|
|
||||||||
|
First published online December 3, 2004; 10.1104/pp.104.049361 Plant Physiology 137:127-140 (2005) © 2005 American Society of Plant Biologists The Role of the Cell Cycle Machinery in Resumption of Postembryonic Development1Department of Plant Systems Biology, Flanders Interuniversity Institute for Biotechnology (VIB), Ghent University, B9052 Gent, Belgium (R.M.B., K.V.P., L.D.V., D.I.); Plant Research International, NL6700 AA Wageningen, The Netherlands (J.H.W.B., S.P.C.G.); and Laboratoire Associé de l'Institut National de la Recherche Agronomique (France), Ghent University, B9000 Gent, Belgium (G.E.)
Cell cycle activity is required for plant growth and development, but its involvement in the early events that initiate seedling development remains to be clarified. We performed experiments aimed at understanding when cell cycle progression is activated during seed germination, and what its contribution is for proper seedling establishment. To this end, the spatial and temporal expression profiles of a large set of cell cycle control genes in germinating seeds of Arabidopsis (Arabidopsis thaliana) and white cabbage (Brassica oleracea) were analyzed. The in vivo behavior of the microtubular cytoskeleton was monitored during Arabidopsis seed germination. Flow cytometry of Arabidopsis germinating seeds indicated that DNA replication was mainly initiated at the onset of root protrusion, when germination reached its end. Expression analysis of cell cycle genes with mRNA in situ localization, -glucuronidase assays, and semiquantitative reverse transcription-polymerase chain reaction showed that transcription of most cell cycle genes was detected only after completion of germination. In vivo green fluorescent protein analysis of the microtubule cytoskeleton demonstrated that mitosis-specific microtubule arrays occurred only when the radicle had started to protrude, although the assembly of the microtubular cytoskeleton was promptly activated once germination was initiated. Thus, seed germination involves the synthesis and/or activation of a reduced number of core cell cycle proteins, which only trigger DNA replication, but is not sufficient to drive cells into mitosis. Mitotic divisions are observed only after the radicle has protruded and presumably rely on the de novo production of other cell cycle regulators.
Seed germination is the process by which the plant embryo resumes growth after a period of quiescence. Under favorable conditions, rapid growth of the embryo culminates in rupture of the covering layers and emergence of the radicle, which is considered the completion of germination. At this stage, the decision of individual embryo cells to reenter the cell cycle or to remain arrested is crucial to determine seedling formation. The building of plant shape and function depends on the ability of the embryo cells to resume division and differentiate. Understanding how the cell cycle genes work at this particular phase of plant development might help to clarify the cellular and structural events that bring a quiescent embryo to a metabolically active plant.
Cell cycle is a coordinated cyclic series of events, occurring between the end of subsequent cell divisions, by which cellular material is duplicated and divided between daughter cells. Thus, cell cycle consists of two major events, DNA replication (S phase) and mitosis (M phase) separated by two gap phases, G1 and G2 (for review, see Dewitte and Murray, 2003
The progressive passage through the various phases of the cell cycle is controlled by a conserved mechanism based on sequential transient formation and activation of complexes between cyclin-dependent kinases (CDKs) and their activating subunits, the cyclins (CYC; for review, see De Veylder et al., 2003
The cytoskeleton plays an important role in the preparation of cell division and cell elongation (Hasezawa and Kumagai, 2002 - and -tubulins in association with other proteins known as MT-associated proteins (MAPs; Lloyd and Hussey, 2001 -Tubulin accumulation has been extensively studied in relation to seed germination both with immunofluorescence microscopy and western-blot analysis (de Castro et al., 1995 -tubulin accumulation in imbibed tomato (Lycopersicon esculentum) seeds has been demonstrated (de Castro et al., 1995Although seed germination has been thoroughly analyzed from the physiological and biochemical point of views, the molecular mechanisms that directly link cell cycle with seed germination have been very poorly investigated. With the exception of a number of studies describing changes in cell cycle protein abundance during germination, the molecular aspects of the cell cycle during seed germination have been almost completely ignored. Here, seeds of Arabidopsis and white cabbage (Brassica oleracea) were chosen to monitor cell cycle-associated modifications during the transition from the quiescent dry state to the first divisions. As introduced above, many highly interesting Arabidopsis genes involved in the regulation of the cell cycle have been isolated and partially characterized during the last years. Expression studies carried out with many of these cell cycle genes on tissues of different Arabidopsis organs allow anticipation of possible involvement of cell cycle genes in early seedling development. By investigating cell cycle-related events, we wanted to determine whether cell cycle is implicated in the molecular accomplishments that lead to early seedling formation.
Nuclear DNA Content of Embryo Cells from Germinating Seeds of Arabidopsis Flow cytometry was performed to monitor DNA replication and to identify the position of Arabidopsis embryo cells within the cell division cycle, while the seed germinated. The histograms from nuclei of dry seeds showed one large peak, corresponding to the 2C DNA content (Fig. 1A). In the same histogram, a very small peak could be observed with slightly more fluorescence representing the nuclei with 3C DNA content. This peak represents the relative DNA content of nuclei from endosperm cells. Upon 8 h of imbibition in water, a peak corresponding to 4C nuclei became visible. However, a large increase in the frequency of 4C nuclei was only observed 40 h after imbibition (HAI), just before or coinciding with root protrusion, also defined as the completion of germination (Fig. 1A).
