| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
|
First published online December 23, 2004; 10.1104/pp.104.051987 Plant Physiology 137:199-208 (2005) © 2005 American Society of Plant Biologists Manipulation of the Blue Light Photoreceptor Cryptochrome 2 in Tomato Affects Vegetative Development, Flowering Time, and Fruit Antioxidant Content1Ente per le Nuove tecnologie, l'Energia e l'Ambiente (ENEA), Casaccia Research Center, Rome 00100AD, Italy (L.G., M.T., A.F., G.G.); ENEA, Trisaia Research Center, 75026 Rotondella (MT), Italy (G.P., P.P.); School of Plant Science, University of Tasmania, Hobart, Tasmania 7001, Australia (J.L.W.); and School of Biological Sciences, Royal Holloway, University of London, Egham, Surrey TW20 OEX, United Kingdom (P.D.F., P.M.B.)
Cryptochromes are blue light photoreceptors found in plants, bacteria, and animals. In Arabidopsis, cryptochrome 2 (cry2) is involved primarily in the control of flowering time and in photomorphogenesis under low-fluence light. No data on the function of cry2 are available in plants, apart from Arabidopsis (Arabidopsis thaliana). Expression of the tomato (Solanum lycopersicum) CRY2 gene was altered through a combination of transgenic overexpression and virus-induced gene silencing. Tomato CRY2 overexpressors show phenotypes similar to but distinct from their Arabidopsis counterparts (hypocotyl and internode shortening under both low- and high-fluence blue light), but also several novel ones, including a high-pigment phenotype, resulting in overproduction of anthocyanins and chlorophyll in leaves and of flavonoids and lycopene in fruits. The accumulation of lycopene in fruits is accompanied by the decreased expression of lycopene  -cyclase genes. CRY2 overexpression causes an unexpected delay in flowering, observed under both short- and long-day conditions, and an increased outgrowth of axillary branches. Virus-induced gene silencing of CRY2 results in a reversion of leaf anthocyanin accumulation, of internode shortening, and of late flowering in CRY2-overexpressing plants, whereas in wild-type plants it causes a minor internode elongation.
Cryptochromes are flavin-containing blue light photoreceptors, first discovered in plants. The first cryptochrome gene was isolated through the insertional cloning of an Arabidopsis (Arabidopsis thaliana) mutant allelic to hy4 (Ahmad and Cashmore, 1993  ). Our knowledge of the function of higher plant cryptochromes relies almost exclusively on the study of a single plant, Arabidopsis. Arabidopsis contains at least three cryptochromes, two (cryptochrome 1 [cry1] and cry2) localized predominantly in the nucleus and the cytoplasm (Lin and Shalitin, 2003) and one (cry3) in the organelles (Kleine et al., 2003). Functional characterization of Arabidopsis mutants has shown that cry1 is mainly involved in the control of photomorphogenesis, including hypocotyl elongation and anthocyanin biosynthesis, while cry2 is mainly involved in the control of flowering time and of hypocotyl elongation (Guo et al., 1998; Lin et al., 1998; Lin and Shalitin, 2003). The role of cry2 in Arabidopsis is strictly dependent on light fluence and photoperiod; cry2– mutants and CRY2 overexpressors have, respectively, long and short hypocotyls under low, but not high, blue light intensities. cry2– mutants flower later than the wild type in long-day but not short-day conditions, and CRY2 overexpressors flower earlier than the wild type in short-day but not long-day conditions (Guo et al., 1998; Lin and Shalitin, 2003). A naturally found, gain-of-function allele of CRY2 is responsible for the early flowering in short days of the Cape Verde ecotype of Arabidopsis, with respect to its northern European counterparts (El-Din El-Assal et al., 2001, 2003).
