|
|
||||||||
|
First published online November 24, 2004; 10.1104/pp.104.050054 Plant Physiology 136:4048-4060 (2004) © 2004 American Society of Plant Biologists Metabolic Engineering of the Chloroplast Genome Using the Echerichia coli ubiC Gene Reveals That Chorismate Is a Readily Abundant Plant Precursor for p-Hydroxybenzoic Acid Biosynthesis1DuPont Experimental Station, Wilmington, Delaware 198800402 (P.V.V., D.L.D., D.E.V.D.); and Department of Molecular and Microbiology, University of Central Florida, Orlando, Florida 328162360 (A.L.D., M.S.K., H.D.)
p-Hydroxybenzoic acid (pHBA) is the major monomer in liquid crystal polymers. In this study, the Escherichia coli ubiC gene that codes for chorismate pyruvate-lyase (CPL) was integrated into the tobacco (Nicotiana tabacum) chloroplast genome under the control of the light-regulated psbA 5' untranslated region. CPL catalyzes the direct conversion of chorismate, an important branch point intermediate in the shikimate pathway that is exclusively synthesized in plastids, to pHBA and pyruvate. The leaf content of pHBA glucose conjugates in fully mature T1 plants exposed to continuous light (total pooled material) varied between 13% and 18% dry weight, while the oldest leaves had levels as high as 26.5% dry weight. The latter value is 50-fold higher than the best value reported for nuclear-transformed tobacco plants expressing a chloroplast-targeted version of CPL. Despite the massive diversion of chorismate to pHBA, the plastid-transformed plants and control plants were indistinguishable. The highest CPL enzyme activity in pooled leaf material from adult T1 plants was 50,783 pkat/mg of protein, which is equivalent to approximately 35% of the total soluble protein and approximately 250 times higher than the highest reported value for nuclear transformation. These experiments demonstrate that the current limitation for pHBA production in nuclear-transformed plants is CPL enzyme activity, and that the process becomes substrate-limited only when the enzyme is present at very high levels in the compartment of interest, such as the case with plastid transformation. Integration of CPL into the chloroplast genome provides a dramatic demonstration of the high-flux potential of the shikimate pathway for chorismate biosynthesis, and could prove to be a cost-effective route to pHBA. Moreover, exploiting this strategy to create an artificial metabolic sink for chorismate could provide new insight on regulation of the plant shikimate pathway and its complex interactions with downstream branches of secondary metabolism, which is currently poorly understood.
All plants normally produce p-hydroxybenzoic acid (pHBA), albeit usually in small quantities. Radioisotope studies with Lithospermum erythrorhizon suggest that this compound is derived from the CoA ester of p-hydroxycinnamic acid (pHCA-CoA) through a -oxidation-like mechanism (Loscher and Heide, 1994 -D linkage. Glc conjugation, which takes place in the cytosol via distinct UDP-glucosyltransferases (Lim et al., 2002
The other microbial protein that has been used to elevate pHBA levels in tobacco is the 4-hydroxycinnamoyl-CoA hydratase/lyase (HCHL) of Pseudomonas fluorescens (Mayer et al., 2001
Although it is conceivable that the current limitation for CPL-mediated pHBA production in plants is carbon flux through the plastid shikimate pathway, other explanations seem more likely. One potential limitation is the low levels of transgene expression caused by position effect due to random integration of transgenes or gene silencing in nuclear transgenic lines (Voinnet, 2001
It is occasionally observed that chloroplast uptake of foreign proteins can be improved by including a small portion of the mature N terminus of the transit peptide donor in addition to the transit peptide and scissile bond (Schreier et al., 1985
An alternate approach to express foreign proteins or enzymes that function within chloroplasts would be to directly integrate and express transgenes via the chloroplast genome. Such an approach has additional advantages including high levels of transgene expression (Daniell et al., 2002 This study is the first attempt to utilize chloroplast transformation for metabolic engineering to generate plants that accumulate large amounts of a small aromatic compound of significant commercial value, pHBA. Towards this goal we have stably integrated the unmodified E. coli ubiC gene into the tobacco chloroplast genome and studied the consequences of hyperexpression of this enzyme in leaf and stem tissue. Another distinguishing feature of this work is that the pHBA levels reported are based on separately processed total leaf and total stalk material that was obtained from fully mature first- and second-generation plastid-transformed plants. It should also be emphasized that this is the first time that stalk production of pHBA has been examined in either CPL- or HCHL-expressing tobacco plants. Finally, our experiments provide unequivocal evidence that the current limitation for CPL-mediated pHBA production in nuclear-transformed plants is achieving high enough levels of enzyme activity in the chloroplast compartment, the site of chorismate synthesis, and that this obstacle is easily circumvented using plastid transformation. Until now high-level production of pHBA in plants has been elusive.