Endoreduplication seemed to be initiated only between 40 to 48 HAI, when an 8C population started to be detected. At this stage, endoreduplication is normally restricted to the cotyledon cells. The fraction of nuclei from which the DNA had replicated can be expressed as the ratio of 4C + 8C to the total amount of embryo nuclei [4C + 8C/(2C + 4C + 8C)]. This coefficient can be used as a direct measure of the nuclear DNA replication activity upon seed imbibition (Fig. 1B). The results illustrate that the percentage of embryo nuclei from dry seeds subject to DNA replication was negligible (0.7%). Following soaking, DNA replication increased up to 5% to 7% of the nuclei. A more remarkable increase in the fraction of nuclei going through S phase was only visible at 40 HAI. Thus, a major transition through S phase toward G2 was detected at about the moment when the radicle started to protrude (Fig. 1B).
CDKA/CYCA complexes have been reported to be essentially implicated in G2-to-M transition, but at least in some cases A-type cyclins seem to be components of CDK/CYC complexes that commit a cell to enter S phase (for review, see Rossi and Varotto, 2002
CYCB1;1 and CDKB1;1 are mitotic cell cycle activators, whose expression is confined to actively dividing meristems (Table I). GUS activity was absent in dried seeds of pCDKB1::GUS and in seeds imbibed for 24 h (data not shown). Immediately after the root started to protrude, CDKB1;1 promoter became active in the SAM and the radicle tip (Fig. 2J). In young seedlings, 3 d after imbibition (DAI), GUS expression had increased, but remained localized in the meristematic regions of the shoot and root and in a few vascular cells (Fig. 2K). Additionally, as reported previously, the GUS expression pattern revealed that CDKB1;1 promoter was active in the stomata cells of the cotyledons (Boudolf et al., 2004 CKS1 promoter activity was detected in most embryo tissues before root protrusion (data not shown). After 2 DAI, CKS1 promoter activity was gradually switched off in most embryo tissues and activity was mainly localized in the cotyledons at the moment of root protrusion (Fig. 2S). After germination, GUS activity became restricted to the cotyledons and vascular tissue of the root (Fig. 2T). CKS1 promoter activity was never observed in the shoot or root meristems.
Extensive mRNA in situ localizations of several Arabidopsis cell cycle genes (CYCB1;1, CYCD5;1, CYCD6;1, E2Fa, E2Fb, CDC6, CDC7, CKS1, KRP1, KRP2, and the histone H4 gene) were performed in germinating seeds of white cabbage to determine precisely their spatial and temporal expression profiles during seed germination and early seedling development (Fig. 3). Radicle protrusion in white cabbage seeds was initiated just after 24 HAI in water.
Simultaneously, the expression patterns of CDKA;1, CDKB1;1, E2Fa, CDC6, and CDC7 genes were also analyzed in germinating seeds of Arabidopsis by whole-mount mRNA in situ hybridization. The results confirmed those obtained with in situ hybridization in cabbage seeds and the promoter-GUS fusion data. From all genes analyzed by mRNA in situ hybridization, CDC6 transcripts were expressed the most early. This gene was expressed just prior to and during root protrusion in a clear patchy pattern throughout the radicle meristem (Fig. 3, A and B). At later stages, its expression was also observed in the epidermis of the radicle, the epidermis of the hypocotyl, and in the vascular tissue (data not shown). The truly early expression of this gene might be justified by its involvement in DNA replication. Shortly after germination, CDC6 was highly expressed in the root and hypocotyl, demonstrating that CDC6 expression was activated early during protrusion, as shown by the expression studies in cabbage. In older seedlings, expression was nearly absent, suggesting that CDC6 expression is strictly controlled during initial seedling development. KRP1 was expressed in the epidermal tissues of the young seedling, predominantly in the SAM region, but also in the hypocotyl (Fig. 3, C and D). Expression could not be detected in the cotyledons (Fig. 3C). Like KRP1, CDC7 expression in germinating seeds was restricted to the epidermis of the hypocotyl and to the base of the cotyledons (data not shown). CDC7 was very weakly expressed at the early stages of seedling development for both cabbage and Arabidopsis. KRP2 transcripts were detected just after the radicle had emerged from the seed coat. KRP2 was strongly expressed in the epidermis of all seedling organs (Fig. 3, EH). Frequently, KRP2 transcripts accumulated in a patchy pattern, with nonuniform zones of high expression alternating with zones without expression (Fig. 3E). Moreover, KRP2 expression was very early visible throughout the epidermis of leaf primordia (Fig. 3H). Similarly, also CKS1 mRNA transcripts were confined to the embryo epidermal cell layers and frequently a patchy expression pattern was observed (Fig. 3, I and J).
