Plant Physiol.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


First published online December 3, 2004; 10.1104/pp.104.052670

Plant Physiology 137:514-521 (2005)
© 2005 American Society of Plant Biologists

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
137/2/514    most recent
pp.104.052670v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Web of Science (12)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lemaire, S. D.
Right arrow Articles by Miginiac-Maslow, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lemaire, S. D.
Right arrow Articles by Miginiac-Maslow, M.
Agricola
Right arrow Articles by Lemaire, S. D.
Right arrow Articles by Miginiac-Maslow, M.

NADP-Malate Dehydrogenase from Unicellular Green Alga Chlamydomonas reinhardtii. A First Step toward Redox Regulation?1

Stéphane D. Lemaire2, Alberto Quesada2, Faustino Merchan, Juan Manuel Corral, Maria Isabel Igeno, Eliane Keryer, Emmanuelle Issakidis-Bourguet, Masakazu Hirasawa, David B. Knaff and Myroslawa Miginiac-Maslow*

Institut de Biotechnologie des Plantes, Unité Mixte de Recherche 8618 Centre National de la Recherche Scientifique, Université Paris-Sud, 91405 Orsay cedex, France (S.D.L., E.K., E.I.-B., M.M.-M.); Departamento de Bioquímica y Biología Molecular, Faculdad de Veterinaria, 10071–Cáceres, Spain (A.Q., F.M., J.M.C., M.I.I.); and Department of Chemistry and Biochemistry, Texas Tech University, Lubbock, Texas, 79409–1061 (M.H., D.B.K.)


    ABSTRACT
 TOP
 ABSTRACT
 RESULTS AND DISCUSSION
 CONCLUSION
 MATERIALS AND METHODS
 LITERATURE CITED
 
The determinants of the thioredoxin (TRX)-dependent redox regulation of the chloroplastic NADP-malate dehydrogenase (NADP-MDH) from the eukaryotic green alga Chlamydomonas reinhardtii have been investigated using site-directed mutagenesis. The results indicate that a single C-terminal disulfide is responsible for this regulation. The redox midpoint potential of this disulfide is less negative than that of the higher plant enzyme. The regulation is of an all-or-nothing type, lacking the fine-tuning provided by the second N-terminal disulfide found only in NADP-MDH from higher plants. The decreased stability of specific cysteine/alanine mutants is consistent with the presence of a structural disulfide formed by two cysteine residues that are not involved in regulation of activity. Measurements of the ability of C. reinhardtii thioredoxin f (TRX f) to activate wild-type and site-directed mutants of sorghum (Sorghum vulgare) NADP-MDH suggest that the algal TRX f has a redox midpoint potential that is less negative than most those of higher plant TRXs f. These results are discussed from an evolutionary point of view.