The developmental patterns of Arabidopsis and tomato (Solanum lycopersicum) are different. Arabidopsis shows a monopodial type of growth (Schmitz and Theres, 1999
Another fundamental difference between the two plants is the development of a fleshy fruit in tomato, whose function is to attract animals involved in seed dispersion. After a period of cell division and cell expansion, leading to the mature green stage, the fruit undergoes a series of changes, controlled by ethylene and collectively known as ripening, which involve the transformation of chloroplasts into chromoplasts (containing high levels of the linear carotene lycopene), the softening of the fruit, and the accumulation of a series of compounds increasing fruit palatability. At the gene expression level, this change involves the differential regulation of genes involved in the biosynthesis of ethylene, carotenoids, and the degradation of cell wall components (Giovannoni, 2001
We have started the molecular and functional characterization of the tomato cryptochrome gene family. To date, two CRY1, one CRY2, and one CRY3 gene have been isolated in tomato (Perrotta et al., 2000
Effects of CRY2 Overexpression on Vegetative Growth
To alter the expression of CRY2, we transformed tomato (cv Moneymaker) with a 35S::CRY2 construct carrying the tomato CRY2 cDNA (Perrotta et al., 2000
We then grew CRY2-overexpressing (CRY2-OX) plants under high-irradiance white light (40 µmol m–2 s–1) in a long-day photoperiod (16 h light/8 h dark). These plants showed several additional phenotypes. The seedlings accumulated high levels of anthocyanins in all organs, including roots (Fig. 2D). Adult plants were dwarfed (Fig. 2A), had darker green leaves with anthocyanin-accumulating veins (Fig. 2B), and showed an abnormal outgrowth of axillary meristems (Fig. 2C). Spectrophotometric measurements indicated a generalized pigment increase in leaves of the transgenic lines, very evident (up to 3-fold) for anthocyanins and less so for chlorophylls and carotenoids (Fig. 3, A–C). The internodes of adult plants were significantly shorter (Figs. 2C and 3D).
Homozygous transgenic seed populations were obtained from lines 52.3 and 52.8 and germinated under different light qualities and intensities. CRY2-OX seedlings showed, with respect to their wild-type counterparts, reduced hypocotyl length and elevated anthocyanin content when grown under white and blue but not red light (Fig. 4, A and B). Increasing the fluence rate (from 2–16 µmol m–2 s–1 for blue and from 5–40 µmol m–2 s–1 for white) magnified both responses in CRY2-OX seedlings. The strongest responses, both for hypocotyl shortening and for anthocyanin accumulation, were observed under high-irradiance white light, suggesting that blue light alone is insufficient for complete responses. Under these conditions, ll organs of CRY2-OX seedlings, including roots, showed strong anthocyanin pigmentation (Fig. 2D).
Collectively, these results indicate that CRY2 overexpression in tomato produces a series of alterations in vegetative growth, some of which (hypocotyl shortening under high irradiances, anthocyanin accumulation, and dwarfism of adult plants) are more similar to those of Arabidopsis CRY1, rather than CRY2, overexpressors (Lin et al., 1996 , 1998). Yet another phenotype (induction of axillary branch growth) has not been described before in Arabidopsis CRY1 or CRY2 overexpressors, whereas tomato cry1– mutants show decreased growth of axillary branches (Weller et al., 2001). These observations suggest that, in tomato, both cry1 and cry2 play stimulatory roles in the growth of axillary branches.
In Arabidopsis, cry2 plays a major role in the control of flowering time; cry2– mutants flower later than the wild type under long but not short days, and CRY2 overexpressors flower earlier than the wild-type under short but not long days (Guo et al., 1998 Surprisingly, all three CRY2-OX lines show retardation, instead of anticipation, of flowering under both short and long days (Table I). This retardation in time, however, does not correspond to a change in the number of vegetative metamers that are formed before the first inflorescence appears (Table I).
Effects on Fruit Antioxidants
Tomato fruit pigmentation is influenced by light perceived from the environment. Fruit-localized phytochromes positively influence the accumulation of lycopene (Alba et al., 2000 Upon visual inspection, fruits of the three CRY2-OX lines show increased pigmentation, both at the immature green and at the red ripe stage (Fig. 2, E and F). We spectrophotometrically measured the levels of lycopene, the major red pigment and lipophilic antioxidant in tomato fruits, at the red ripe stage. The data show an approximately 1.5- to 2-fold increase in this pigment (Fig. 3E).