E2F genes code for transcription factors with an important role in the activation of S phase-specific genes (De Veylder et al., 2003 D-type cyclins are able to integrate extracellular signals to mediate the progression from G1-to-S phase. In germinating seeds of cabbage, CYCD5;1 gene expression could only be observed in the endosperm of both dry and imbibed seeds (data not shown). Expression in the embryo tissues might only be initiated later in development. Likewise, also CYCD6;1 and E2Fb mRNA transcripts accumulated in the endosperm cells (data not shown). In addition, CYCD6;1 and E2Fb were expressed in the embryo epidermis and in a restricted number of cells of the vascular tissues (Fig. 3, N and O, and P and Q, respectively). In these tissues expression was only established after protrusion, whereas in the endosperm corresponding transcripts were present at all stages. The tissue distribution pattern of CYCB1;1 mRNAs in cabbage coincided with the GUS pattern observed in transgenic seeds of Arabidopsis harboring the GUS gene under control of the CYCB1;1 promoter. Expression of this mitotic cyclin was mainly confined to the meristematic regions, both in the shoot and the root (Fig. 3, R and S). Clear in situ signals were also seen in the pericycle cells, which will probably form lateral roots (data not shown). Also, histone H4 mRNA was found in the main meristematic regions of the young seedling (data not shown). The expression of these genes could not be detected during germination but only 12 h after radicle protrusion. Whole-mount hybridizations with CDKA;1 and CDKB1;1 mRNA probes illustrate that the CDKA;1 mRNA distribution pattern was very similar to the GUS expression pattern observed in young transgenic seedlings of Arabidopsis that harbor the GUS gene under control of the CDKA;1 and CDKB1;1 promoters (data not shown).
To further validate our expression studies, the mRNA levels of key cell cycle genes were further analyzed in Arabidopsis seeds by semiquantitative reverse transcription (RT)-PCR. Five time points during seed imbibition were selected covering the complete seed germination and early seedling development. Specific transcript accumulation patterns were identified for CDKA;1, CDKB1;1, CYCD4;1, and CYCB1;1 (Fig. 4). Expression of CYCD4;1 increased abruptly during the first 24 h of seed soaking, and an expression peak was registered at 3 DAI, after which the transcript levels clearly decreased. CDKA;1 showed a very similar profile of gene expression, but the increase and decrease of its expression levels were less abrupt. Based on their expression profile, these cell cycle regulators might be essential for resumption of embryo growth, early during germination.
By contrast, the expression levels of CYCB1;1 and CDKB1;1 increased more evenly. CDKB1;1 transcript levels steadily increased during the initial 4 d of seed imbibition. This increase was slightly more abrupt between day 2 and day 3, coinciding with radicle protrusion. CYCB1;1 expression was nearly absent during the first 2 d after seed imbibition. Between day 3 and day 4, the expression levels increased rapidly. This expression peak might relate to the initiation of cell division events. Thereafter, the expression of this cyclin remained unchanged. These expression results largely corroborate the profiles revealed by tissue expression analysis.
Transgenic Arabidopsis MAP4-GFP plants were used as a living model system to monitor the in vivo dynamics of MTs within epidermal embryo cells, while the seed germinates and seedling growth is initiated. Based on our observations, organized MTs seemed to be absent in dry seeds but were rapidly assembled immediately after soaking. The visualization of living embryo cells implied that the seeds had to be soaked; so, the visualization of embryos of dry seeds was obviously unfeasible. After 45 min of imbibition in water, a reduced number of randomly aligned short MTs could be observed (Fig. 5A). At 6 to 8 HAI, the number of MTs had increased, but the arrays remained short and irregularly oriented. The number and size of the MT arrays steadily increased as the seeds were imbibed (Fig. 5B). By following the in vivo behavior of MTs in living epidermal cells of several germinating seeds between 10 and 20 HAI, we found that at this stage certain MTs were highly dynamic, while others remained remarkably stable in the cell over large periods. Moreover, the reorientation of MT arrays was not synchronized among neighboring cells, meaning that even when adjacent cells were subjected to the same external signals, the reorientation of MTs probably depended on each cell autonomously.
Until 24 HAI, the MT arrays were randomly aligned in all embryo cells (Fig. 5C). In general, approximately 24 HAI, MTs started to lose their seemingly free organization and progressively aligned in transverse arrays. This orchestrated array organization seemed to be preceded by a noteworthy increase in the number of MTs. Gradually, the transverse-oriented MTs of some embryo cells were replaced by newly organized longitudinal arrays. After 48 HAI, when the radicle had already protruded the seed coat, the majority of the cells presented a very specific orientation of the CMTs (Fig. 5D). At this stage, the MT arrays of the majority of the cells were perpendicular to the root/hypocotyl axis, indicating that most cells were elongating. In the radicle, MTs were seemingly less organized in the meristematic region, whereas with increasing distance from the root tip, transverse arrays became much more highly aligned. At this stage, although root protrusion had been accomplished, mitotic figures could only be observed in the root cap layer (Fig. 5F). In the hypocotyl, the CMTs presented various orientations from random to transverse and, in some cases, helical. Random orientation was particularly obvious in the top of the hypocotyl, close to the shoot apex. In the cotyledons, as in other embryo tissues, the dispersed CMTs gradually aligned into transverse arrays (Fig. 5E). These MT arrays, once organized, retained the same transversal positioning throughout further development. No obvious differences in the length and number of MT arrays were noticed between cotyledons and other embryo tissues throughout germination. The fluorescence intensity in the cells of the root/hypocotyl transition zone was significantly lower than that of other embryo tissues (Fig. 5G). Exhaustive observations revealed that this region had fewer MT arrays (data not shown). Dry MAP4 transgenic seeds were also imbibed in water containing cycloheximide (CHX). The dynamic changes in MT distribution were then followed in vivo, showing that although this drug prevents protein synthesis, CHX-treated seeds displayed a normal organization of MT arrays. In seeds imbibed for 30 min in water containing CHX, a small number of randomly aligned short MTs were observed, both in the cotyledons and radicle (Fig. 5H). Time-sequence observations demonstrated that CHX treatment did not alter the cellular MT network and assembly of MT arrays. An increasing number of MTs was still detectable after embryo cells were imbibed for more than 60 min in CHX-containing water (Fig. 5, I and J). Although similar in number and still highly dynamic, these arrays remained much shorter than those of untreated seeds. Monitoring the behavior of MTs from CHX-treated seeds demonstrated that although protein synthesis is blocked, the assembly of MT arrays in germinating seeds is not halted.
