biolabs).
For the electrophoretic mobility shift assay, both strands of the following oligonucleotides were synthesized for the GCC box (ATAAGAGCCGCCACTAAAAT; Ohme-Takagi and Shinshi, 1995
CaPF1 full-length cDNA was constructed into a polylinker site of a binary vector, pMBP-1, a derivative of pBI121, in the sense orientation. Constructs were introduced into Agrobacterium tumefaciens strain C58C1. Arabidopsis plants used for transformation were grown in 8-cm pots filled with soil at 25°C for 5 weeks and transformed by vacuum infiltration, as described by Bechtold and Pelletier (1998)
Electrolyte leakage tests were performed essentially as described (Warren et al., 1996 Sequence data from this article have been deposited with the EMBL/GenBank data libraries under accession number AY246274. Received March 17, 2004; returned for revision May 31, 2004; accepted May 31, 2004.
1 This work was supported by grants from the Plant Diversity Research Center, Crop Functional Genomics Center of the 21st Century Frontier Research Program funded by the Ministry of Science and Technology and the Plant Molecular Genetics and Breeding Research Center through the Korea Science and Engineering Foundation. Article, publication date, and citation information can be found at www.plantphysiol.org/cgi/doi/10.1104/pp.104.042903. * Corresponding author; e-mail doil{at}kribb.re.kr; fax 82428604309.
Bechtold N, Pelletier G (1998) In planta Agrobacterium-mediated transformation of adult Arabidopsis thaliana plants by vacuum infiltration. Methods Mol Biol 82: 259266[Medline]
Buttner M, Singh KB (1997) Arabidopsis thaliana ethylene-responsive element binding protein (AtEBP), an ethylene-inducible, GCC box DNA-binding protein interacts with an ocs element binding protein. Proc Natl Acad Sci USA 94: 59615966 Calkins JB, Swanson BT (1990) The distinction between living and dead plant tissue-viability tests in cold hardiness research. Cryobiology 27: 194211
Chen W, Provart NJ, Glazebrook J, Katagiri F, Chang HS, Eulgem T, Mauch F, Laun S, Zou G, Whitham SA, et al (2002) Expression profile matrix of Arabidopsis transcription factor genes suggests their putative functions in response to environmental stresses. Plant Cell 14: 559574 Choi D, Kim HM, Yun HK, Park JA, Kim WT, Bok SH (1996) Molecular cloning of a metallothionein-like gene from Nicotiana glutinosa L. and its induction by wounding and tobacco mosaic virus infection. Plant Physiol 112: 353359[Abstract] Chung E, Kim SY, Yi SY, Choi D (2003) Capsicum annuum dehydrin, an osmotic-stress gene in hot pepper plants. Mol Cells 15: 327332[Medline]
Church GM, Gilbert W (1984) Genomic sequencing. Proc Natl Acad Sci USA 81: 19911995 Dingwall C, Laskey RA (1991) Nuclear targeting sequencesa consensus? Trends Biochem Sci 16: 478481[CrossRef][Web of Science][Medline]
Durrant WE, Rowland O, Piedras P, Hammond-Kosack KE, Jones JDG (2000) cDNA-AFLP reveals a striking overlap in race-specific resistance and wound response gene expression profile. Plant Cell 12: 963977
Fujimoto SY, Ohta M, Usui A, Shinshi H, Ohme-Takagi M (2000) Arabidopsis ethylene responsive-element binding factors act as transcriptional activators or repressors of GCC box mediated gene expression. Plant Cell 12: 393404