Tobacco chloroplast transformation vector pLD-CtV previously developed in the Daniell laboratory (Daniell et al., 1998
Chloroplast transgenic plants were obtained by particle bombardment as previously described (Daniell, 1997 Southern blotting was performed to confirm stable integration of transgenes into the chloroplast genome and to determine their homoplasmy or heteroplasmy. Upon achieving homoplasmy, all chloroplast genomes contain the integrated ubiC gene and are hence identical. In contrast, the presence of untransformed chloroplast genomes is a clear indication of heteroplasmy. Southern blots were probed with either a gene specific (ubiC) probe or a flanking sequence probe. The ubiC gene specific probe (0.3 kb) was obtained by SmaI/BamHI digestion of the pLDK plasmid (Fig. 2A). The flanking sequence probe (0.81 kb) was obtained by BamHI/BglII digestion of the pUC-ct plasmid, which contains the chloroplast flanking sequences trnI and trnA (Fig. 2A). The plant DNA was digested with AflIII (Fig. 2A). Upon hybridization with the flanking sequence probe transformed chloroplasts should exhibit a 6.3-kb fragment and untransformed chloroplasts a 4.2-kb fragment. If the 4.2-kb fragment is not seen in the transgenic line, this is an indication that all chloroplast genomes have been transformed and homoplasmy has been achieved, within the limit of detection. All transgenic lines tested positive for site-specific integration when hybridized with the ubiC probe and untransformed lines showed no such fragment (Fig. 2C). Most of the lines from T1 whose seeds were germinated in the presence of spectinomycin showed only the 6.3-kb fragment, indicating again that homoplasmy had been achieved within the levels of detection and maintained in subsequent generations (Fig. 2D).
Shown in Figure 3 is the developmental time course for pHBA accumulation in leaves for a representative T0 plant (line 4). Leaf punches obtained from the first or second leaf from the bottom of the plant were used for this analysis, and variation between replicates was typically less than 10%. Consistent with previous observations with nuclear-transformed tobacco plants expressing a chloroplast-targeted version of CPL (Siebert et al., 1996 -D linkage and are readily converted to free pHBA by acid or base hydrolysis (Siebert et al., 1996
When grown under the normal light/dark cycle (16 h on/8 h off), the leaf content of pHBA Glc conjugates in the T0 plant steadily increased over a 3-month period to a maximum value of 15% dry weight. However, there was further increase in product accumulation when the plant was shifted to continuous light (arrow in Fig. 3). This phenomenon, which was also observed with other T0 and T1 plants (data not shown), supports the notion that the psbA 5' UTR is stimulated by light (Eibl et al., 1999
Since product accumulation continued to increase over the span of several months, it was anticipated that young leaves would have a lower content of pHBA Glc conjugates than old leaves, and this turned out to be the case. As shown in Figure 4, the oldest leaves at the bottom of the plant had 5 to 6 times more pHBA than the youngest leaves at the top, while samples obtained from mature green leaves half way up the stalk contained intermediate levels. Although this experiment was performed with a T1 plant that was derived from line 4, all the plastid-transformed plants exhibited this trend. It is also interesting to note that product accumulation in the first- and second-generation line 4 plants was very similar when old leaf tissue was analyzed, reaching a maximum value of approximately 25% dry weight in both cases. This observation suggests that the line 4 T0 plant was homoplasmic or nearly homoplasmic, and further support for this conclusion is shown in Table I. Regardless of the explanation, it is clear from the forgoing experiments that the E. coli ubiC gene integrated in the plastid genome was stably inherited in the second-generation plants.
