| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
|
First published online October 1, 2004; 10.1104/pp.104.046979 Plant Physiology 136:2900-2912 (2004) © 2004 American Society of Plant Biologists The Central Role of PhEIN2 in Ethylene Responses throughout Plant Development in Petunia1Department of Environmental Horticulture (K.S., K.G.B., H.M.L., B.A.U., D.G.C.) and Department of Horticultural Sciences (H.J.K.), University of Florida, Gainesville, Florida 32611; Plantgenix, Philadelphia, Pennsylvania 19104 (J.A.C.); and Plant Science Institute, Department of Biology, University of Pennsylvania, Philadelphia, Pennsylvania 19104 (S.N., J.R.E.)
The plant hormone ethylene regulates many aspects of growth and development. Loss-of-function mutations in ETHYLENE INSENSITIVE2 (EIN2) result in ethylene insensitivity in Arabidopsis, indicating an essential role of EIN2 in ethylene signaling. However, little is known about the role of EIN2 in species other than Arabidopsis. To gain a better understanding of EIN2, a petunia (Petunia x hybrida cv Mitchell Diploid [MD]) homolog of the Arabidopsis EIN2 gene (PhEIN2) was isolated, and the role of PhEIN2 was analyzed in a wide range of plant responses to ethylene, many that do not occur in Arabidopsis. PhEIN2 mRNA was present at varying levels in tissues examined, and the PhEIN2 expression decreased after ethylene treatment in petals. These results indicate that expression of PhEIN2 mRNA is spatially and temporally regulated in petunia during plant development. Transgenic petunia plants with reduced PhEIN2 expression were compared to wild-type MD and ethylene-insensitive petunia plants expressing the Arabidopsis etr1-1 gene for several physiological processes. Both PhEIN2 and etr1-1 transgenic plants exhibited significant delays in flower senescence and fruit ripening, inhibited adventitious root and seedling root hair formation, premature death, and increased hypocotyl length in seedling ethylene response assays compared to MD. Moderate or strong levels of reduction in ethylene sensitivity were achieved with expression of both etr1-1 and PhEIN2 transgenes, as measured by downstream expression of PhEIL1. These results demonstrate that PhEIN2 mediates ethylene signals in a wide range of physiological processes and also indicate the central role of EIN2 in ethylene signal transduction.
The plant hormone ethylene is involved in a wide range of developmental processes in many plant species (Abeles et al., 1992  ). In Arabidopsis, ethylene signaling is mediated by a complex multicomponent pathway (Kieber, 1997; Guo and Ecker, 2004). ETR1, which encodes a His kinase with homology to bacterial two-component regulators, has been identified as an ethylene receptor (Chang et al., 1993). A total of five ethylene receptor genes have been cloned from Arabidopsis; ETR1, ETR2, ERS1, ERS2, and EIN4 (Hua et al., 1995, 1998; Sakai et al., 1998). Analysis of loss-of-function mutations in multiple receptors has shown that the receptors are negative regulators of ethylene responses (Hua and Meyerowitz, 1998). The receptors are believed to act through CTR1, which is homologous to the Raf family of Ser/Thr kinases and negatively regulates ethylene signaling (Kieber et al., 1993; Huang et al., 2003). Multiple EIN3/EIL (EIN3-like) transcription factors have also been identified in Arabidopsis (Chao et al., 1997). The EIN3 family contains several proteins that bind an ethylene response element in the promoter of a downstream transcription factor, ERF1 (Solano et al., 1998).
An additional component of the ethylene-signaling pathway, EIN2, was isolated from Arabidopsis (Alonso et al., 1999
Recently, Hall and Bleecker (2003) To gain a better understanding of the role of EIN2 in ethylene signaling and responses, we isolated a homolog of the Arabidopsis EIN2 gene from petunia (cv Mitchell Diploid [MD]) and produced transgenic plants with reduced expression of PhEIN2 mRNA. Comparison of PhEIN2 transgenic plants and transgenic plants expressing etr1-1 indicates that PhEIN2 mediates ethylene signals involved in a wide range of physiological processes, including flower senescence, fruit ripening, and adventitious root and root hair formation. Characterization of plants displaying moderate and strong reductions in ethylene sensitivity indicates that both the ethylene receptors and EIN2 share central roles in a wide range of physiological responses.