Gu YQ, Wildermuth MC, Chakravarthy S, Loh YT, Yang C, He X, Han Y, Martin GB (2002) Tomato transcription factors pti4, pti5, and pti6 activate defense responses when expressed in Arabidopsis. Plant Cell 14: 817831 Jaglo-Ottosen KR, Gilmour SJ, Zarka DG, Schabenberger O, Thomashow MF (1998) Arabidopsis CBF1 overexpression induces COR genes and enhances freezing tolerance. Science 3: 104106 Kasuga M, Liu Q, Miura S, Yamaguchi-Shinozaki K, Shinozaki K (1999) Improving plant drought, salt, and freezing tolerance by gene transfer of a single stress-inducible transcription factor. Nat Biotechnol 17: 287291[CrossRef][Web of Science][Medline] Kizis D, Lumbreras V, Pages M (2001) Role of AP2/EREBP transcription factors in gene regulation during abiotic stress. FEBS Lett 498: 187189[CrossRef][Web of Science][Medline] Lee SJ, Lee MY, Yi SY, Oh SK, Choi SH, Her NH, Choi D, Min BW, Yang SG, Harn CH (2002) PPI1: a novel pathogen-induced basic region-leucine zipper (bZIP) transcription factor from pepper. Mol Plant Microbe Interact 15: 540548[Medline] Li D, Xie B, Zhang B, Zhao K, Luo K (2000) The current problems and the solution for pepper disease-resistant gene engineering (in Chinese). Acta Hortic Sin 27(Suppl): 509514
Liu Q, Kasuga M, Sakuma Y, Abe H, Miura S, Yamaguchi-Shinozaki K, Shinozaki K (1998) Two transcription factors, DERB1 and DREB2, with an EREBPERF/AP2 DNA binding domain separate two cellular signal transduction pathways in drought- and low-temperature-responsive gene expression, respectively, in Arabidopsis. Plant Cell 10: 13911406 Moller SG, Chua NH (1999) Interactions and intersections of plant signaling pathways. J Mol Biol 22: 219234 Ohme-Takagi M, Shinshi H (1995) Ethylene inducible DNA binding proteins that interact with an ethylene-responsive element. Plant Cell 7: 173182[Abstract]
Okamuro JK, Caster B, Villarroel R, Montagu M, Jofuku KD (1997) The AP2 domain of APETALA2 defines a large new family of DNA binding proteins in Arabidopsis. Proc Natl Acad Sci USA 94: 70767081 Park CJ, Shin R, Park JM, Lee GJ, Yoo TH, Paek KH (2001) A hot pepper cDNA encoding a pathogenesis-related protein 4 is induced during the resistance response to tobacco mosaic virus. Mol Cells 28: 122127
Park JM, Park CJ, Lee SB, Ham BK, Shin R, Paek KH (2001) Overexpression of the tobacco Tsi1 gene encoding an EREBPERF/AP2-type transcription factor enhances resistance against pathogen attack and osmotic stress in tobacco. Plant Cell 13: 10351046 Penninckx IA, Eggermont K, Terras FR, Thomma BP, De Samblanx GW, Buchala A, Metraux JP, Manners JM, Broekaert WF (1996) Pathogen-induced systemic activation of a plant defensin gene in Arabidopsis follows a salicylic acid-independent pathway. Plant Cell 8: 23092323[Abstract]
Penninckx IA, Thomma BP, Buchaala A, Metraux JP, Broekaert WF (1998) Concomitant activation of jasmonate and ethylene response pathways is required for induction of a plant defensin gene in Arabidopsis. Plant Cell 10: 21032113 Richard S, Morency M-J, Drevet C, Jouanin L, Seguin A (2000) Isolation and characterization of a dehydrin gene from white spruce induced upon wounding, drought and cold stresses. Plant Mol Biol 43: 110[CrossRef][Web of Science][Medline]
Riechmann JL, Martin JH, Leuber L, Jiang CZ, Keddie J, Adam L, Pineda O, Ratcliffe OJ, Samaha RR, Creelman R, et al (2000) Arabidopsis transcription factors: genome-wide comparative analysis among eukaryotes. Science 290: 21052110 Rushton PJ, Somssich IE (1998) Transcriptional control of plant genes responsive to pathogens. Curr Opin Plant Biol 1: 311315[CrossRef][Web of Science][Medline] Sakuma Y, Liu Q, Dubouzet JG, Abe H, Shinozaki K, Yamaguchi-Shinozaki K (2002) DNA-binding specificity of the ERF/AP2 domain of Arabidopsis DREBs, transcription factors involved in dehydration- and cold-inducible gene expression. Biochem Biophys Res Commun 25: 9981009 Sambrook J, Fritrsch EF, Maniatis T (1989) Molecular Cloning: A Laboratory Manual, Ed 2. Cold Spring Harbor Laboratory Press, Plainview, NY
Schenk PM, Kazan K, Wilson I, Anderson JP, Richmond T, Somerville SC, Manners JM (2000) Coordinated plant defense responses in Arabidopsis revealed by microarray analysis. Proc Natl Acad Sci USA 97: 1165511660