Because the amount of pHBA in leaves depends on not only the age of the plant but also the age of the leaves, the leaf punch experiments described above provide no insight on perhaps the most important question from a biotechnology perspective: What is the total leaf content of pHBA in a fully mature plastid-transformed tobacco plant? It is also of interest to know how much product accumulates in the stalk when contemplating the commercial feasibility of a plant pHBA production platform. Surprisingly, there are no reports in the literature regarding pHBA levels in stem tissue for nuclear-transformed tobacco plants expressing either CPL or HCHL. To address these important questions, fully mature plastid-transformed tobacco plants were sacrificed and all biomass above the ground was harvested for analysis. Total leaf and total stalk material were segregated and the tissues were lyophilized to dryness and ground to a fine powder in an electrically driven mill. Following this procedure, the homogeneous dry plant material was analyzed by HPLC for pHBA Glc conjugates. The results from these experiments are summarized in Table I for selected first- and second-generation plastid-transformed plants.
The total leaf content of pHBA Glc conjugates for the three T0 lines ranged from 10.9% dry weight to 15.2% dry weight. The mean value (±SE) was 13.15% ± 1.26% dry weight, which is roughly one-half the amount that was observed with leaf punches that were obtained from the oldest leaves on the plant. To determine the stability of the transgene and long-term effects on the health of the plant, four second-generation plants were subjected to the same analysis. Like the parental lines, the T1 plants were not adversely affected by pHBA overproduction and were phenotypically indistinguishable from nontransformed control plants (Fig. 5). The two line 4 offspring had slightly lower levels of product accumulation than the T0 plant, but these differences are probably not significant. On the other hand, there was a 50% to 70% increase in the total leaf content of pHBA Glc conjugates for the two line 3 descendants. The most logical explanation for this discrepancy is that the line 3 T0 plant was heteroplasmic, while the T1 plants were homoplasmic. Indeed, a mixed population of chloroplast genomes in T0 plants is frequently observed with plastid transformation (Guda et al., 2000
The data shown in Table I also reveals the dramatic difference between leaf and stalk content of pHBA, and all the first- and second-generation plants exhibited the same trend. The mean value for pHBA Glc conjugates in total stalk material representing fully mature plants was 2.3% dry weight ± 0.36% dry weight for the T0 lines and 2.5% dry weight ± 0.05% dry weight for the T1 lines. Thus, product accumulation in the stalk was 5- to 8-fold lower than corresponding leaf levels. Another notable difference between leaf and stalk production of pHBA was the Glc conjugate profile. In stem tissue, almost the entire compound was converted to the phenolic glucoside and only trace amounts of the Glc ester were detected (<5%).
In Arabidopsis (Arabidopsis thaliana), UDP-glucosyltransferases are members of a multigene family that consists of at least 107 distinct open reading frames (Li et al., 2001 Figure 6A shows the relative susceptibility of the pHBA phenolic glucoside and Glc ester to acid hydrolysis after 48 h at 60°C. From this data it is clear that the Glc ester is the most acid labile species. Quantitative conversion of this compound to free pHBA occurred with as little as 0.1 N HCl, while a 5-fold higher concentration of acid was required for complete hydrolysis of the phenolic glucoside. Since both Glc conjugates and free pHBA have limited water solubility at acid pH, alkaline hydrolysis was also examined (Fig. 6B). Again, the phenolic glucoside was relatively stable under the conditions employed and complete hydrolysis required >0.5 N NaOH. In marked contrast, 0.1 N NaOH was sufficient to release all of the pHBA from the Glc ester. Based on these observations, as well as economic and environmental considerations, we conclude that the Glc ester is the conjugate of choice to make in plants, if it is feasible to alter the in vivo partitioning of pHBA through metabolic engineering with an appropriate UDP-glucosyltransferase.