Seed germination is a complex physiological process triggered by the imbibition of water and the release of quiescence mechanisms by appropriate signals. We investigated cell cycle-associated events to illustrate whether cell cycle regulators are implicated in the events leading to early seedling formation. Although Arabidopsis has been generally accepted as the most important model organism for plant molecular biological research, its use for studying seed germination encounters some practical disadvantages, mainly related to the small size of the seeds. Therefore, some experiments were performed with white cabbage. These two species are ontogenetically closely related, and the morphology of the seeds is comparable. Previous hybridization experiments in Arabidopsis and rape (Brassica napus) seeds have revealed that the expression patterns correlate well between the two species, indicating that the Arabidopsis and Brassica sp. share high gene sequence homology (Girke et al., 2000
Flow cytometry has demonstrated that embryos of dry seeds contain almost exclusively nuclei with 2C DNA content. This observation indicates that most embryo cells are arrested in the G1 phase of the cell cycle, as corroborated by both quantitative and cytological analyses of DNA synthesis in germinating embryos of tomato or faba bean (Vicia faba; Liu et al., 1994
In root tips of white cabbage, the onset of DNA replication precedes root protrusion (Górnik et al., 1997
Resumption of DNA replication after imbibition of tomato seeds might be correlated with an increase in
The onset of radicle protrusion is also marked by a rapid increase in cell cycle gene transcription as evidenced by our expression analysis results (Fig. 6). The promoter activity of CDKA;1, CDKB1;1, CYCB1;1, CYCA2;1, CYCD4;1, and CKS1 genes has been characterized in detail by GUS activity detection assays. Based on these assays, two classes of cell cycle genes can be defined: one class with genes whose promoter activity is just activated after germination (CDKB1;1 and CYCB1;1), and the other with the cell cycle activators from which the associated GUS activity can be detected in dry seeds and throughout germination. Interestingly, this latter class gathers core cell cycle genes implicated in the resumption of cell cycle after a nonproliferative period (CDKA;1 and CYCD4;1). However, GUS activity in dry seeds might not be directly related with the expression of cell cycle genes, but rather result from the activity of residual extant GUS proteins that remained in the dry seed after desiccation. This hypothesis is sustained by the presence of GUS activity in most of the dry embryo tissues instead of a more specific tissue pattern, as expected for the activity of most cell cycle gene promoters. Indeed, after imbibition, GUS activity in pCDKA;1::GUS, pCYCA2;1::GUS, or pCYCD4;1::GUS seeds appears to be gradually reallocated and becomes much more specific to meristematic tissues. Thus, the GUS analysis reveals a clear correlation between root protrusion and initiation or reestablishment of cell cycle gene promoter activity. As a clear example, CYCB1;1 promoter activity is not observed prior to completion of germination. CYCB1;1 is a mitotic cyclin whose expression has been previously demonstrated to be confined to dividing tissues, suggesting that its regulation might be one of the factors for the activation of cell division in some developmental programs, such as the resumption of postembryonic growth. On the contrary, CKS1 promoter activity was not detected in meristematic tissues. The preferential accumulation of GUS activity in the cotyledons could indicate that CKS1At plays a role in the endocycle. However, CKS1 overproduction in Arabidopsis has no effect on the endoreduplication pattern (De Veylder et al., 2001b
The tissue expression analysis observed after GUS activity assays is largely corroborated by the transcript accumulation profiles revealed by RT-PCR analysis. This technique was chosen to confirm and/or complement the tissue expression analysis in Arabidopsis because of its high sensitivity. Expression of CYCD4;1 and CDKA;1 was found to increase abruptly from the instant seed imbibition was initiated until 3 DAI. Based on these expression profiles, both CYCD4;1 and CDKA;1 seem to be necessary for early seed germination and the resumption of embryo growth, being probably implicated in reestablishment of cell cycle activity and preparation for G1-to-S transition. CDKA/CYCD complexes act at G1-to-S transition, being essential for the production of S-phase activators (De Veylder et al., 2003
Similarly, the expression profile of CDKA;1 also suggests that the corresponding protein is implicated in the early reactivation of cell cycle progression in germinating seeds. However, CDKA;1 transcript levels do not necessarily correlate with CDKA;1 protein activity. During cell cycle progression, transcript and protein levels remain constant, while CDKA;1 kinase activity increases throughout S and G2 and peaks at early M phase (Mironov et al., 1999