The pigment (carotenoid and flavonoid) content of the pericarp of red ripe fruits of line 52.3 was also analyzed by HPLC (Table II). Again, lycopene shows a significant (1.7-fold) increase, with other carotenoids (
It has been shown previously that accumulation of lycopene in ripening tomato fruits is associated with the increase in transcript levels of lycopene biosynthetic genes, like phytoene synthase 1 (Psy1) and phytoene desaturase (Pds; Giuliano et al., 1993 ), and the repression of lycopene-catabolizing genes like lycopene -cyclase (-Lcy; Pecker et al., 1996). The mRNA levels of these genes, as well as of other genes for carotenoid biosynthesis and of cryptochrome genes, were measured at the red ripe stage through RT-QPCR. Transcripts involved in lycopene synthesis (Psy1, Zds), as well as CRY1a and CRY1b transcripts, do not show significant variations in CRY2-OX fruits with respect to their wild-type counterparts (Table III). Actually, the Pds transcript shows a slight repression instead of an induction, consistent with the model that we had previously proposed, i.e. that the activity of the Pds promoter is feedback regulated by carotenoid levels (Corona et al., 1996). Instead, transcripts of the two genes involved in lycopene cyclization (-Lcy, B) show an approximately 2-fold repression in CRY2-OX fruits. We and others have shown previously that fruit-specific silencing of either of the two transcripts (-Lcy or B) results in increased lycopene levels (Ronen et al., 2000; Rosati et al., 2000). Thus, the data are consistent with the idea that CRY2 overexpression increases fruit lycopene content through the repression of lycopene cyclase genes rather than through the induction of earlier genes in the carotenoid pathway.
Virus-Induced Gene Silencing
VIGS has been advocated as a tool for large-scale functional genomics in plants (Baulcombe, 1999
The silencing of the CRY2 transgene in CRY2-OX plants was accompanied by a reversion of several of the CRY2-OX phenotypes: three phenotypes that were clearly suppressed by silencing but not by infection with PVX alone were internode shortening (Figs. 2G and 5A), anthocyanin pigmentation of leaf veins (Fig. 2H), and late flowering (Fig. 5B). Infection with PVX alone caused a significant degree of internode shortening both in wild-type and CRY2-OX plants (Fig. 5A). Therefore, the minor internode elongation observed in CRY2-silenced, wild-type plants (Fig. 5A) is probably the result of two contrasting effects: internode shortening induced by PVX infection and internode elongation induced by silencing of CRY2. No clear effects of CRY2 silencing on flowering time of wild-type plants were observed. The lateral branching phenotype was also suppressed in silenced plants. However, the interpretation of the data was complicated by the fact that infection with PVX alone has a clear inhibitory effect on the growth of axillary branches (data not shown).
In Arabidopsis, cry2 plays multiple roles in regulating photomorphogenesis at low irradiances and flowering time (Lin and Shalitin, 2003 ; Yanovsky and Kay, 2003). CRY2 overexpression in tomato results in several photomorphogenic and flowering phenotypes, some of which are expected on the basis of the experience gained with Arabidopsis while others are novel (Fig. 6). Similar to their Arabidopsis counterparts, tomato CRY2 overexpressors show a light quality-dependent short-hypocotyl phenotype under low irradiances (Lin et al., 1998). However, the enhancement of the short-hypocotyl phenotype at high irradiances, the anthocyanin accumulation, and the dwarfism of adult plants observed in CRY2-OX tomato are associated with CRY1, rather than CRY2, overexpression in Arabidopsis (Lin et al., 1996, 1998). We have previously shown that impairment of tomato cry1a function reduces anthocyanin levels and increases internode and hypocotyl length (Ninu et al., 1999; Weller et al., 2001). The presence of cry1-like phenotypes in cry2-overexpressing lines suggests that cry2 plays roles partially redundant with those of cry1 in the control of tomato photomorphogenesis.