Malate dehydrogenases (MDHs) are ubiquitous enzymes, present in all the living organisms. Most of them (EC 1.1.1.37) use NAD as a cofactor, are constitutively active, and are not regulated by metabolites, except for the mitochondrial isoform, allosterically regulated by citrate (Miginiac-Maslow et al., 1997Go). The major chloroplastic isoform (EC 1.1.1.82) uses NADP as a cofactor. Its main regulation is performed through thiol-disulfide interchange with reduced thioredoxin (TRX), the oxidized enzyme being totally inactive. The only known regulation of its activity by metabolites is an inhibition by excess oxaloacetate, which is also present in several NAD-dependent MDHs. The TRX-dependent redox regulation of the NADP-MDH from higher plants has been studied thoroughly over the last decade (Miginiac-Maslow and Lancelin, 2002Go). The amino acid sequences of the plant enzymes are highly conserved (see Johansson et al., 1999Go for alignments of the sorghum [Sorghum vulgare], maize [Zea mays], spinach [Spinacia oleracea], Flaveria, and ice plant [Mesembryanthemum crystallimum] sequences). In particular, all the Cys involved in redox regulation are strictly conserved. The regulatory and biochemical properties of enzymes isolated from C3- or C4-type plants are very similar, and the three-dimensional (3-D) structures of the NADP-MDH from sorghum (Johansson et al., 1999Go) and Flaveria (Carr et al., 1999Go) are almost identical. As a rule, the chloroplastic, NADP-dependent isoforms exhibit sequence extensions both at the N-terminal and the C-terminal end, and each extension contains a regulatory disulfide that needs to be reduced to obtain an active enzyme. It is now well established that the reduction of the N-terminal disulfide triggers a rate-limiting conformational change at the active site, whereas the reduction of the C-terminal disulfide leads to the release of the C-terminal tip from the active site. Indeed, in the oxidized enzyme, the two negatively charged C-terminal residues are bound to positively charged active-site residues, thus blocking the access of the substrate by an autoinhibitory mechanism. A different situation exists for the primary structures of NADP-MDH from lower photosynthetic organisms and with regard to a requirement for TRX to activate the enzymes from these organisms (Ocheretina et al., 2000Go). Photosynthetic prokaryotes do not contain chloroplasts and are lacking the enzyme. In algae, the conservation of the Cys differs in the various species. In the unicellular eukaryotic green alga Chlamydomonas reinhardtii, the two typical sequence extensions at the N terminus and at the C terminus are present; however, the N terminus lacks the regulatory Cys (Gomez et al., 2002Go). The enzyme is redox regulated (Lemaire et al., 2003bGo), and modeling of its structure suggested that the C-terminal disulfide would be present, possibly along with an internal disulfide (Gomez et al., 2002Go). This work was aimed at unraveling the role of the different putative regulatory Cys in the redox regulation of the Chlamydomonas enzyme. To this end, Cys were substituted by site-directed mutagenesis either individually or in combination, and the activation and catalytic properties of the mutated recombinant proteins were studied. We show that activation of the purified wild-type enzyme is strictly TRX dependent, like for the higher plant enzymes, though with much faster activation kinetics. Consistent with kinetic observations, there is only one disulfide bridge involved in regulation, linking the two most C-terminal Cys. The redox potential of this disulfide is less negative than that of the C-terminal regulatory disulfide of the higher plant enzyme. The Chlamydomonas TRX f that is likely to be a physiological reductant for the algal NADP-MDH appears to have a less negative redox potential than those of higher plant f-type TRXs, as indicated by the inability of the algal TRX f to activate the wild-type higher plant enzyme. On the other hand, the presence of internal Cys in Chlamydomonas NADP-MDH seems to improve the stability of the enzyme, consistent with the presence of an internal structural disulfide that was previously proposed on the basis of homology modeling.


    RESULTS AND DISCUSSION
 TOP
 ABSTRACT
 RESULTS AND DISCUSSION
 CONCLUSION
 MATERIALS AND METHODS
 LITERATURE CITED
 

Biochemical Characteristics of NADP-MDH from Chlamydomonas

In our previous work, aimed at testing the biochemical properties of a new chloroplastic TRX (TRX y) from Chlamydomonas, we noticed that the NADP-MDH from this green alga was activated much faster than the sorghum NADP-MDH (Lemaire et al., 2003bGo), without the sigmoidal kinetics typical for all higher plant NADP-MDHs. In fact, the kinetics were very similar to those of the sorghum NADP-MDH mutants where the N-terminal disulfide had been eliminated either by deletion of the N-terminal extension or by substitution of either or both of the most N-terminal Cys by Ser or Ala (Issakidis et al., 1992Go). This observation suggested that a single C-terminal disulfide, the reduction of which is not rate limiting for activation of the sorghum enzyme (Issakidis et al., 1994Go), regulates the activity of the enzyme from Chlamydomonas. However, as molecular modeling suggested the existence of a second, internal disulfide, this assumption required an experimental confirmation. First, we determined the main biochemical properties of CrMDH. Figure 1 shows the activation kinetics obtained with saturating amounts of TRX. Full activation was obtained within 15 s. The activation of higher plant NADP-MDH is known to be inhibited by the oxidized cofactor. When 2 mM NADP was included into the activation medium of CrMDH, the activation was slowed down, but still remained fast, full activation being reached within 1 min. The inhibitory effect of NADP was thus very mild compared to the strong inhibition observed for the sorghum enzyme (Schepens et al., 2000Go), where activation in the presence of NADP was barely detectable after 10-min incubation. Once fully activated, the Chlamydomonas enzyme showed kinetic parameters very similar to those of the higher plant enzyme (Issakidis et al., 1992Go): a Km NADPH of 35.7 µM and a Km oxaloacetate of 40 µM. Plots of initial rates versus NADPH concentration were hyperbolic (data not shown), whereas oxaloacetate dependence exhibits the well known but yet not fully understood inhibition by excess substrate (Fig. 2). However, the inhibition of the Chlamydomonas enzyme appeared at lower oxaloacetate concentrations, i.e. slightly above 200 µM, than in the case of the sorghum enzyme, where inhibition appears at concentrations above 800 µM. The oxaloacetate concentration at which inhibition of the Chlamydomonas enzyme begins is not in fact the lowest example known. Inhibition of the NAD-dependent MDH from the bacterium Thermus flavus begins at oxaloacetate concentrations near 50 µM (Nishiyama et al., 1986Go).