The RT-PCR results show an expression outbreak of CYCB1;1 and CDKB1;1 that coincides with radicle protrusion, in contrast with that of CDKA;1 and CYCD4;1. CYCB1;1 and CDKB1;1 are required to trigger entry into mitosis, and their activity fairly reflects their temporal expression pattern (Mironov et al., 1999
The spatial pattern of cell cycle gene expression was also extensively analyzed by mRNA in situ localization. For all the genes, transcript accumulation was detected only during or after growth of the radicle through the seed coat, evidencing that the de novo production of most cell cycle proteins mainly takes place after germination is accomplished. Thus, cell division activity per se does not seem to be essential for the initiation of the seed germination process but is required to allow further postgerminative development. This conclusion corroborates previous data revealing that chemical block of replication does not halt radicle protrusion in cabbage, although DNA replication starts roughly halfway through the completion of germination (Górnik et al., 1997
In germinating embryos, the rapid organization of a MT cytoskeleton might be required to accomplish the large rates of cell elongation that precede embryo emergence (de Castro et al., 2000
Two-dimensional gel electrophoresis has been used to analyze the seed proteome and the changes in protein abundance in germinating Arabidopsis seeds (Gallardo et al., 2001
Until now, the contribution of cell cycle regulators to seed germination has been largely neglected, and the molecular aspects concerning the involvement of cell cycle in that important developmental process have been only very poorly characterized. We show that a limited set of cell cycle proteins might be activated very early in the embryo to promote cell cycle progression, allowing a number of embryo cells to initiate DNA replication after only a few hours of imbibition. However, our gene expression results indicate that the de novo production of most cell cycle proteins mainly takes place after root protrusion. Therefore, we postulate that resumption of DNA replication prior to radicle protrusion is induced either by limited protein synthesis from stored mRNAs or by activation of cell cycle proteins already present in the dry seeds. This reduced core of cell cycle proteins initiates DNA replication but is not sufficient to drive cells into mitosis. Entry into M phase occurs only after radicle protrusion, as demonstrated by confocal observations, and might depend on the de novo production of specific cell cycle activators.
Seed Germination Two replicas of approximately 100 seeds of Arabidopsis (Arabidopsis thaliana L. Heyhn.) or white cabbage (Brassica oleracea L. cv Bartolo) were imbibed on triple layers of filter paper saturated with distilled water, which were placed inside 145-mm petri dishes. The seeds were germinated at 22°C to 24°C under a 16-h-light/8-h-dark regime for the time periods specified (DAI or HAI). Seeds were regarded as having completed germination when 1 mm of the radicle had protruded through the seed coat.
Relative DNA content of the seed nuclei was measured in Arabidopsis seeds imbibed from 0 to 72 h. Suspensions of intact nuclei were collected at an 8-h interval. Samples of at least 20 seeds were chopped with a razor blade in ice-cold nucleus isolation buffer (10 mM MgSO4 x 7H2O, 50 mM KCl, 5 mM HEPES, 1 mg mL1 DTT, and 2.5 mg mL1 Triton X-100, 1% [w/v] polyvinylpyrrolidone-40) on ice. The suspension was sieved through an 88-µm nylon mesh. After the samples had been digested with RNAse for 30 min at room temperature, they were stained with propidium iodide (1 mg mL1) for 15 min. DNA analyses were performed with an EPICS XL-MCL flow cytometer (Beckman-Coulter, Miami) equipped with an argon ion laser at 488 nm. The amount of DNA, proportional to the red fluorescent signal, is expressed as arbitrary C values, in which 1C represents the amount of DNA of the unreplicated haploid chromosome. The number of nuclei present in each peak of the histogram (2C, 3C, 4C, 6C, and 8C) was analyzed by measuring the peak area. Histograms were processed with the ModFit LT software (Verity, Turramurra, Australia; http://www.ampl.com.au/vsh_modfit.htm) for data analysis and correction of the background noise, and the volume of each histogram was calculated.
The CYCD4;1 promoter of Arabidopsis (1,189 bp) was isolated by PCR amplification of a genomic DNA template with the primers GGCTGCAGGGGTAAAACAGAAGACAGTATATTTGGG and GGCCATGGCAACAGAGTGTTCATGTAAGAAAAATTGATCC. The amplified promoter fragment was cloned into the pGUS1 vector upstream from the gus (uidA from Escherichia coli) coding sequence, to produce the pGUSCYCD4 plasmid. The CYCD4 promoter-GUS-3'octopine synthase (3'OCS) cassette was excised from the pGUSCYCD4 and ligated into the pBin+ binary vector. Similarly, the Arabidopsis CKS1 promoter (889 bp) also was isolated by PCR amplification of genomic DNA template with specific primers. The amplified promoter fragment was cloned into the pGUS1 vector upstream from the GUS coding sequence, producing the pGUSCKS1 plasmid. The CKS promoter-GUS-3'OCS cassette was excised from the pGUSCKS1 and ligated into the pBin+ binary vector.