Previous attempts to elevate pHBA levels in green plants using the E. coli ubiC gene have relied on nuclear transformation for expression of the foreign protein. Using this approach in tobacco, pHBA Glc conjugates accumulated in leaf tissue to a maximum value of 0.52% dry weight, which is at least a 1,000-fold increase over nontransformed control plants (Siebert et al., 1996
To test the hypothesis that pHBA production in nuclear-transformed plants is currently limited by CPL enzyme activity in the compartment of interest, not chorismate per se, the unmodified E. coli ubiC gene was integrated into the tobacco plastid genome. Thus, the foreign protein was directly expressed in the intracellular organelle where its substrate is synthesized. Using this approach we were able to achieve levels of pHBA Glc conjugates in old leaf tissue that exceeded 25% of the total dry weight when the plants were grown in continuous light (Figs. 3 and 4). This is a 50-fold increase over the maximum value reported for nuclear-transformed tobacco plants expressing the same enzyme (Siebert et al., 1996 It should be emphasized that the CPL-enzyme activity noted above is the average value for total pooled leaf material from a fully mature, plastid-transformed plant that was obtained from two independently prepared cell-free extracts that differed by <5%. The total leaf content of pHBA Glc conjugates in the same plant was 18.3% dry weight (Table I). Given the extraordinarily high levels of CPL enzyme activity that were achieved in this study with plastid transformation, it is quite possible that the latter value represents the upper limit of pHBA production in tobacco leaf at the whole-plant level, although additional studies are necessary to test this hypothesis. Nevertheless, one clear-cut conclusion from our experiments is that CPL is a much better catalyst than HCHL for plant pHBA production when the enzyme is expressed at high levels directly in the plastid compartment.
The substrate for HCHL is pHCA-CoA, a key intermediate in the phenylpropanoid pathway. The highest leaf content of pHBA Glc conjugates reported for HCHL-expressing tobacco was only 2.9% dry weight and the transgenic plants were extremely sick due to a severe depletion of phenylpropanoids (Mayer et al., 2001
In striking contrast to the metabolic chaos described above, our plastid-transformed, CPL-expressing plants were healthy and robust and exhibited no discernible negative phenotype despite the fact that more carbon was converted to pHBA. This result is a clear indication that flux through the shikimate pathway was able to keep pace with the massive diversion of chorismate to pHBA and still provide enough carbon for downstream intermediates that are essential for plant growth and development, including pHCA-CoA (HCHL's substrate) and other phenylpropanoids. In bacteria, regulation of carbon flow into the shikimate pathway is largely under transcriptional control and feedback inhibition of the first enzyme in the pathway, 3-deoxy-D-arabino-heptulosonate 7-phosphate synthase; the aromatic amino acids mediate both processes. Although there is no evidence for a feedback-sensitive 3-deoxy-D-arabino-heptulosonate 7-phosphate synthase in plants, a recent study suggests that reduced thioredoxin plays a role in activation of this enzyme (Entus et al., 2002
The total stalk content of pHBA was at least 5 times lower than the total leaf content in plastid-transformed plants (Table I), and this study provides no explanation for this unexpected observation. Phenylpropanoid biosynthesis in stem tissue is a high-flux pathway that is largely devoted to lignin production, and lignin accounts for approximately 20% of the total dry weight of the stalk. Since all phenylpropanoids are ultimately derived from chorismate, including monolignols, it is reasonable to assume that substrate availability should not be the limiting factor for stalk accumulation of pHBA. The average CPL specific activity in cell-free extracts prepared from total stalk material obtained from fully mature line 3-B was only 8,378 pkat/mg of protein, which is 6-fold lower the corresponding leaf value. However, this result does not necessarily indicate that the process is limited by catalyst. Additional experiments using different promoters and 5'UTRs that might function more effectively in nonphotosynthetic plastids are necessary to see if it is possible to achieve higher stalk levels of pHBA with plastid transformation. In this context, we have recently utilized several regulatory sequences for foreign gene expression in nongreen plastids. For example, the 5'UTR of the T7 gene 10 and 3'UTR of the rps16 gene facilitated 75% transgene expression in nongreen edible parts of carrots containing chromoplasts (grown underground in the dark) and 48% in proplastids, compared to the 100% value in leaf chloroplasts (Kumar et al., 2004a