Isolation of EIN2 cDNA in Petunia
A petunia homolog of the Arabidopsis EIN2 gene was isolated through a combination of reverse transcription (RT)-PCR and RACE. The cDNA, designated PhEIN2 (accession no. AY353249), shares 56% nucleotide identity and 46% amino acid sequence identity (62% similarity) with Arabidopsis EIN2 (Fig. 1). The deduced PhEIN2 peptide shares 38% identity (53% similarity) with rice EIN2 (OsEIN2; Jun et al., 2004
PhEIN2 Transgenic Plants To determine the function of PhEIN2 in ethylene signal transduction, we produced transgenic petunia plants with reduced PhEIN2 expression. Two independent approaches to reduce expression were employed; expression of a sense RNA (PhEIN2-sense) to achieve cosuppression and RNA interference (PhEIN2-RNAi). Seventy-six and 68 independent transgenic lines were produced for the PhEIN2-sense and the PhEIN2-RNAi construct, respectively. Eight lines (11%) of the PhEIN2-sense construct displayed increased flower longevity (more than 2-fold) after ethylene treatment and pollination compared to wild-type (MD) plants in the T0 generation. For PhEIN2-RNAi, 15 lines (22%) displayed increased flower longevity and an additional 8 lines (12%) died prematurely during plant culture. None of the MD or PhEIN2-sense lines displayed premature plant death during culture.
Two homozygous lines, EIN2s-182 and EIN2r-12, which exhibited the greatest flower longevity after ethylene treatment and pollination in the T1 generation, were selected from the PhEIN2-sense and PhEIN2-RNAi lines, respectively. The EIN2r-12 plants showed greater flower longevity compared to the EIN2s-182 plants. Phenotypes of these PhEIN2 transgenic lines were compared to those of two additional transgenic lines, etr-44568 (Wilkinson et al., 1997
PhEIN2 mRNA levels in whole flowers of EIN2s-182 and EIN2r-12 plants were determined by quantitative real-time RT-PCR. The level of PhEIN2 mRNA was decreased to 60% relative to control (MD) in EIN2s-182 flowers, and the level was decreased to 20% relative to control in EINr-12 flowers (Fig. 2A). Furthermore, to analyze whether PhEIN2 expression was greatly reduced in particular tissues, levels of PhEIN2 mRNA in separate flower parts and vegetative tissues were determined. Levels of PhEIN2 mRNA were decreased in most tissues of the transgenic plants, but the degree of reduction varied in different tissues (Fig. 2B). In the EIN2s-182 plants, the PhEIN2 mRNA level was decreased to 40% of control in petal tubes and 46% of control in receptacles, but no reduction was observed in petal limbs. PhEIN2 mRNA was also decreased in ovaries (53% of control) and anthers (46% of control) of EIN2s-182 flowers compared to controls. Levels of the PhEIN2 mRNA were 57%, 47%, and 31% of control in leaves, stems, and roots, respectively, in the EIN2s-182 plants (Fig. 2B). In the EIN2r-12 plants, the PhEIN2 mRNA level was decreased to 36% of control in petal limbs, 41% of control in petal tubes, and 66% of control in receptacles. Levels of the PhEIN2 mRNA were 28%, 30%, and 52% of control in leaves, stems, and roots, respectively, in the EIN2r-12 plants (Fig. 2B). These results indicate that the suppression level of PhEIN2 expression is not uniform in tissues of these transgenic plants, even though transgene expression was driven by the constitutive cauliflower mosaic virus (CaMV) 35S promoter.
In order to determine whether PhEIN2 is regulated by ethylene, detached flowers were treated with ethylene, and mRNA levels in petal limbs and tubes from MD and etr-44568 flowers were determined. Expression of PhEIN2 mRNA was decreased after ethylene treatment in both petal limbs and petal tubes in MD. Two hours of ethylene treatment was sufficient to reduce PhEIN2 expression in both petal limbs and petal tubes (Fig. 3A). However, at least 9 h of ethylene treatment is required to induce irreversible flower senescence in petunia (Underwood, 2003 ). Since levels of PhEIN2 expression were restored after 10 h of treatment, the initial reduction of PhEIN2 expression after 2 h of treatment is likely a quick and temporal response of exposure to a high concentration of ethylene. The levels of PhEIN2 mRNA were 15% and 32% of control in the petal limb and tube, respectively, at 48 h after treatment, when senescence of the petal limb started (Fig. 3A). By contrast, levels of PhEIN2 mRNA were not decreased by ethylene treatment in petals of ethylene-insensitive etr-44568 plants during the course of the experiment (Fig. 3A). These results indicate that PhEIN2 mRNA expression is decreased by exogenous ethylene treatment in petals. To determine whether PhEIN2 expression was affected by ethylene in other tissues, levels of PhEIN2 mRNA were determined in seedlings grown in the presence of 1-aminocyclopropane-1-carboxylic acid (ACC), an ethylene precursor. In contrast to the petal, the expression level of PhEIN2 mRNA was not affected by ACC treatment in seedlings (Fig. 3B). These results suggest that PhEIN2 expression is regulated by ethylene in a tissue-specific manner. However, whether this ethylene-associated decrease in petals is a direct effect of the hormone or simply associated with petal senescence remains to be determined.