The pigment content of CRY2-OX leaves and fruits suggests that cry2 controls some aspect of pigment biosynthesis/accumulation. It is possible that this control is at least partially exerted at the transcriptional level. We had previously shown that the Arabidopsis nuclear Psy gene, encoding the first dedicated step in the plastid-localized carotenoid biosynthesis pathway, is positively regulated by blue light through an unidentified photoreceptor (von Lintig et al., 1997 ). CRY2 overexpression in tomato increases flavonoid and lycopene levels in ripe fruits. This phenotype is reminiscent of the tomato high pigment mutants hp1 and hp2, which display shortened hypocotyls and internodes, anthocyanin accumulation, and highly pigmented fruits. Hp1 and Hp2 encode the tomato orthologs of negative regulators of light signal transduction in Arabidopsis: Det1 and Ddb1 (Mustilli et al., 1999; Liu et al., 2004). Our data suggest that, consistent with the observed accumulation of lycopene, Cry2 overexpression represses two genes in the carotenoid biosynthetic pathway (lycopene -cyclases) in fruits. Previous findings had indicated that transgenic silencing of these genes results in increased fruit lycopene levels (Ronen et al., 2000; Rosati et al., 2000). Microarray profiling of CRY2-OX plants is under way to determine which genes, in pigment biosynthesis as well as in different biochemical pathways, are regulated by CRY2 overexpression.
Several laboratories, including ours, have achieved the targeted increase in tomato fruits of individual antioxidant compounds, such as the carotenoids lycopene,
Flowering time is an important trait, influencing both the time it takes for a plant to reproduce in the wild and the time it takes to produce harvestable fruits and seeds for human consumption. In Arabidopsis, a long-day plant, the photoreceptors cry2 and phytochrome A act positively and phytochrome B acts negatively to regulate flowering in response to light (Koornneef et al., 1998
Another important agricultural trait is axillary branching. In tomato, the excessive outgrowth of axillary branches negatively affects fruit production so that they have to be manually removed, increasing labor costs. Mutants in some tomato genes, such as lateral suppressor, prevent the initiation of axillary meristems (Schumacher et al., 1999
This is the first time, to our knowledge, that VIGS has been used to functionally study a plant photosensory receptor. In some cases (flowering time, internode length, anthocyanin accumulation), VIGS clearly reverted the CRY2-OX phenotypes, whereas PVX infection did not. In other cases (chlorophyll and carotenoid accumulation, lateral branching), PVX infection itself interfered with the phenotypes studied, complicating the interpretation of the results. Two other drawbacks of the PVX system are its inherent instability in tomato, the low levels of silencing obtained in wild-type plants, and the variable silencing observed in fruits. Other silencing vectors have now been developed, which may overcome some of these problems (Liu et al., 2002
In conclusion, cry2 is a central player in tomato development. Its manipulation through transgenic overexpression and VIGS results in the alteration of a large set of developmental and biochemical responses both in vegetative and reproductive tissues (Fig. 6). In Arabidopsis, cry2 controls photomorphogenic responses through the interaction with the photomorphogenic repressor Cop1, resulting in a modulation of Hy5 abundance (Wang et al., 2001
Standard molecular biology protocols were followed as described (Sambrook et al., 1989 ). The CRY2 full-length cDNA of tomato (Solanum lycopersicum; Perrotta et al., 2000) was cloned in the SmaI and SacI sites of the Agrobacterium-based vector pBI121 (Jefferson et al., 1987), under the control of the cauliflower mosaic virus 35S promoter. Agrobacterium-mediated transformation was performed according to a published protocol (van Roekel et al., 1993). To establish truly independent transformation events, only one regenerant was taken from every cocultivated tomato explant. For fruit and seed production, plants were grown in the greenhouse under controlled conditions (16 h light, 25°C:8 h dark, 20°C). All germination and growth experiments were conducted in growth chambers at a constant temperature of 25°C. Light sources were as follows: white was provided by Osram (Munich) 11-860 lamps and Osram Fluora 77 lamps (2:1 ratio). Blue was provided by Osram 67 lamps, additionally filtered through a Lee (Hampshire, UK) Dark Blue plastic filter (ref. 119). Red was provided by Osram 60 lamps, additionally filtered through a Lee Primary Red plastic filter (ref. 106). Irradiances were adjusted by using Lee neutral density filters to 40 and 5 µmol m–2 s–1 (high and low irradiance) for white, and 15 and 2 µmol m–2 s–1 (high and low irradiance) for blue and red. Seeds were harvested from ripe fruits (10–15 d after breaker stage), treated for 20 min in 100 mM HCl, washed extensively in tap water, dried overnight on filter paper, and stored at room temperature in capped tubes over silica gel. For measuring hypocotyl lengths, seeds were imbibed on two layers of filter paper, moistened with tap water, in Magenta boxes (Sigma, Milan). Germination was induced with 16 h of high-fluence white light, ensuring a homogeneous germination rate. The seeds were transferred under the various light conditions for 7 d. Data (pigment content, HPLC profiles, internode length, days to anthesis, transcript levels) were collected from at least three independent experimental replicates. For hypocotyl length, at least 12 seedlings per experiment were measured in duplicate experiments.