View larger version (15K):
[in this window]
[in a new window]
 
Figure 1. Activation kinetics of CrNADP-MDH by TRX, inhibitory effect of NADP. CrNADP-MDH was activated by preincubation with 5 mM DTT and 10 µM CrTRX m in the absence (black circles) or in the presence (white circles) of 2 mM NADP+. The activity was measured as a function of time of preincubation.

 


View larger version (16K):
[in this window]
[in a new window]
 
Figure 2. Inhibition of CrNADP-MDH by excess oxaloacetate. CrNADP-MDH was fully activated by preincubation with 5 mM DTT and 10 µM CrTRX m for 10 min. Its activity was measured in the presence of variable concentrations of oxaloacetate in the reaction medium.

 

Sequence Alignment and Comments about the Choice of Mutations

Sequence alignment and homology modeling (Fig. 3) suggested that the enzyme contained a C-terminal disulfide bridge linking Cys-356 and Cys-368, and possibly an internal disulfide linking Cys-330 and Cys-295. Accordingly, single mutants at one of the Cys in each of the putative disulfides have been engineered by site-directed mutagenesis, i.e. mutants C330A and C356A. Double mutants of both C-terminal Cys (C356A/C368A) and of one of the C-terminal Cys and one of the internal Cys (C330A/C356A) have also been engineered.



View larger version (27K):
[in this window]
[in a new window]
 
Figure 3. Partial sequence alignment of Chlamydomonas NADP-MDH with sorghum NADP-MDH. Homology modeling of a portion of the molecule where a structural disulfide might be located in Chlamydomonas (left) compared to the 3-D structure of this portion available for sorghum NADP-MDH (right). Cr, Chlamydomonas reinhardtii; Sv, Sorghum vulgare. Homology-based 3-D modeling has been done by using the Swissmodel program (Guex and Peitsch, 1997Go).

 

Thermostability of the Mutants

Initial observations, obtained with crude extracts, revealed that the C330A mutant required reduced TRX to reach full activity, whereas the three other mutants displayed a constitutive activity that was slightly increased by addition of dithiothreitol (DTT), independently of the presence of TRX (data not shown). This result, which suggested that these mutants might have undergone some artefactual oxidation having nothing to do with a physiological redox regulation, prompted us to check the thermostability of the mutants in crude extracts. Figure 4A shows that all the reduced proteins were less stable than their oxidized forms (Fig. 4, B–D), a feature already observed for TRXs (Slaby et al., 1996Go; Lemaire et al., 2000Go). A discrete but reproducible decrease in thermostability was observed for the C330A mutant (40% loss in activity versus 20% for the wild-type protein after 5-min heating), and a more pronounced decrease was observed for the double mutant. The differences were more dramatic after a mild heat treatment (45°C; Fig. 4B) of the oxidized proteins. Mutation of Cys-330 resulted in an enzyme showing higher susceptibility to heat than its wild-type counterpart. However, the mutation of the C-terminal Cys resulted in an even higher heat sensitivity. The double mutation was, not surprisingly, the most detrimental.