Phenotypes of PhEIN2 Transgenic Plants
Induction of PhEIL1 Expression by Exogenous Ethylene in Flowers
Flower Longevity and Fruit Ripening Senescence of petunia flowers is accelerated by exogenous ethylene treatment or pollination through an induction of autocatalytic ethylene biosynthesis (Gilissen and Hoekstra, 1984 ; Tang and Woodson, 1996). Previously ethylene-insensitive etr-44568 petunia plants were shown to have significant delays in flower senescence (Wilkinson et al., 1997). To determine the role of PhEIN2 in flower senescence, flower longevity of the PhEIN2 transgenic plants after exogenous ethylene treatment or pollination was analyzed. MD flowers senesced 2 d after ethylene treatment, whereas the EIN2s-182 flowers exhibited delayed senescence, showing no visible signs of senescence for up to 8 d (Table I; Fig. 5A). The EIN2s-182 plants also displayed delayed flower senescence after pollination. Flowers from these plants senesced after 9 d of pollination, whereas MD flowers senesced after 2 d (Table I). The EIN2r-12 flowers senesced 12 d after ethylene treatment and 14 d after pollination (Table I). Corollas were still turgid, even after the ovaries were fully expanded in these PhEIN2 transgenic plants (Fig. 5B). These results indicate that PhEIN2 is involved in ethylene signaling leading to flower senescence.
The etr-44568 plants displayed delayed flower senescence after ethylene treatment and pollination, as reported previously by Wilkinson et al. (1997) . The etr-56 plants also exhibited increased flower longevity compared to MD, but to a lesser extent than etr-44568. Flower longevity of the EIN2r-12 plants after ethylene treatment and pollination was equivalent to that of etr-44568 and greater than that of EIN2s-182 and etr-56 (Table I). These results indicate that there are intermediate levels of ethylene sensitivity between genotypes for both PhEIN2 and etr1-1 transgenic plants. Petunia fruits usually fully expand by 7 d after pollination, then dry down and dehisce when ripe. Both PhEIN2 transgenic lines and both etr1-1 lines exhibited a significant delay in fruit ripening compared to MD. Fruits of MD plants turned completely brown by 25 d after pollination, whereas fruit ripening of the EIN2r-12 and etr-44568 plants took 31 and 29 d, respectively, to reach the same stage. The EIN2s-182 and etr-56 plants also displayed a significant delay in fruit ripening compared to MD but less than EIN2r-12 and etr-44568 (Table I). These results indicate an involvement of PhEIN2 in ethylene signaling leading to fruit ripening.
Adventitious Root Formation
Seedling Ethylene Response and Root Hair Formation A commonly used assay to measure quantitative ethylene responses is the seedling triple response. Hypocotyl length of dark-grown PhEIN2 and etr1-1 transgenic seedlings was compared to MD in the presence of ACC. Hypocotyl length of MD seedlings was decreased in the presence of increasing concentrations of ACC. In the EIN2r-12, etr-56, and etr-44568 seedlings, hypocotyls were longer compared to MD on higher levels of ACC, indicating reduced sensitivity to ethylene. These three transgenic lines were not significantly different from each other (Fig. 6A), thus indicating that EIN2r-12, etr-56, and etr-44568 seedlings have similar levels of ethylene sensitivity. By contrast, the EIN2s-182 seedlings showed similar responses to MD (Fig. 6A), indicating that the transgene did not reduce ethylene sensitivity at this stage of development. To determine the relationship between the level of ethylene sensitivity and the level of PhEIN2 mRNA, the expression of PhEIN2 mRNA was analyzed in etiolated PhEIN2 seedlings. The level of PhEIN2 mRNA was decreased to 56% of control in EIN2r-12, whereas the level was not decreased significantly in EIN2s-182 (Fig. 6B). These results indicate that there is a correlation between PhEIN2 mRNA levels and ethylene sensitivity in etiolated seedlings. In addition, since even small reduction (50% of control) of PhEIN2 expression altered ethylene sensitivity, the level of PhEIN2 mRNA is likely critical for regulating sensitivity.
In the seedling ethylene response assay, we observed differences in root hair formation among MD and transgenic lines. Root hairs of MD and EIN2s-182 seedlings were induced by 1 µM ACC treatment, and the length of primary roots was shortened. By contrast, root hairs were not induced by 1 µM ACC treatment in EIN2r-12, etr-56, and etr-44568 seedlings (Fig. 7). In etr-56, root hairs were slightly induced on the agar plate containing 1.0 mM ACC (data not shown). These results indicate that PhEIN2 also mediates ethylene signals leading to root hair formation.