Total RNA was isolated using a published protocol (Lopez-Gomez and Gomez-Lim, 1992
The protocol of Porra (Porra et al., 1989
For HPLC determinations, flavonoids, phenylpropanoids, and carotenoids were extracted from freeze-dried ripe tomato fruit (skin and pericarp tissue). A homogenous powder was created by homogenization in a freezer-mill (6750) apparatus (Glen Creston, Middlesex, UK). Carotenoids were extracted from 100 mg of freeze-dried powder as described by Fraser et al. (2000) Flavonoids (including glycone derivatives) and phenylpropanoids were extracted from freeze-dried powder (50 mg) with methanol (1 mL) containing salicylic acid (20 µg) as the internal standard. The mixtures were incubated at 90°C for 60 min. After cooling on ice, the suspensions were centrifuged at 3,500 rpm for 5 min. The resulting supernatants were removed and passed through a 0.4-µm filter. Separation and identification of flavonoids and phenylpropanoids was performed using a Dionex HPLC system with online photodiode array detection (Dionex, Camberley, Berks, UK). A C18 reverse-phase column (250 x 4.6 mm with 25 x 4.6-mm guard column from Hichrom, Berks, UK) maintained at 25°C was used to separate component flavonoids and phenylpropanoids. The mobile phases consisted of 2% aqueous methanol containing 0.015% HCl (A) and acetonitrile (B). Initial chromatographic conditions consisted of 95% A and 5% B for 10 min, followed by a linear gradient to 50% B over 30 min. Identification was achieved by cochromatography and comparison of spectral characteristics with authentic standards. Quantitation was achieved from dose-response curves created with authentic standards.
For PVX::CRY2 construction, the 3' nontranslated region of the tomato CRY2 cDNA was amplified using the oligonucleotides AGATCGATCAGCTGTGAATACTTCACAT and ACGCGTCGACAGGATATCGTCATTCCACT (introducing ClaI and SalI restriction sites at the ends of the molecule) and cloned in the ClaI and SalI sites of the pPVX201 plasmid (Baulcombe et al., 1995 For PVX infection, 2-week-old plants grown under long-day conditions were transferred to the dark for 6 to 7 h before inoculation. Two leaves per plant were inoculated, each with 20 µL of a solution containing 10 mg/mL plasmid DNA, 50 mM KH2PO4, pH 7.0, and 0.5% (w/v) Celite type 45, 10 to 40 µm (Serva, Heidelberg). After gentle rubbing with a glass spatula and brief (10 min) drying, the leaves were gently washed with tap water and the plants transferred to the dark overnight, before starting the normal light cycle. Upon request, all novel materials described in this publication will be made available in a timely manner for noncommercial research purposes, subject to the requisite permission from any third-party owners of all or parts of the material. Obtaining any permissions will be the responsibility of the requestor.
We thank David Baulcombe for the kind gift of the pPVX201 plasmid and Roberto Bassi for suggesting the Porra formulas for chlorophyll measurements. L.G. acknowledges the supervision of Prof. Laura Spano, University of L'Aquila, for his doctoral work. Received August 18, 2004; returned for revision November 5, 2004; accepted November 8, 2004.
1 This work was supported by the European Union (research contract no. QLK3–2000–00809) and by the Italian Ministry of Research, Special Funds for Basic Research (project no. RBNE01CFKB_010) and for Strategic Research (project Genefun). L.G. acknowledges the financial support of BIOGEN SrL.  Article, publication date, and citation information can be found at www.plantphysiol.org/cgi/doi/10.1104/pp.104.051987. * Corresponding author; e-mail giuliano{at}casaccia.enea.it, fax 39–06–30483215.