View larger version (22K):
[in this window]
[in a new window]
 
Figure 4. Thermostability of CrNADP-MDH mutants in crude extracts. Reduced samples were first activated in the presence of 10 µM CrTRX m and 10 mM DTT for 10 min then heated at 45°C (A) and their activities measured. Oxidized samples (B–D) were first heated at the indicated temperatures for the indicated times, then cooled down and activated in the presence of 10 µM CrTRX m and 10 mM DTT for 10 min before activity measurements. Wild type, black circles and straight line; C330A, white circles and dotted line; C356A, black triangles and dashed line; C330A/C356A, white triangles, dashed and dotted line.

 

Redox Regulation by TRX

The activation kinetics of an MDH mutated at one of the internal Cys is presented in Figure 5, A and B. Similarly to the wild-type enzyme, the mutated enzyme is strictly dependent on reduced TRX for activity; DTT alone is totally ineffective. Its activation kinetics are quite similar to those of the wild-type enzyme, with identical half saturation for CrTRX m (S0.5 = 2.5 µM) and t1/2 (15 s at S0.5). On the other hand, single mutants at either of the most C-terminal Cys (Fig. 5, C and D) are constitutively active, even if their specific activity is decreased to about 20% of the activity of the wild-type enzyme. They show a modest stimulation by reductants; however, this stimulation can be obtained with DTT alone as well (Fig. 5C) and can be observed even by adding DTT directly to the reaction cuvette (Fig. 5D). This kind of behavior had been observed previously with constitutively active mutants of sorghum NADP-MDH (Ruelland et al., 1997Go) and has been attributed to the formation of artefactual disulfides during storage, easily reduced by chemical reductants but not by reduced TRX. In contrast, physiological reduction of the regulatory disulfides of the sorghum enzyme is strictly TRX dependent. Combined mutations of either of the C-terminal Cys with one of the internal Cys led to the same results, but the enzyme was much less stable and could not be purified to homogeneity, suggesting a role for the internal Cys in stabilization of the structure, an assumption that is consistent with the results of the heat sensitivity assays. Despite these side effects of mutation, it seems quite clear that Chlamydomonas NADP-MDH has only one regulatory disulfide, the C-terminal one, and that this disulfide is rapidly reduced by TRXs.



View larger version (22K):
[in this window]
[in a new window]
 
Figure 5. Activation kinetics of C330A and C-terminal Cys mutants of CrNADP-MDH. A, Activation rate of the C330A mutant as a function of CrTRX m concentration. The activity was measured after 15-s preincubation with variable concentrations of CrTRX m and 10 mM DTT. B, TRX dependence of the C330A mutant for activity. Compared activation time courses with 10 mM DTT alone or 10 µM CrTRX m +10 mM DTT. C, Effect of preincubation with 10 mM DTT alone or with 10 mM DTT + 10 µM CrTRX m on the activity of the C356A/C368A mutant of CrNADP-MDH as a function of time. D, Effect of adding 10 mM DTT or 10 mM DTT + 10 µM CrTRX m directly to the reaction medium of the C356A/C368A mutant of CrNADP-MDH.

 