Premature Death In the EIN2r-12, etr-44568, and etr-56 lines, 64%, 67%, and 26% of plants, respectively, exhibited premature death during culture of their homozygous progeny. These plants displayed severe wilting of leaves and died during the course of the experiment (Fig. 5 D). Although we observed this premature death at various time points during plant culture, many plants died after transfer of the seedlings to 15-cm pots. We also observed that the percentage of premature death was higher in high temperatures during summertime compared to other seasons (data not shown). Tissue samples from plants that displayed premature death were routinely submitted for pathogen identification to a diagnostic lab and were reported to have either no infection or the gray mold fungus Botrytis cinerea, which is ubiquitous in greenhouses especially on dead or dying tissues. By contrast, none of the MD or EIN2s-182 plants died prematurely during the course of any of these experiments. We have seen that Nr tomato plants also show a significant amount of premature death when they are grown in the field (H. Klee, unpublished data). The premature death observed in the EIN2r-12, etr-56, and etr-44568 lines is likely due to reduced tolerance to abiotic stresses resulting from strong reduction of ethylene sensitivity.
EIN2 has been shown to be essential for ethylene signal transduction in Arabidopsis. It is a particularly interesting and important protein, having been identified in screen for multiple hormone responses (Su and Howell, 1992 ; Fujita and Syono, 1996; Beaudoin et al., 2000). Ethylene is involved in several important developmental processes in many horticultural crop species, but the function of EIN2 has not been examined in these responses. We isolated a petunia homolog of the Arabidopsis EIN2 gene (PhEIN2) and analyzed spatial and temporal regulation of PhEIN2 expression. Furthermore, we produced transgenic lines with reduced PhEIN2 expression and compared these lines to additional transgenic lines expressing Arabidopsis etr1-1 in order to examine the role of PhEIN2 in ethylene signal transduction.
The predicted peptide sequence of PhEIN2 shows high similarity to Arabidopsis EIN2 throughout the protein, with a particularly highly conserved amino acid sequence in the carboxyl terminus (Fig. 1). This region is also conserved in EIN2 proteins of rice (Jun et al., 2004
PhEIN2 mRNA was present at different levels in different tissues (Fig. 2B), indicating that PhEIN2 expression is spatially regulated. In the petal limb and tube of MD plants, PhEIN2 mRNA levels decreased after ethylene treatment (Fig. 3A). This may indicate that feedback inhibition is involved in the regulation of PhEIN2 expression. This result contrasts with results from Arabidopsis and rice, where the expression of EIN2 was not affected by treatment with ethylene (Alonso et al., 1999
To determine the function of PhEIN2 in ethylene responses in petunia, transgenic plants with reduced PhEIN2 expression were produced. We used two different constructs to suppress the PhEIN2 mRNA expression, one for expression of a sense RNA to achieve cosuppression and the other for RNAi. The RNAi construct gave a higher percentage of independent transgenic plants showing reduced ethylene sensitivity in flowers compared to the cosuppression construct. These results indicate that RNAi-mediated gene silencing is more efficient than cosuppression, as shown by Wesley et al. (2001)
It has been shown that ethylene induces flower senescence in petunia (Gilissen and Hoekstra, 1984
The decreased ethylene sensitivity of the EIN2s-182 and EIN2r-12 flowers was also evident in the expression of an ethylene-inducible gene, PhEIL1. PhEIL1 is a petunia homolog of the Arabidopsis EIN3 gene that is downstream of EIN2 in the ethylene-signaling pathway (Chao et al., 1997
Although results on flower longevity and PhEIL1 expression demonstrate a reduction of ethylene sensitivity in flowers of EIN2s-182 plants, the question of whether the 40% reduction of PhEIN2 mRNA relative to MD corresponded to an almost 4-fold increase in flower longevity still remained. To determine whether PhEIN2 mRNA expression was greatly decreased in particular tissues, we analyzed levels of PhEIN2 in separate flower parts. In EIN2s-182, the PhEIN2 mRNA level was decreased 60% compared to MD in the petal tube, whereas the mRNA level was not decreased in the petal limb. Interestingly, the reduction of PhEIN2 mRNA in the petal tube of EIN2r-12, which showed a greater delay in flower senescence than EIN2s-182, was almost the same as that of EIN2s-182. However, in EIN2r-12 plants, the expression level was decreased to 36% relative to MD in the petal limb. These results suggest that a decrease of PhEIN2 mRNA in the petal tube is sufficient to delay flower senescence, and a decrease in the petal limb gives additional longevity to flowers. It has been suggested that the ethylene produced from pistils triggers ethylene production in petals after pollination (Tang and Woodson, 1996
Transgenic plants with reduced PhEIN2 expression and etr1-1 transgenic plants also showed a delay in fruit ripening compared to MD, with a greater delay in EIN2r-12 and etr-44568 plants compared to EIN2s-182 and etr-56 plants (Table I). It is well known that ethylene induces and accelerates fruit ripening in many plant species that produce fleshy fruits such as tomato (Abeles et al., 1992
Ethylene-insensitive phenotypes were also observed in vegetative tissues of the transgenic lines. Adventitious root formation of vegetative cuttings was inhibited in EIN2r-12 plants as strongly as in etr-44568. It has been previously shown that the ethylene-insensitive etr-44568 petunia and Nr tomato plants produce fewer adventitious roots than wild-type plants (Clark et al., 1999 In the seedling ethylene response assay, EIN2r-12 seedlings exhibited strong ethylene insensitivity equivalent to etr-44568 (Fig. 6A). Although EIN2s-182 plants showed a significant reduction of ethylene sensitivity in flowers and fruits, their seedlings did not exhibit a reduction of ethylene sensitivity (Fig. 6A). However, in the EIN2s-182 seedlings, the PhEIN2 mRNA level was not decreased compared to MD (Fig. 6B). This nonuniform suppression of PhEIN2 expression in different tissues is likely due to a positional effect of the transgene.