Another challenge for a commercially viable, plant-based production platform is to control the partitioning of pHBA Glc conjugates. As already indicated, the phenolic glucoside and Glc ester are both formed in the cytosol by distinct UDP-glucosyltransferases and are subsequently transported into the vacuole by different carriers. The Glc ester, however, is exquisitely sensitive to acid and base hydrolysis, and this could have a significant impact on the cost of downstream processing in the recovery and purification of polymer-grade pHBA. The ease of hydrolysis of this compound is undoubtedly related to the fact that it is a
In summary, pHBA is the major monomer in liquid crystal polymers (LCPs). These thermotropic polyesters have excellent properties, including high strength/stiffness, low melt viscosity, property retention at elevated temperatures, environmental resistance, and low gas permeability (Figuly, 1996
Construction of the CPL Chloroplast Transformation Vector
The Escherichia coli ubiC gene (GenBank accession no. M92628) was amplified from genomic DNA of strain W3110 (Campbell et al., 1978
Chloroplast transformants were obtained as previously described (Daniell, 1997
Plant DNA was extracted from transgenic and wild-type tobacco using Qiagen DNeasy plant mini kit (Gaithersburg, MD). The PCR primers, AAAACCCGTCCTCAGTTCGGATTGC (3P) and CCGCGTTGTTTCATCAAGCCTTACG (3M), were used to perform PCR on transgenic and wild-type plant DNA as described previously (Daniell et al., 2004d
These steps were performed essentially as previously described (Daniell et al., 2004d
Leaf punches (50150 mg fresh weight) were used to monitor pHBA levels throughout development. Young, mature, and old tissues were used for this analysis as described in the text and figure legends. Unless otherwise indicated, all steps were conducted at room temperature. The tissue was placed in a Biopulverizer H tube that contained a ceramic bead (QBiogen [Carlsbad, CA]), and 1 mL of 50% (w/v) methanol was added. The tubes were agitated for 40 s using a FastPrep FP120 tissue disrupter (QBiogen) set at 5 m/s, and the samples were then placed on a rotary shaker (400 rpm) for 1 h. Debris was removed by centrifugation and a 50-µL aliquot of the supernatant was taken to dryness in a heated Speed-Vac. The residue was dissolved in 100 µL of 5 mM Tris-HCl, pH 8, for subsequent analysis of pHBA Glc conjugates. Alternatively, the leaf tissue was extracted with 1.0 mL of 5 mM Tris-HCl, pH 8.0, using the same procedure described above. Side-by-side experiments demonstrated that both approaches yield identical results. In some experiments, fully mature tobacco plants were analyzed for whole-leaf and whole-stalk levels of pHBA Glc conjugates. For this type of analysis, all plant material above the ground was harvested, but total leaf and total stalk material were segregated and processed individually. Tissues were lyophilized to dryness and ground to a homogeneous powder in an electrically driven mill. Five to 20 mg of the dry plant material was then extracted with either 1.0 mL of 50% (w/v) methanol or 1.0 mL of 5 mM Tris-HCl, pH 8.0, using the same procedure described above. pHBA Glc conjugates were analyzed by HPLC using a C18 column (Vydac 218TP54 [The Nest Group, Southborough, MA]) that was developed at 1.0 mL/min with a linear gradient (20 min) of 0% to 50% methanol/0.1% formic acid; the separation was performed at room temperature. Elution of the pHBA phenolic glucoside and pHBA Glc ester were monitored at 254 nm. Authentic standards (chemically synthesized and characterized at DuPont) were used to calibrate the HPLC runs, and extinction coefficients for both compounds were accurately determined under the conditions employed. Peak areas were integrated and values obtained with known amounts of the standards were used to quantitate pHBA Glc conjugates. After accounting for the fraction of the extract that was injected, numbers were corrected to reflect total recovery from the leaf sample analyzed. This, coupled with individual measurements of the dry weight of the plant tissue analyzed (taken from the same leaf, on the same day), enabled the expression of pHBA Glc conjugates as a percentage of total dry weight.