Redox Characteristics of the TRX-Dependent Activation

The reductant-dependent activation of Chlamydomonas NADP-MDH mutants was studied using Chlamydomonas TRX m. However, recent results suggested that, at least for Arabidopsis (Arabidopsis thaliana), pea (Pisum sativum), and spinach, TRX f is in fact a more efficient activator of the enzyme (Hodges et al., 1994Go; Geck et al., 1996Go; Collin et al., 2003Go). This difference was not obvious when comparing the efficiencies of CrTRX m and AtTRX f (Lemaire et al., 2003bGo). To explore this possibility in more detail, we cloned Chlamydomonas TRX f1 and tried to purify the recombinant protein, using the sorghum NADP-MDH activation test to detect it in column eluates. The detection failed, despite the presence of low amounts of TRX f in the fractions, visualized on PAGE and western blots (data not shown). When we turned instead to activation of the NADP-MDH from Chlamydomonas as a test for the presence of TRX, it became possible to follow its activation by fractions containing TRX f. The available data about the redox potentials of the two disulfides of sorghum NADP-MDH indicate that the N-terminal disulfide is less negative (Em = –280 mV), i.e. is thermodynamically less difficult to reduce than the C-terminal disulfide (Em = –330 mV; Hirasawa et al., 2000Go). As Chlamydomonas NADP-MDH is lacking the N-terminal regulatory disulfide, it initially seemed unlikely that differences in the redox potentials of the sorghum and Chlamydomonas NADP-MDH were responsible for the different activation behavior. However, as we had in hand various mutants of sorghum NADP-MDH (Issakidis et al., 1992Go; Ruelland et al., 1997Go) displaying a range of different redox potentials, we could investigate the ability of Chlamydomonas TRX f to activate them as a direct test of this possibility. Figure 6 shows that this Chlamydomonas TRX does indeed become more efficient at activating mutants of sorghum NADP-MDH as the midpoint redox potential of the regulatory disulfides becomes less negative. In particular, it can be stressed that the double amino-terminal mutant (DMN) mutant (C24S/C29S), where the two N-terminal Cys have been substituted, i.e. the equivalent of Chlamydomonas NADP-MDH, is fully activated. This observation prompted us to determine the redox potential of Chlamydomonas NADP-MDH, and we found it to be –315 ± 6 mV at pH 7.0, i.e. significantly less negative than the redox midpoint potential measured in redox titrations of the activity of the wild-type sorghum enzyme (Em = –330 ± 10 mV). This suggests that the redox potential of TRX f from Chlamydomonas is less negative than the redox potential of its higher plant counterpart (Em values of –290 mV have been measured for both pea and spinach TRXs; Hirasawa et al., 1999Go). Unfortunately, the production of recombinant TRX f from Chlamydomonas was very poor; thus, the protein-consuming direct redox titration of its disulfide could not be performed. However, the results presented in Figure 6 clearly indicate that the inefficiency of CrTRX f in sorghum NADP-MDH activation is much more likely to be a matter of redox midpoint potential and not one of protein-protein interaction.



View larger version (17K):
[in this window]
[in a new window]
 
Figure 6. Activation of sorghum NADP-MDH mutants by Chlamydomonas TRX f1. Activations of various sorghum NADP-MDH mutants were performed in the presence of 10 µM CrTRX f1 and 10 mM DTT for 10 min before measuring their activities. The previously determined redox potentials at pH 7 (Hirasawa et al., 2000Go) are plotted in the bottom section. WT, Wild type; 207A, C207A mutant; DeltaN, deletion of the N-terminal extension; DMN, double amino-terminal mutant C24S/C29S; 207/2C, C207A/C365A/C377A mutant.

 