Overall, EIN2r-12 plants displayed a strong reduction of ethylene sensitivity equivalent to etr-44568 plants in flower senescence, fruit ripening, adventitious root and root hair formation, and seedling ethylene response assay. Since the transgenic plants with reduced PhEIN2 expression exhibited similar phenotypes to the transgenic plants with manipulated ethylene signaling at the level of the receptor, all signals from ethylene receptors regulating these responses are likely mediated through EIN2 in petunia. The EIN2s-182 and etr-56 plants also displayed phenotypes associated with reduced ethylene sensitivity. However, the severity of phenotypes varied in different responses. For example, these two lines showed a similar delay in fruit ripening, but EIN2s-182 plants produced adventitious roots and etr-56 plants did not. These results indicate that the level of ethylene sensitivity required for a certain response may be different or there may be a threshold of ethylene sensitivity that lies between EIN2s-182 and etr-56 for some of the responses measured here. It is also possible that the difference in these ethylene responses is due to the different levels of transgene expression in different tissues. Partial reductions (60% reduction from control) in PhEIN2 levels caused a great reduction of ethylene sensitivity in flower senescence and seedling ethylene response assay. This suggests that EIN2 must be limiting to signal transduction and also indicates that temporal and spatial regulation of PhEIN2 expression in flowers is responsible for regulation of ethylene sensitivity during senescence. Guo and Ecker (2003)
Manipulation of ethylene responses may be useful for production of high-quality crops with long-lasting flowers or fruits with long shelf life. The Arabidopsis etr1-1 gene has been used to alter ethylene sensitivity in petunia and tomato (Wilkinson et al., 1997
Transgenic plants with reduced PhEIN2 mRNA expression displayed reduced ethylene sensitivity in a wide range of physiological processes, indicating an essential role for PhEIN2 in ethylene signal transduction throughout plant development in petunia. Guo and Ecker (2003)
Plant Material and Treatment Petunia x hybrida cv Mitchell Diploid (MD; wild type) and transgenic plants were grown under standard greenhouse conditions in commercial potting medium (Fafard 2B; Fafard, Apopka, FL) in 15-cm pots and fertilized at each irrigation with 150 mg L–1 Scott's Excel 15-5-15 (Scotts, Marysville, OH). Flower and vegetative tissues were harvested on the day before anthesis, frozen in liquid nitrogen, and stored at –80°C. For the ethylene treatment, detached flowers were placed in vials of water and then sealed in a glass container containing 2 µL L–1 ethylene for 2, 10, 24, 36, and 48 h under continuous fluorescent light at 20°C to 23°C. For the ACC (Sigma, St. Louis) treatment, MD seeds were surface sterilized with 1.2% sodium hypochlorite for 10 min, rinsed three times in sterile water, and then plated on 0.5x Murashige and Skoog media, pH 5.6, containing 0.8% agar with 0, 1, 10, and 100 mM ACC in a Phytatray II (Sigma). Seeds were incubated under fluorescent light (16-h light/8-h dark) at 24°C for 7 d.