The pGUSCYCD4 and pGUSCKS1 constructs in the pBin+ were mobilized into Agrobacterium tumefaciens C58C1RifR (pMP90) and then introduced into Arabidopsis (ecotype Columbia) with the floral dip transformation method (Clough and Bent, 1998
GUS expression was analyzed in germinating seeds of Arabidopsis lines expressing the GUS gene under the control of specific cell cycle gene promoters. In addition to the two gus lines described above, this study was extended to the other cell cycle promoter-GUS lines available in our laboratory, namely those harboring the CDKA;1 promoter (Hemerly et al., 1993 Seeds were imbibed in water for 1, 2, or 3 d (up to 7 d in a few cases) and subjected to GUS enzymatic assays. Dry seeds were imbibed in buffer containing the GUS substrate for 30 min and immediately peeled. After peeling, the embryos were checked for GUS and then further incubated in buffer containing GUS substrate up to 16 h. In the cases for which GUS expression is described as being present in the dry seed, GUS staining was observed immediately after the seeds had been peeled. In general, the patterns observed did not change by longer incubation time.
The histochemical GUS detections were carried out according to standard protocols. Seed embryos and young seedlings were incubated in 90% (v/v) acetone for 2 h at 4°C. After washing in phosphate buffer, the material was immersed in the enzymatic reaction mixture (1 mg mL1 of 5-bromo-4-chloro-3-indolyl-
mRNA in situ localizations were performed in white cabbage imbibed in water for 0, 12, 24, 36, or 48 h, transferred to fixative, and peeled. Dry seeds (time point 0) were placed directly in fixative (3% [w/v] glutaraldehyde in 0.1 M cacodylate buffer, pH 7.2), without any pretreatment, and subsequently peeled. After seed coat removal, all the seeds were transferred to fresh fixative and incubated for an additional 12 to 16 h (at 4°C). Fixed seeds were dehydrated through standard ethanol series and embedded in paraffin. Embedded tissues were sliced into serial 10-µm sections and attached to coated microscope slides. 35S-UTP-labeled sense (control) and antisense RNAs of CYCB1;1, CYCD5;1, CYCD6;1, E2Fb, E2Fa, CDC6, CDC7, CKS1, KRP1, KRP2, and H4 genes were generated by in vitro transcription with SP6 or T7 RNA polymerases, according to the manufacturer's protocol (Roche Diagnostics, Brussels).
Plant material was hybridized overnight at 42°C with the appropriate antisense and control 35S-labeled mRNA probes (5 x 106 cpm per slide). After hybridization, the slides were washed in 2x SSC (1x SSC, 150 mM NaCl, NA3-citrate, pH 7.0) at room temperature for 1 h and in 0.1x SSC/50% (w/v) formamide at 42°C for 1 h. All posthybridization procedures, including RNase treatment and washes, were performed as described by de Almeida Engler et al. (2001)
Germinating seeds and young seedlings of Arabidopsis (ecotype Landsberg erecta) were fixed in phosphate-buffered saline solution containing 0.1% (v/v) Tween 20, 0.08 mM EGTA, 10% (v/v) dimethylsulfoxide, and 5% (w/v) paraformaldehyde. After dehydration, the samples were stored at 20°C until hybridization. RNA probes of CDKA;1, CDKB1;1, E2Fa, CDC7, and CDC6 were labeled with digoxigenin (DIG) by using a nucleic acid-labeling kit according to the manufacturer's instructions (Roche Diagnostics). Prehybridization and hybridization were carried out as described by de Almeida Engler et al. (1998)
Total RNA was extracted from dry mature seeds and seeds at different stages of germination (1, 2, 3, and 4 DAI). Seeds of Arabidopsis (ecotype Columbia; 300 mg initial weight) were imbibed during the necessary time and promptly ground in liquid nitrogen. RNA was extracted as described by Chang et al. (1993) The amount of target cDNA used for PCR was standardized by quantification of UBQ14 transcripts present in all the samples. However, it must be emphasized that ubiquitin levels are not absolutely stable during germination. The UBQ14 relative expression ratio between germinating and dry Arabidopsis seeds is approximately 2.4, as detected by cDNA microarray analysis (L. van der Geest, personal communication). This fluctuation was not considered, and, therefore, the values presented must be regarded as fairly accurate. This analysis does not intend to precisely quantify transcript levels on seeds, but to illustrate the transcription profile of main cell cycle genes during germination. To facilitate the comparison between the different mRNA levels of the four genes analyzed, all values were adjusted to a relative final value of 100 (time point 4 d). This adjustment allowed the graphic representation of transcript fluctuation from the four genes in a single graph and the easy comparison of the respective profiles.