Cell-free extracts were prepared at 0°C to 4°C. The lyophilized leaf and stalk powders described above were the starting materials for this procedure. Approximately 10 mg of the dry powder was transferred to a 1.5-mL polypropylene microfuge tube and 650 µL of a solution containing 50 mM Tris-HCl, pH 7.5, 1 mM EDTA, 0.1%
CPL enzyme activity was measured spectrophotometrically using a continuous assay that is based on the increase in A246 that occurs when chorismate is converted to pHBA. Reactions were carried out at 37°C in a quartz cuvette that contained 90 mM Tris-HCl, pH 7.6, 0.2 M NaCl, 100 µM purified barium chorismate (Siebert et al., 1994 Received July 16, 2004; returned for revision October 15, 2004; accepted October 17, 2004.
1 This work was supported in part by the National Institutes of Health (grant no. R 01 GM63879) and by the U.S. Department of Agriculture (grant no. 36112100001700D to H.D.).
2 Present address: National Institute of Biotechnology and Genetic Engineering, Jhang Road, Faisalabad, Pakistan. Article, publication date, and citation information can be found at www.plantphysiol.org/cgi/doi/10.1104/pp.104.050054. * Corresponding author; e-mail daniell{at}mail.ucf.edu; fax 4078230956.
Bartholomew DM, Van Dyk DE, Lau S-ZC, O'Keefe DP, Rea PA, Viitanen PV (2002) Alternate energy-dependent pathways for the vacuolar uptake of glucose and glutathione conjugates. Plant Physiol 30: 15621572
Bate NJ, Orr J, Ni W, Meromi A, Nadler-Hassar T, Doerner PW, Dixon RA, Lamb CJ, Elkind Y (1994) Quantitative relationship between phenylalanine ammonia-lyase levels and phenylpropanoid accumulation in transgenic tobacco identifies a rate-determining step in natural product synthesis. Proc Natl Acad Sci USA 91: 76087612 Bradford MM (1976) A rapid and sensitive method for quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72: 248254[CrossRef][ISI][Medline]
Campbell JL, Richardson CC, Studier FW (1978) Genetic recombination and complementation between bacteriophage T7 and cloned fragments of T7 DNA. Proc Natl Acad Sci USA 75: 22762280 Daniell D, Carmona-Sanchez O, Burns BB (2004b) Chloroplast derived antibodies, biopharmaceuticals and edible vaccines. In R Fischer, S Schillberg, eds, Molecular Farming Weinheim. WILEY-VCH, Verlag, pp 113133 Daniell H (1997) Transformation and foreign gene expression in plants mediated by microprojectile bombardment. Methods Mol Biol 62: 463489[Medline] Daniell H (2002) Molecular strategies for gene containment in transgenic crops. Nat Biotechnol 20: 581586[ISI][Medline] Daniell H (2004) Medical molecular pharming: therapeutic recombinant antibodies, biopharmaceuticals, and edible vaccines in transgenic plants engineered via the chloroplast genome. In RM Goodman, ed, Encyclopedia of Plant and Crop Science. Marcel Decker, New York, pp 704710 Daniell H, Chebolu S, Kumar S, Singleton M, Falconer R (2004c) Chloroplast-derived vaccine antigens and other therapeutic proteins. Vaccine (in press) Daniell H, Cohill P, Kumar S, Dufourmantel N, Dubald M (2004a) Chloroplast genetic engineering. In H Daniell, C Chase, eds, Molecular Biology and Biotechnology of Plant Organelles, Kluwer Academic Publishers, Dordrecht, The Netherlands, pp 423468 Daniell H, Datta R, Varma S, Gray S, Lee SB (1998) Containment