For cloning of the petunia EIN2 cDNA (PhEIN2) by RT-PCR, RNA was extracted from leaves, according to the method of Ciardi et al. (2000)
Total RNA was extracted using an RNeasy plant mini kit (Qiagen, Valencia, CA) and treated with RNase-Free DNase (Qiagen). Quantitative real-time RT-PCR was performed on 250 ng of total RNA in a 25-µL reaction volume using TaqMan Reverse Transcription Reagents and SYBR Green PCR Core Reagents (Applied Biosystems, Foster City, CA) in an Applied Biosystems GeneAmp 5700 sequence-detection system. Reactions were repeated twice with one set of RNAs and once with RNA collected from separate, duplicate tissue. The primers designed with primer express software (Applied Biosystems) for PhEIN2 were: forward primer, TGTGTTTTTCTGGCTGCAACTG; reverse primer, GCACTGCCATTGTCCAAGAGA. The primers for PhEIN2 were designed for the 5' region of PhEIN2 that the constructs for transformation did not contain. The final concentration of each primer was 300 nM. RT-PCR conditions were 48°C for 30 min, 95°C for 10 min, followed by 40 cycles of 95°C for 15 s and 60°C for 1 min. Sense-strand RNA, synthesized as described in Tieman et al. (2001)
Two sets of three flowers were detached on the day before anthesis and treated with 0.01, 0.1, 1, and 10 µL L–1 ethylene for 4 h. For control, solid KMnO4 was added to a glass container to remove ethylene emitted by the flowers. Quantitative real-time RT-PCR was performed as described above. The primers for PhEIL1 were: forward primer, GCCTTTTCCATCTCCACTTACTATTG; reverse primer, TGGATATCAAGCCCCAAATTAAA. The primers for PhEIL1 were designed for the 3' untranslated region of PhEIL1. Specificity of the primer sets was verified by performing PCR eactions with an in vitro transcribed PhEIL2 and PhEIL3 template.
Transgenic plants containing one of two different constructs, one for expression of a sense RNA (PhEIN2-sense) to achieve cosuppression and the other for RNA interference (PhEIN2-RNAi), were produced. For the PhEIN2-sense construct, a 1.1-kb segment of the PhEIN2 cDNA spanning nucleotides 2,824 to 3,940 was cloned into a vector downstream from a CaMV 35S promoter and upstream of the Agrobacterium nopaline synthase terminator region in the sense orientation. For the PhEIN2-RNAi construct, a 1.0-kb fragment spanning bases 3,250 to 4,250 and a 450-bp fragment spanning bases 3,800 to 4,250 of the PhEIN2 cDNA were cloned into pBluescript SK+ (Stratagene, La Jolla, CA) in sense and antisense orientation, respectively. The RNAi construct was cloned downstream of the CaMV 35S promoter and upstream of the nopaline synthase terminator. These sense expression and RNAi constructs were then cloned into a binary transformation vector containing a gene for kanamycin resistance (NPTII). The transformation vector was transferred to Agrobacterium ABI through triparental mating. Petunia plants (MD) were transformed with these constructs, according to the methods of Jorgensen et al. (1996) Plants that died during the course of the experiment were scored as exhibiting premature death. Tissue samples from plants that showed premature were death were sent to the Doyle Conner Diagnostic Lab (Gainesville, FL) to identify any potentially lethal pathogens.
To measure flower senescence induced by ethylene, three flowers were removed from each of 24 plants (72 flowers in total per genotype) for MD and transgenic lines on the day before anthesis and placed in vials of water. The flowers were then sealed in a glass container and treated with 2 µL L–1 ethylene for 16 h. The flowers were then placed in a growth room under continuous fluorescent light at 20°C to 23°C, and the day on which the flowers completely wilted was recorded. To measure flower longevity after pollination, 3 flowers from each of 24 plants (72 flowers in total per genotype) for MD and each transgenic line were self-pollinated on the plant on the day before anthesis, and the number of days to wilting was recorded. To determine the period of fruit ripening, 3 flowers each from 24 plants (72 flowers in total per genotype) for MD and each transgenic line were self-pollinated, and the number of days until the seed pods had turned completely brown was recorded. Data were analyzed using the ANOVA function of SAS 8.02 (Cary, NC) to compare differences among genotypes. Tukey's honestly significant difference mean-separation test was the procedure used for mean separation at the 0.05% level (HSD0.05).
Vegetative stem cuttings were taken from approximately 8-week-old MD, EIN2s-182, EIN2r-12, etr-56, and etr-44568 plants. The cuttings were approximately 5 cm in length and had two nodes. Seventy-two cuttings per genotype were propagated, as described by Clark et al. (1999)
MD and transgenic seeds of homozygous progeny were surface sterilized as described above and then plated on 0.5x Murashige and Skoog media, pH 5.6, containing 0.8% agar with 0, 0.1, 1, 10, 100, and 1,000 µM ACC in a Phytatray II (Sigma). Seeds were incubated under fluorescent light (16 h light/8 h dark) at 24°C for 48 h, then incubated at 24°C in the dark for 7 d. Lengths of hypocotyls from 20 seedlings per genotype were measured. Experiments were conducted twice separately with similar results. Data presented are for one experiment. To analyze root hair formation, seeds were plated on the same medium described above containing 1 µM ACC in petri dishes (15 x 100 mm). The petri dishes were incubated vertically, as described above, for 7 d. Photographs were recorded using a dissecting microscope with a digital camera. Sequence data from this article have been deposited with the EMBL/GenBank data libraries under accession numbers AY353249 (PhEIN2) and AY353248 (PhEIL1).