Ahmad M, Cashmore AR (1993) HY4 gene of A. thaliana encodes a protein with characteristics of a blue-light photoreceptor. Nature 366: 162–166[CrossRef][Medline]
Alba R, Cordonnier-Pratt MM, Pratt LH (2000) Fruit-localized phytochromes regulate lycopene accumulation independently of ethylene production in tomato. Plant Physiol 123: 363–370 Angell SM, Baulcombe DC (1999) Technical advance: potato virus X amplicon-mediated silencing of nuclear genes. Plant J 20: 357–362[Web of Science][Medline] Baulcombe DC (1999) Fast forward genetics based on virus-induced gene silencing. Curr Opin Plant Biol 2: 109–113[CrossRef][Web of Science][Medline] Baulcombe DC, Chapman S, Santa Cruz S (1995) Jellyfish green fluorescent protein as a reporter for virus infections. Plant J 7: 1045–1053[CrossRef][Web of Science][Medline] Booker J, Auldridge M, Wills S, McCarty D, Klee H, Leyser O (2004) MAX3/CCD7 is a carotenoid cleavage dioxygenase required for the synthesis of a novel plant signaling molecule. Curr Biol 14: 1232–1238[CrossRef][Web of Science][Medline]
Bovy A, de Vos R, Kemper M, Schijlen E, Almenar Pertejo M, Muir S, Collins G, Robinson S, Verhoeyen M, Hughes S, et al (2002) High-flavonol tomatoes resulting from the heterologous expression of the maize transcription factor genes LC and C1. Plant Cell 14: 2509–2526 Chatfield SP, Stirnberg P, Forde BG, Leyser O (2000) The hormonal regulation of axillary bud growth in Arabidopsis. Plant J 24: 159–169[CrossRef][Web of Science][Medline] Corona V, Aracri B, Kosturkova G, Bartley GE, Pitto L, Giorgetti L, Scolnik PA, Giuliano G (1996) Regulation of a carotenoid biosynthesis gene promoter during plant development. Plant J 9: 505–512[CrossRef][Web of Science][Medline] Dharmapuri S, Rosati C, Pallara P, Aquilani R, Bouvier F, Camara B, Giuliano G (2002) Metabolic engineering of xanthophyll content in tomato fruits. FEBS Lett 519: 30–34[CrossRef][Web of Science][Medline] El-Din El-Assal S, Alonso-Blanco C, Peeters AJ, Raz V, Koornneef M (2001) A QTL for flowering time in Arabidopsis reveals a novel allele of CRY2. Nat Genet 29: 435–440[CrossRef][Web of Science][Medline]
El-Din El-Assal S, Alonso-Blanco C, Peeters AJ, Wagemaker C, Weller JL, Koornneef M (2003) The role of cryptochrome 2 in flowering in Arabidopsis. Plant Physiol 133: 1504–1516 Faiss M, Zalubilova J, Strnad M, Schmulling T (1997) Conditional transgenic expression of the ipt gene indicates a function for cytokinins in paracrine signaling in whole tobacco plants. Plant J 12: 401–415[CrossRef][Web of Science][Medline] Fraser PD, Pinto ME, Holloway DE, Bramley PM (2000) Technical advance: application of high-performance liquid chromatography with photodiode array detection to the metabolic profiling of plant isoprenoids. Plant J 24: 551–558[CrossRef][Web of Science][Medline]
Fraser PD, Romer S, Shipton CA, Mills PB, Kiano JW, Misawa N, Drake RG, Schuch W, Bramley PM (2002) Evaluation of transgenic tomato plants expressing an additional phytoene synthase in a fruit-specific manner. Proc Natl Acad Sci USA 99: 1092–1097 Giovannoni J (2001) Molecular biology of fruit maturation and ripening. Annu Rev Plant Physiol Plant Mol Biol 52: 725–749[CrossRef][Web of Science][Medline] Giuliano G, Bartley GE, Scolnik PA (1993) Regulation of carotenoid biosynthesis during tomato development. Plant Cell 5: 379–387[Abstract]