of herbicide resistance through genetic engineering of the chloroplast genome. Nat Biotechnol 16: 345348[CrossRef][ISI][Medline] Daniell H, Dhingra A (2002) Multigene engineering: Dawn of an exciting new era in biotechnology. Curr Opin Biotechnol 13: 136141[CrossRef][ISI][Medline] Daniell H, Kahn M, Allison L (2002) Milestones in chloroplast genetic engineering: an environmentally friendly era in biotechnology. Trends Plant Sci 7: 8491[CrossRef][ISI][Medline] Daniell H, Lee SB, Panchal T, Wiebe PO (2001a) Expression of cholera toxin B subunit gene and assembly as functional oligomers in transgenic tobacco chloroplasts. J Mol Biol 311: 10011009[CrossRef][ISI][Medline] Daniell H, Muthukumar B, Lee SB (2001b) Marker free transgenic plants: the chloroplast genome without the use of antibiotic selection. Curr Genet 39: 109116[CrossRef][ISI][Medline] Daniell H, Ruiz ON, Dhingra A (2004d) Chloroplast genetic engineering to improve argonomic traits. Methods Mol Biol 286: 111137 DeCosa B, Moar W, Lee SB, Miller M, Daniell H (2001) Overexpression of the Bt Cry2Aa2 operon in chloroplasts leads to formation of insecticidal crystals. Nat Biotechnol 19: 7174[CrossRef][ISI][Medline]
DeGray G, Rajasekaran K, Smith F, Sanford J, Daniell H (2001) Expression of an antimicrobial peptide via the chloroplast genome to control phytopathogenic bacteria and fungi. Plant Physiol 127: 852862 Devine AL, Daniell H (2004) Chloroplast genetic engineering for enhanced agronomic traits and expression of proteins for medical/industrial applications. In SG Møller, ed, Plastids, Vol 13. Blackwell Publishing, Oxford, pp 283323
Dhingra A, Portis AR, Daniell H (2004) Enhanced translation of a chloroplast-expressed RbcS gene restores small subunit levels and photosynthesis in nuclear antisense RbcS plants. Proc Natl Acad Sci USA 101: 63156320 Dufourmantel N, Pelissier B, Garçon F, Peltier JM, Tissot G (2004) Generation of fertile transplastomic soybean. Plant Mol Biol (in press) Eibl C, Zou Z, Beck A, Kim M, Mullet J, Koop HU (1999) In vivo analysis of plastid psbA, rbcL and rpl32 UTR elements by chloroplast transformation: tobacco plastid gene expression is controlled by modulation of transcript levels and translation efficiency. Plant J 19: 333345[CrossRef][ISI][Medline]
Entus R, Poling M, Hermann KM (2002) Redox regulation of arabidopsis 3-deoxy-D-arabino-heptulosonate 7-phosphate synthase. Plant Physiol 129: 18661871 Erickson B (1982) Salicylic acid and related compounds. In M Grayson, ed, Kirk-Othmer Encyclopedia of Chemical Technology. Wiley, New York, Vol 20, pp 517519 Fernandez-San Millan A, Mingeo-Castel AM, Miller M, Daniell H (2003) A chloroplast transgenic approach to hyper-express and purify human serum albumin, a protein highly susceptible to proteolytic degradation. Plant Biotechnol J 1: 7179 Figuly GD (1996) Liquid crystalline polymers (thermotropic polyesters) in polymeric materials., In JC Salamone, ed, Encyclopedia, Vol 5. CRC Press, Boca Raton, FL, pp 37313740
Gasson MJ, Kitamura Y, McLauchlan WR, Narbad A, Parr AJ, Parsons EL, Payne J, Rhodes MJ, Walton NJ (1998) Metabolism of ferulic acid to vanillin. A bacterial gene of the enoyl-SCoA hydratase/isomerase superfamily encodes an enzyme for the hydration and cleavage of a hydroxycinnamic acid SCoA thioester. J Biol Chem 273: 41634170