We thank Dr. Denise Tieman for technical assistance with the real-time RT-PCR analysis and Yvonne Arwood for her assistance with plant growth and maintenance in the greenhouse. Received May 28, 2004; returned for revision June 25, 2004; accepted June 30, 2004.
1 This work was supported by grants from the Fred Gloeckner Foundation, the American Floral Endowment, the U.S. Department of Agriculture Floral and Nursery Crops Initiative, Plantgenix, and the Florida Agriculture Experimental Station (D.G.C.). Florida Agriculture Experimental Station Journal Series No. R–10373. 
2 Present address: Plant Biology Laboratory, The Salk Institute for Biological Studies, La Jolla, CA 92037. Article, publication date, and citation information can be found at www.plantphysiol.org/cgi/doi/10.1104/pp.104.046979. * Corresponding author; e-mail geranium{at}ufl.edu; fax 352–392–3870.
Abeles FB, Morgan PW, Saltveit ME (1992) Ethylene in Plant Biology. Academic Press, San Diego
Alonso JM, Hirayama T, Roman G, Nourizadeh S, Ecker JR (1999) EIN2, a bifunctional transducer of ethylene and stress responses in Arabidopsis. Science 284: 2148–2152
Beaudoin N, Serizet C, Gosti F, Giraudat J (2000) Interactions between abscisic acid and ethylene signaling cascades. Plant Cell 12: 1103–1115 Bovy AG, Angenent GC, Dons HJM, van Altvorst AC (1999) Heterologous expression of the Arabidopsis etr1-1 allele inhibits the senescence of carnation flowers. Mol Breed 5: 301–308
Chang C, Kwok SF, Bleecker AB, Meyerowitz EM (1993) Arabidopsis ethylene response gene ETR1—similarity of product to two-component regulators. Science 262: 539–544 Chao Q, Rothenberg M, Solano R, Roman G, Terzaghi W, Ecker JR (1997) Activation of the ethylene gas response pathway in Arabidopsis by the nuclear protein ETHYLENE-INSENSITIVE3 and related proteins. Cell 89: 1133–1144[CrossRef][Web of Science][Medline] Chen QG, Bleecker AB (1995) Analysis of ethylene signal-transduction kinetics associated with seedling-growth response and chitinase induction in wild-type and mutant Arabidopsis. Plant Physiol 108: 597–607[Abstract]
Ciardi JA, Tieman DM, Lund SD, Jones JB, Stall RE, Klee HJ (2000) Response to Xanthomonas campestris pv. vesicatoria in tomato involves regulation of ethylene receptor gene expression. Plant Physiol 123: 81–92
Clark DG, Gubrium EK, Barrett JE, Nell TA, Klee HJ (1999) Root formation in ethylene-insensitive plants. Plant Physiol 121: 53–59 Clevenger D (2000) Horticultural performance of ethylene-insensitive petunias. MS thesis. University of Florida, Gainesville, FL
Fujita H, Syono K (1996) Genetic analysis of the effects of polar auxin transport inhibitors on root growth in Arabidopsis thaliana. Plant Cell Physiol 37: 1094–1101 Gallie DR, Young TE (2004) The ethylene biosynthetic and perception machinery is differentially expressed during endosperm and embryo development in maize. Mol Genet Genomics 271: 267–281[CrossRef][Web of Science][Medline]
Gilissen LJW, Hoekstra FA (1984) Pollination-induced corolla wilting in Petunia hybrida rapid transfer through the style of a wilting-inducing substance. Plant Physiol 75: 496–498
Gubrium EK, Clevenger DJ, Clark DG, Barrett JE, Nell TA (2000) Reproduction and horticultural performance of transgenic ethylene-insensitive petunias. J Am Soc Hortic Sci 125: 277–281 Guo H, Ecker JR (2003) Plant responses to ethylene gas are mediated by SCFEBF1/EBF2-dependent proteolysis of EIN3 transcription factor. Cell 115: 667–677[CrossRef][Web of Science][Medline] Guo H, Ecker JR (2004) The ethylene signaling pathway: new insights. Curr Opin Plant Biol 7: 40–49[CrossRef][Web of Science][Medline]
Hall AE, Bleecker AB (2003) Analysis of combinatorial loss-of-function mutants in the Arabidopsis ethylene receptors reveals that the ers1 etr1 double mutant has severe developmental defects that are EIN2 dependent. Plant Cell 15: 2032–2041