Arabidopsis (ecotype C24) transgenic seeds carrying a chimeric gene containing the GFP gene fused to the MBD of MAP4, under the control of the 35S promoter, were kindly provided by M. Karimi (Ghent University). Transgenic seeds expressing 35S-GFP-MDB were imbibed in water, as described above, and carefully peeled at different time points. For time sequence observations, the seed embryos were sealed in an approximately 2-mm-thick slide chamber (Lab-Tek, Christchurch, New Zealand) containing 1.5% (w/v) low-melting-point agarose (Sigma-Aldrich, St. Louis). This environment allowed the normal development of seed embryos for at least 48 h, as confirmed by the imaging of freshly peeled seeds after imbibition in water for the same time period. The rearrangement of the MTs was recorded at the peripheral epidermal cell layer of the embryo organs. Images were obtained by confocal laser scanning microscopy LSM510 (Zeiss) with an argon laser for 488 nm excitation, a 505 to 530 nm emission filter, and a water immersion 63x Plan-Apochromat objective, with exception of Figure 5G, which was obtained with a 10x Plan-Neofluar objective. Images of embryo epidermal cells are presented as single sections or as Z-stacks of consecutive sections as stated in the figure legend.
Upon request, all novel materials described in this publication will be made available in a timely manner for noncommercial research purposes, subject to the requisite permission from any third-party owners of all or parts of the material. Obtaining any permission will be the responsibility of the requestor.
The authors would like to thank Mansour Karimi and Bejo Zaden (Warmenhuizen, The Netherlands) for providing the p35S::MBD::GFP transgenic Arabidopsis seeds and the cabbage seeds, respectively; Wim Van Caeneghem for skillful assistance with real-time PCR analysis; and Martine De Cock for help in preparing the manuscript and the anonymous reviewers whose suggestions helped improve it. Received July 8, 2004; returned for revision October 8, 2004; accepted October 12, 2004.
1 This work was supported by the European Community (Fisheries, Agricultural and Agro-Industrial Research project; grant no. CT973711), by the Interuniversity Poles of Attraction Programme-Belgian Science Policy (P5/13), and by the Fund for Scientific Research-Flanders (postdoctoral fellowship to L.D.V.).
2 Present address: Agricultural Research Centre, Department of Crop Protection, B9820 Merelbeke, Belgium.
3 Present address: Department for Plant Health and the Environment, Institut National de la Recherche Agronomique, F06606 Antibes, France. Article, publication date, and citation information can be found at www.plantphysiol.org/cgi/doi/10.1104/pp.104.049361. * Corresponding author; e-mail dirk.inze{at}psb.ugent.be; fax 3293313809.
Azimzadeh J, Traas J, Pastuglia M (2001) Molecular aspects of microtubule dynamics in plants. Curr Opin Plant Biol 4: 513519[CrossRef][Medline]
Boudolf V, Barrôco R, de Almeida Engler J, Verkest A, Beeckman T, Naudts M, Inzé D, De Veylder L (2004) B1-type cyclin-dependent kinases are essential for the formation of stomatal complexes in Arabidopsis thaliana. Plant Cell 16: 945955 Burssens S, de Almeida Engler J, Beeckman T, Richard C, Shaul O, Ferreira P, Van Montagu M, Inzé D (2000) Developmental expression of the Arabidopsis thaliana CycA2;1 gene. Planta 211: 623631[CrossRef][Web of Science][Medline] Chang S, Puryear J, Cairney J (1993) A simple and efficient method for isolating RNA from pine trees. Plant Mol Biol Rep 11: 113116 Clough SJ, Bent AF (1998) Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J 16: 735743[CrossRef][Web of Science][Medline] Cruz-García F, Zúñiga-Aguilar JJ, Vázquez-Ramos JM (1998) Effect of stimulating maize germination on cell cycle proteins. Physiol Plant 102: 573581[CrossRef] de Almeida Engler J, De Groodt R, Van Montagu M, Engler G (2001) In situ hybridization to mRNA of Arabidopsis tissue sections. Methods 23: 325334[CrossRef][Web of Science][Medline]
de Almeida Engler J, De Vleesschauwer V, Burssens S, Celenza JL Jr, Inzé D, Van Montagu M, Engler G, Gheysen G (1999) Molecular markers and cell cycle inhibitors show the importance of cell cycle progression in nematode-induced galls and syncytia. Plant Cell 11: 793807 de Almeida Engler J, Van Montagu M, Engler G (1998) Whole-mount in situ hybridization in plants. In JM Martínez-Zapater, J Salinas, eds, Arabidopsis Protocols, Methods in Molecular Biology, Vol 82. Humana Press, Totowa, pp 373384 de Castro RD, Bino RJ, Jing H-C, Kieft H, Hilhorst HWM (2001) Depth of dormancy in tomato (Lycopersicon esculentum Mill.) seeds is related to the progression of the cell cycle prior to the induction of dormancy. Seed Sci Res 11: 4554