Guo H, Yang H, Mockler TC, Lin C (1998) Regulation of flowering time by Arabidopsis photoreceptors. Science 279: 1360–1363 Hayama R, Yokoi S, Tamaki S, Yano M, Shimamoto K (2003) Adaptation of photoperiodic control pathways produces short-day flowering in rice. Nature 422: 719–722[CrossRef][Medline]
Izawa T, Oikawa T, Sugiyama N, Tanisaka T, Yano M, Shimamoto K (2002) Phytochrome mediates the external light signal to repress FT orthologs in photoperiodic flowering of rice. Genes Dev 16: 2006–2020 Jefferson AR, Kavanagh TA, Bevan MW (1987) GUS fusion: beta-glucuronidase as a sensitive and versatile gene fusion marker in higher plants. EMBO J 6: 3901–3907[Web of Science][Medline] Kleine T, Lockhart P, Batschauer A (2003) An Arabidopsis protein closely related to Synechocystis cryptochrome is targeted to organelles. Plant J 35: 93–103[CrossRef][Web of Science][Medline] Koornneef M, Alonso-Blanco C, Peeters AJM, Soppe W (1998) Genetic control of flowering time in Arabidopsis. Annu Rev Plant Physiol 49: 345–370[CrossRef][Web of Science] Lin C, Ahmad M, Cashmore AR (1996) Arabidopsis cryptochrome 1 is a soluble protein mediating blue light-dependent regulation of plant growth and development. Plant J 10: 893–902[CrossRef][Web of Science][Medline] Lin C, Shalitin D (2003) Cryptochrome structure and signal transduction. Annu Rev Plant Biol 54: 469–496[CrossRef][Medline]
Lin C, Yang H, Guo H, Mockler T, Chen J, Cashmore AR (1998) Enhancement of blue-light sensitivity of Arabidopsis seedlings by a blue light receptor cryptochrome 2. Proc Natl Acad Sci USA 95: 2686–2690
Liu Y, Roof S, Ye Z, Barry C, van Tuinen A, Vrebalov J, Bowler C, Giovannoni J (2004) Manipulation of light signal transduction as a means of modifying fruit nutritional quality in tomato. Proc Natl Acad Sci USA 101: 9897–9902 Liu Y, Schiff M, Dinesh-Kumar SP (2002) Virus-induced gene silencing in tomato. Plant J 31: 777–786[CrossRef][Web of Science][Medline]
Lopez-Gomez R, Gomez-Lim MA (1992) A method for extracting intact RNA from fruits rich in polysaccharides using ripe mango mesocarp. HortScience 27: 440–442
Mockler T, Yang H, Yu X, Parikh D, Cheng YC, Dolan S, Lin C (2003) Regulation of photoperiodic flowering by Arabidopsis photoreceptors. Proc Natl Acad Sci USA 100: 2140–2145 Muir SR, Collins GJ, Robinson S, Hughes S, Bovy A, Ric De Vos CH, van Tunen AJ, Verhoeyen ME (2001) Overexpression of petunia chalcone isomerase in tomato results in fruit containing increased levels of flavonols. Nat Biotechnol 19: 470–474[CrossRef][Web of Science][Medline]
Mustilli AC, Fenzi F, Ciliento R, Alfano F, Bowler C (1999) Phenotype of the tomato high pigment-2 mutant is caused by a mutation in the tomato homolog of DEETIOLATED1. Plant Cell 11: 145–157 Niggeweg R, Michael AJ, Martin C (2004) Engineering plants with increased levels of the antioxidant chlorogenic acid. Nat Biotechnol 22: 746–754[CrossRef][Web of Science][Medline] Ninu L, Ahmad M, Miarelli C, Cashmore AR, Giuliano G (1999) Cryptochrome 1 controls tomato development in response to blue light. Plant J 18: 551–556[CrossRef][Web of Science][Medline] Pecker I, Gabbay R, Cunningham FX Jr, Hirschberg J (1996) Cloning and characterization of the cDNA for lycopene beta-cyclase from tomato reveals decrease in its expression during fruit ripening. Plant Mol Biol 30: 807–819[CrossRef][Web of Science][Medline] Perrotta G, Ninu L, Flamma F, Weller JL, Kendrick