Hua J, Chang C, Sun Q, Meyerowitz EM (1995) Ethylene insensitivity conferred by Arabidopsis ERS gene. Science 269: 1712–1714 Hua J, Meyerowitz EM (1998) Ethylene responses are negatively regulated by a receptor gene family in Arabidopsis thaliana. Cell 94: 261–271[CrossRef][Web of Science][Medline]
Hua J, Sakai H, Nourizadeh S, Chen QG, Bleecker AB, Ecker JR, Meyerowitz EM (1998) EIN4 and ERS2 are members of the putative ethylene receptor gene family in Arabidopsis. Plant Cell 10: 1321–1332 Huang Y, Li H, Hutchison CE, Laskey J, Kieber JJ (2003) Biochemical and functional analysis of CTR1, a protein kinase that negatively regulates ethylene signaling in Arabidopsis. Plant J 33: 221–233[CrossRef][Web of Science][Medline] Jorgensen RA, Cluster PD, English J, Oue O, Napoli CA (1996) Chalcone synthase cosuppression phenotypes in petunia flowers: comparison of sense vs. antisense constructs and single-copy vs. complex T-DNA sequences. Plant Mol Biol 31: 957–973[CrossRef][Web of Science][Medline]
Jun SH, Han MJ, Lee S, Seo YS, Kim WT, An G (2004) OsEIN2 is a positive component in ethylene signaling in rice. Plant Cell Physiol 45: 281–289 Kieber JJ (1997) The ethylene response pathway in Arabidopsis. Annu Rev Plant Physiol Plant Mol Biol 48: 277–296[CrossRef][Web of Science][Medline] Kieber JJ, Rothenberg M, Roman G, Feldmann K, Ecker JR (1993) CTR1, a negative regulator of the ethylene response pathway in Arabidopsis, encodes a member of the Raf family of protein kinases. Cell 72: 427–441[CrossRef][Web of Science][Medline]
Knoester M, van Loon LC, Heuvel JPD, Hennig J, Bol JF, Linthorst HJM (1998) Ethylene-insensitive tobacco lacks nonhost resistance against soil-borne fungi. Proc Natl Acad Sci USA 95: 1933–1937 Roman G, Lubarsky B, Kieber JJ, Rothenberg M, Ecker JR (1995) Genetic analysis of ethylene signal transduction in Arabidopsis thaliana: five novel mutant loci integrated into a stress response pathway. Genetics 139: 1393–1409[Abstract]
Sakai H, Hua J, Chen QG, Chang C, Medrano LJ, Bleecker AB, Meyerowitz EM (1998) ETR2 is an ETR1-like gene involved in ethylene signaling in Arabidopsis. Proc Natl Acad Sci USA 95: 5812–5817
Solano R, Stepanova A, Chao QM, Ecker JR (1998) Nuclear events in ethylene signaling: a transcriptional cascade mediated by ETHYLENE-INSENSITIVE3 and ETHYLENE-RESPONSE-FACTOR1. Genes Dev 12: 3703–3714
Su WP, Howell SH (1992) A single genetic-locus, ckr1, defines Arabidopsis mutants in which root-growth is resistant to low concentrations of cytokinin. Plant Physiol 99: 1569–1574 Tang X, Woodson WR (1996) Temporal and spatial expression of 1-aminocyclopropane-1-carboxylate oxidase mRNA following pollination of immature and mature petunia flowers. Plant Physiol 112: 503–511[Abstract] Tieman DM, Ciardi JA, Taylor MG, Klee HJ (2001) Members of the tomato EIN3 gene family are functionally redundant and regulate ethylene responses throughout plant development. Plant J 26: 47–58[CrossRef][Web of Science][Medline] Underwood BA (2003) Effects of ethylene on floral fragrance Petunia x hybrida ‘Mitchell Diploid.’ PhD thesis. University of Florida, Gainesville, FL Wesley SV, Helliwell CA, Smith NA, Wang M, Rouse DT, Liu Q, Gooding PS, Singh SP, Abbott D, Stoutjesdijk PA, et al (2001) Construct design for efficient, effective and high throughput gene silencing in plants. Plant J 27: 581–590[CrossRef][Web of Science][Medline] Wilkinson JQ, Lanahan MB, Clark DG, Bleecker AB, Chang C, Meyerowitz EM, Klee HJ (1997) A dominant mutant receptor from Arabidopsis confers ethylene insensitivity in heterologous plants. Nat Biotechnol 15: 444–447[CrossRef][Web of Science][Medline]
Wilkinson JQ, Lanahan MB, Yen HC, Giovannoni JJ, Klee HJ (1995) An ethylene-inducible component of signal transduction encoded by never-ripe. Science 270: 1807–1809 This article has been cited by other articles:
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ASPB Publications | PLANT PHYSIOLOGY® | THE PLANT CELL | |
|---|---|---|---|
TOP
ABSTRACT
RESULTS