Seki M, Narusaka M, Abe H, Kasuga M, Yamaguchi-Shinozaki K, Carnici P, Hayashizaki Y, Shinozaki K (2001) Monitoring the expression pattern of 1300 Arabidopsis genes under drought and cold stress by using a full-length cDNA microarray. Plant Cell 13: 6172 Shinozaki K, Yamaguchi-Shinozaki K (2000) Molecular responses to dehydration and low temperature: differences and cross talk between two stress signaling pathways. Curr Opin Plant Biol 3: 217223[Web of Science][Medline] Shinozaki K, Yamaguchi-Shinozaki K, Seki M (2003) Regulatory network of gene expression in the drought and cold stress responses. Curr Opin Plant Biol 6: 410417[CrossRef][Web of Science][Medline] Singh KB, Foley RC, Onate-Sanchez L (2002) Transcription factors in plant defense and stress responses. Curr Opin Plant Biol 5: 430436[CrossRef][Web of Science][Medline]
Solano R, Stepanova A, Chao Q, Ecker JR (1998) Nuclear events in ethylene signaling: a transcriptional cascade mediated by ETHYLENE-INSENSITIVE3 and ETHYLENE-RESPONSE-FACTOR1. Genes Dev 12: 37033714
Stockinger EJ, Gilmour SJ, Thomashow MF (1997) Arabidopsis thaliana CBF1 encodes an AP2 domain-containing transcriptional activator that binds to the C-repeat/DRE, a cis-acting DNA regulatory element that simulates transcription in response to low temperature and water deficit. Proc Natl Acad Sci USA 94: 10351040 Thilmony RL, Chen Z, Bressan RA, Martin GB (1995) Expression of the tomato Pto gene in tobacco enhances resistance to Pseudomonas syringae pv. tabaci expressing avrPto. Plant Cell 7: 15291536[Abstract] Thomashow MF (1999) Plant cold acclimation: freezing tolerance genes and regulatory mechanisms. Annu Rev Plant Physiol Plant Mol Biol 50: 571599[CrossRef][Web of Science] Tournier B, Sanchez-Ballesta MT, Jones B, Pesquet E, Regad F, Latche A, Pech JC, Bouzayen M (2003) New members of the tomato ERF family show specific expression pattern and diverse DNA-binding capacity to GCC box element. FEBS Lett 550: 149154[CrossRef][Web of Science][Medline]
Uknes S, Mauch-Mani B, Moyer M, Potter S, Williams S, Dincher S, Chandler D, Slusarenko A, Ward E, Ryals J (1992) Acquired resistance in Arabidopsis. Plant Cell 4: 645656
Wang KLC, Li H, Ecker JR (2002) Ethylene biosynthesis and signaling network. Plant Cell 14: S131S151 Warren G, McKown R, Marin AL, Teutonico R (1996) Isolation of mutations affecting the development of freezing tolerance in Arabidopsis thaliana (L.) Heynh. Plant Physiol 111: 10111019[Abstract]
Wu K, Tian L, Hollingworth J, Brown DC, Miki B (2002) Functional analysis of tomato Pti4 in Arabidopsis. Plant Physiol 128: 3037 Yamaguchi-Shinozaki K, Shinozaki K (1994) A novel cis-acting element in an Arabidopsis gene is involved in responsiveness to drought, low-temperature, or high-salt stress. Plant Cell 6: 251264[Abstract] Yang HJ, Shen H, Chen L, Xing YY, Wang ZY, Zhang JL, Hong MM (2002) The OsEBP-89 gene of rice encodes a putative EREBP ERF transcription factor and is temporally expressed in developing endosperm and intercalary meristem. Plant Mol Biol 50: 379391[Medline]
Yang Y, Shash J, Klessig DF (1997) Signal perception and transduction in plant defense responses. Genes Dev 11: 16211639 Yi SY, Yu SH, Choi D (1999) Molecular cloning of a catalase cDNA from Nicotiana glutinosa L. and its repression by tobacco mosaic virus infection. Mol Cells 30: 320325 Zhou J, Goldsbrough PB (1993) An Arabidopsis gene with homology to glutathione S-transferases is regulated by ethylene. Plant Mol Biol 22: 517523[CrossRef][Web of Science][Medline] Zhou J, Tang X, Martin GB (1997) The Pto kinase conferring resistance to tomato bacterial speak disease interact with proteins that bind a cis-element of pathogenesis-related genes. EMBO J 16: 32073218[CrossRef][Web of Science][Medline] This article has been cited by other articles:
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ASPB Publications | PLANT PHYSIOLOGY® | THE PLANT CELL | |
|---|---|---|---|