Goldschmidt-Clermont M (1991) Transgenic expression of aminoglycoside adenine transferase in the chloroplast: a selectable marker for site-directed transformation of Chlamydomonas. Nucleic Acids Res 19: 40834089 Guda C, Lee SB, Daniell H (2000) Stable expression of biodegradable protein based polymer in tobacco chloroplasts. Plant Cell Rep 19: 257262[CrossRef] Herrmann KM, Weaver LM (1999) The shikimate pathway. Annu Rev Plant Physiol Plant Mol Biol 50: 473503[CrossRef][ISI] Howles PA, Sewalt VJW, Paiva NL, Elkind Y, Bate NJ, Lamb C, Dixon RA (1996) Overexpression of L-phenylalanine ammonia-lyase in transgenic tobacco plants reveals control points for flux into phenylpropanoid biosynthesis. Plant Physiol 112: 16171624[Abstract] Hrazdina G, Jensen RA (1992) Spatial organization of enzymes in plant metabolic pathways. Annu Rev Plant Physiol 43: 241267[CrossRef][ISI]
Kota M, Daniell H, Varma S, Garczynski SF, Gould F, William MJ (1999) Overexpression of the Bacillus thuringiensis (Bt) Cry2Aa2 protein in chloroplasts confers resistance to plants against susceptible and Bt-resistant insects. Proc Natl Acad Sci USA 96: 18401845 Kumar S, Daniell H (2004) Engineering the chloroplast genome for hyper-expression of human therapeutic proteins and vaccine antigens in recombinant protein protocols. Methods Mol Biol 267: 365383[Medline]
Kumar S, Dhingra A, Daniell H (2004a) Plastid-expressed betaine aldehyde dehydrogenase gene in carrot cultured cells, roots, and leaves confers enhanced salt tolerance. Plant Physiol 136: 28432854 Kumar S, Dhingra A, Daniell H (2004b) Stable transformation of the cotton plastid genome and maternal inheritance of transgenes. Plant Mol Biol (in press) Lee SB, Kwon HB, Kwon SJ, Park SC, Jeong MJ, Han SE, Byun MO, Daniell H (2003) Accumulation of trehalose within transgenic chloroplasts confers drought tolerance. Mol Breed 11: 113 Leelavathi S, Gupta N, Maiti S, Ghosh A, Reddy VS (2003) Overproduction of an alkali- and thermo-stable xylanase in tobacco chloroplasts and efficient recovery of the enzyme. Mol Breed 11: 5967[CrossRef] Leelavathi S, Reddy VS (2003) Chloroplast expression of His-tagged GUS-fusions: a general strategy to overproduce and purify foreign proteins using transplastomic plants as bioreactors. Mol Breed 11: 4958[CrossRef]
Li Y, Baldauf S, Lim E-K, Bowles DJ (2001) Phylogenetic analysis of the UDP-glycosyltransferase multigene family of Arabidopsis thaliana. J Biol Chem 276: 43384343
Lim EK, Doucet CJ, Li Y, Elias L, Worrall D, Spencer SP, Ross J, Bowles DJ (2002) The activity of Arabidopsis glycosyltransferases toward salicylic acid, 4-hydroxybenzoic acid, and other benzoates. J Biol Chem 277: 586592 Loscher R, Heide L (1994) Biosynthesis of p-hydroxybenzoate from p-coumarate and p-coumaroyl-coenzyme A in cell-free extracts of Lithospermum erythrorhizon cell cultures. Plant Physiol 106: 271279[Abstract] Lossl A, Eibl C, Harloff HJ, Jung C, Koop HU (2003) Polyester synthesis in transplastomic tobacco (Nicotiana tabacum L.): significant contents of polyhydroxybutyrate are associated with growth reduction. Plant Cell Rep 21: 891899[ISI][Medline] Mayer MJ, Narbad A, Parr AJ, Parker ML, Walton NJ, Mellon FA, Michael AJ (2001) Rerouting the plant phenylpropan |