RE, Nebuloso E, Giuliano G (2000) Tomato contains homologues of Arabidopsis cryptochromes 1 and 2. Plant Mol Biol 42: 765–773[CrossRef][Web of Science][Medline] Perrotta G, Yahoubyan G, Nebuloso E, Renzi L, Giuliano G (2001) Tomato and barley contain duplicated copies of cryptochrome 1. Plant Cell Environ 24: 991–997[CrossRef] Porra RJ, Thompson WA, Kriedermann PE (1989) Determination of accurate extinction coefficients and simultaneous equation for assaying chlorophyll a and b extracted with four different solvents: verification of the concentration of chlorophyll standards by atomic absorption spectroscopy. Biochim Biophys Acta 975: 384–394[CrossRef] Romer S, Fraser PD, Kiano JW, Shipton CA, Misawa N, Schuch W, Bramley PM (2000) Elevation of the provitamin A content of transgenic tomato plants. Nat Biotechnol 18: 666–669[CrossRef][Web of Science][Medline]
Ronen G, Carmel-Goren L, Zamir D, Hirschberg J (2000) An alternative pathway to beta -carotene formation in plant chromoplasts discovered by map-based cloning of beta and old-gold color mutations in tomato. Proc Natl Acad Sci USA 97: 11102–11107 Rosati C, Aquilani R, Dharmapuri S, Pallara P, Marusic C, Tavazza R, Bouvier F, Camara B, Giuliano G (2000) Metabolic engineering of beta-carotene and lycopene content in tomato fruit. Plant J 24: 413–420[CrossRef][Web of Science][Medline] Sambrook J, Fritsch EF, Maniatis T (1989) Molecular Cloning: A Laboratory Manual, Ed 2. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY Schmitz G, Theres K (1999) Genetic control of branching in Arabidopsis and tomato. Curr Opin Plant Biol 2: 51–55[CrossRef][Web of Science][Medline]
Schumacher K, Schmitt T, Rossberg M, Schmitz G, Theres K (1999) The Lateral suppressor (Ls) gene of tomato encodes a new member of the VHIID protein family. Proc Natl Acad Sci USA 96: 290–295
Valverde F, Mouradov A, Soppe W, Ravenscroft D, Samach A, Coupland G (2004) Photoreceptor regulation of CONSTANS protein in photoperiodic flowering. Science 303: 1003–1006 van Roekel JSC, Damm B, Melchers LS, Hoekema A (1993) Factors influencing transformation frequency of tomato (Lycopersicon esculentum). Plant Cell Rep 12: 644–647 von Lintig J, Welsch R, Bonk M, Giuliano G, Batschauer A, Kleinig H (1997) Light-dependent regulation of carotenoid biosynthesis occurs at the level of phytoene synthase expression and is mediated by phytochrome in Sinapis alba and Arabidopsis thaliana seedlings. Plant J 12: 625–634[CrossRef][Web of Science][Medline]
Wang H, Ma LG, Li JM, Zhao HY, Deng XW (2001) Direct interaction of Arabidopsis cryptochromes with COP1 in light control development. Science 294: 154–158 Weller JL, Perrotta G, Schreuder ME, Van Tuinen A, Koornneef M, Giuliano G, Kendrick RE (2001) Genetic dissection of blue-light sensing in tomato using mutants deficient in cryptochrome 1 and phytochromes A, B1 and B2. Plant J 25: 427–440[CrossRef][Web of Science][Medline] Yanovsky MJ, Kay SA (2002) Molecular basis of seasonal time measurement in Arabidopsis. Nature 419: 308–312[CrossRef][Medline] Yanovsky MJ, Kay SA (2003) Living by the calendar: how plants know when to flower. Nat Rev Mol Cell Biol 4: 265–275[CrossRef][Web of Science][Medline] This article has been cited by other articles:
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ASPB Publications | PLANT PHYSIOLOGY® | THE PLANT CELL | |
|---|---|---|---|
TOP
ABSTRACT
RESULTS