de Castro RD, Hilhorst HWM, Bergervoet JHW, Groot SPC, Bino RJ (1998) Detection of
de Castro RD, van Lammeren AAM, Groot SPC, Bino RJ, Hilhorst HWM (2000) Cell division and subsequent radicle protrusion in tomato seeds are inhibited by osmotic stress but DNA synthesis and formation of microtubular cytoskeleton are not. Plant Physiol 122: 327335
de Castro RD, Zheng X, Bergervoet JHW, De Vos CHR, Bino RJ (1995)
De Veylder L, Beeckman T, Beemster GTS, Krols L, Terras F, Landrieu I, Van Der Schueren E, Maes S, Naudts M, Inzé D (2001a) Functional analysis of cyclin-dependent kinase inhibitors of Arabidopsis. Plant Cell 13: 16531667 De Veylder L, Beemster GTS, Beeckman T, Inzé D (2001b) CKS1At overexpression in Arabidopsis thaliana inhibits growth by reducing meristem size and inhibiting cell-cycle progression. Plant J 25: 617626[CrossRef][Web of Science][Medline] De Veylder L, Joubès J, Inzé D (2003) Plant cell cycle transitions. Curr Opin Plant Biol 6: 536543[CrossRef][Web of Science][Medline] Dewitte W, Murray JAH (2003) The plant cell cycle. Annu Rev Plant Biol 54: 235264[CrossRef][Medline]
Ferreira PCG, Hemerly AS, de Almeida Engler J, Van Montagu M, Engler G, Inzé D (1994) Developmental expression of the Arabidopsis cyclin gene cyc1At. Plant Cell 6: 17631774
Fujikura Y, Dole
Gallardo K, Job C, Groot SPC, Puype M, Demol H, Vandekerckhove J, Job D (2001) Proteomic analysis of Arabidopsis seed germination and priming. Plant Physiol 126: 835848
Girke T, Todd J, Ruuska S, White J, Benning C, Ohlrogge J (2000) Microarray analysis of developing Arabidopsis seeds. Plant Physiol 124: 15701581 Górnik K, de Castro RD, Liu Y, Bino RJ, Groot SPC (1997) Inhibition of cell division during cabbage (Brassica oleracea L.) seed germination. Seed Sci Res 7: 333340 Groot SPC, de Castro RD, Liu Y, Bino RJ (1997) Cell cycle analysis in dormant and germinating tomato seeds. In RH Ellis, M Black, AJ Murdoch, TD Hong, eds, Basic and Applied Aspects of Seed Biology. Kluwer Academic Publishers, Dordrecht, The Netherlands, pp 395402 Gutierrez C, Ramirez-Parra E, Castellano MM, del Pozo JC (2002) G1 to S transition: more than a cell cycle engine switch. Curr Opin Plant Biol 5: 480486[CrossRef][Web of Science][Medline] Hasezawa S, Kumagai F (2002) Dynamic changes and the role of the cytoskeleton during the cell cycle in higher plant cells. Int Rev Cytol 214: 161191[Web of Science][Medline] Hemerly AS, Ferreira P, de Almeida Engler J, Van Montagu M, Engler G, Inzé D (1993) cdc2a expression in Arabidopsis is linked with competence for cell division. Plant Cell 5: 17111723[Abstract] Herrera-Teigeiro I, Jiménez-García LF, Vázquez-Ramos JM (1999) Benzyladenine promotes early activation of p34cdc2-like kinase(s) during maize germination. Seed Sci Res 9: 5562
Jing H-C, van Lammeren AAM, de Castro RD, Bino RJ, Hilhorst HWM, Groot SPC (1999) Liu Y, Bergervoet JHW, De Vos CHR, Hilhorst HWM, Kraak HL, Karssen CM, Bino RJ (1994) Nuclear replication activities during imbibition of abscisic acid- and gibberellin-deficient tomato (Lycopersicon esculentum Mill.) seeds. Planta 194: 368373[Web of Science] Lloyd C, Hussey P (2001) Microtubule-associated proteins in plantswhy we need a map. Nat Rev Mol Cell Biol 2: 4047[CrossRef][Web of Science][Medline] Mansfield SG, Briarty LG (1996) The dynamics of seedling and cotyledon cell development in Arabidopsis thaliana during reserve mobilization. Int J Plant Sci 157: 280295[CrossRef] Menges M, Hennig L, Gruissem W, Murray JAH (2003) Genome-wide gene expression in an Arabidopsis cell suspension. Plant Mol Biol 53: 423442[CrossRef][Web of Science][Medline] Menges M, Murray JA (2002) Synchronous Arabidopsis suspension cultures for analysis of cell-cycle gene activity. Plant J 30: 203212[CrossRef][Web of Science][Medline]
Mironov V, De Veylder L, Van Montagu M, Inzé D (1999) Cyclin-dependent kinases and cell division in higher plantsthe nexus. Plant Cell 11: 509521 Nishitani H, Lygerou Z (2002) Control of DNA replication licensing in a cell cycle. Genes Cells 7: 523534[Abstract] Rossi V, Varotto S (2002) Insights into the G1/S transition in plants. Planta 215: 345356[CrossRef][Web of Science][Medline] Wang H, Zhou Y, Gilmer S, Whitwill S, Fowke LC (2000) Expression of the plant cyclin-dependent kinase inhibitor ICK1 affects cell division, plant growth and morphology. Plant J 24: 613623[CrossRef][Web of Science][Medline]
Wasteneys GO (2002) Microtubule organization in the green kingdom: chaos or self-order? J Cell Sci 115: 13451354 This article has been cited by other articles:
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ASPB Publications | PLANT PHYSIOLOGY® | THE PLANT CELL | |
|---|---|---|---|