    CONCLUSION
 TOP
 ABSTRACT
 RESULTS AND DISCUSSION
 CONCLUSION
 MATERIALS AND METHODS
 LITERATURE CITED
 
Summing up all the regulatory characteristics of Chlamydomonas NADP-MDH and comparing them to those of higher plant NADP-MDHs, one gets the picture that the algal protein is a kind of first draft of the very complex regulatory process present in the higher plant enzyme. The lack of a second, N-terminal, regulatory disulfide is obviously the reason for the absence of the fine-tuning that exists in higher plants and the reason that the Chlamydomonas enzyme is activated very rapidly. The inhibitory effect of the oxidized cofactor, known to be due to an interaction between the positively charged cofactor and the negatively charged C-terminal tip of the enzyme within the active site (Carr et al., 1999Go; Johansson et al., 1999Go), is also much less pronounced in the algal protein. This suggests that in the higher plant enzyme, the N-terminal extension, besides its rate-limiting control of activation, has also a more direct effect on the active site conformation. This can certainly be considered as an allosteric effect due to the proximity of the oxidized N-terminal end of one subunit to some critical active-site residues of the neighboring subunit, a constraint released by the reduction of the disulfide (Carr et al., 1999Go; Johansson et al., 1999Go). This interaction may well have an effect on the redox potential of the C-terminal disulfide, rendering it more difficult to reduce in higher plant NADP-MDH than in Chlamydomonas NADP-MDH, where this interaction appears to be absent. The presence of a second disulfide, performing a structural rather than a regulatory role, in Chlamydomonas NADP-MDH is suggested by the thermal stability results presented above. However, definitive proof for the presence of such an internal, structural disulfide requires confirmation through structural approaches. It seems that evolution from green algae to higher plants has added an additional level of complexity to the redox regulatory process of NADP-MDH. One might assume that this sophistication is linked to the multicellular structure of higher plants where malate is a circulating form of the reducing power, requiring a strict control of its concentration (Scheibe, 2004Go). In Chlamydomonas, where the unique chloroplast occupies a large space inside the cell, the only exchange of reducing power that can take place is the export of malate from the chloroplast to the cytosol. In this context, it should be noted that, while all the eight higher plant NADP-MDH Cys are conserved in the mossfern Selaginella NADP-MDH, in several green algae like Dunaliella or Scherffellia the amino-terminal Cys are missing but the two C-terminal Cys are conserved, exactly like the case for Chlamydomonas NADP-MDH. In prokaryotes, like cyanobacteria, where no interorganellar transport takes place, there is no NADP-MDH. Other strategies must have evolved in other algal phyla, as red algae and diatoms that diverged earlier from the green plant lineage (Gutman and Niyogi, 2004Go) seem to be devoid of redox-regulated NADP-MDH activity (Ocheretina et al., 2000Go).

Another interesting evolutionary point is the apparent coevolution of TRX f and NADP-MDH redox properties in the same organism. Indeed, Chlamydomonas TRX f1 is unable to activate Sorghum NADP-MDH while it is able to reduce the Chlamydomonas enzyme. This difference is most probably linked to a less negative redox potential of CrTRX f1 compared to its higher plant counterparts (Hirasawa et al., 1999Go). However, this is not the case for CrTRX m or CrTRX h. Both of these Chlamydomonas TRXs have the same redox potentials as their higher plant counterparts and are able to activate higher plant NADP-MDH with reasonable efficiencies (Huppe et al., 1991Go; Stein et al., 1995Go; Krimm et al., 1998Go; Bréhélin et al., 2004Go). This indicates that conclusions drawn from biochemical studies using heterologous enzymes should be taken with some caution. Expressed sequence tag abundance analyses suggest that CrTRX f1 is the more abundant of the two TRX f isoforms present in Chlamydomonas (Lemaire et al., 2003aGo). It would thus be the major redox regulator of Chlamydomonas chloroplastic enzymes. This suggests that energetically speaking, redox regulation in this green alga would be less stringent than in higher plants and that there is a coevolution in the redox properties of TRXs and of their targets.

From the more general point of view of the TRX-dependent redox regulation of chloroplastic enzymes in Chlamydomonas, no general principle can be outlined. Indeed, in higher plants, TRX-regulated chloroplastic enzymes can be distinguished from their unregulated isoforms by either insertions (e.g. Fru-bisphosphatase) or extensions (e.g. glyceraldehyde-phosphate dehydrogenase or NADP-MDH) bearing the regulatory Cys (Ruelland and Miginiac-Maslow, 1999Go). Another case is presented by enzymes regulated by redox-dependent shifts from a dimeric to a monomeric form (peroxiredoxin, ADP-Glc pyrophosphorylase; Fu et al., 1998Go), the inactive dimer being cross-linked by a disulfide bridge involving specific Cys residues. All three cases are also present in Chlamydomonas, but with fewer regulated enzymes. Fructose bisphosphatase is redox regulated (Huppe and Buchanan, 1989Go) and possesses the three regulatory Cys typical for the higher plant enzyme (Jacquot et al., 1997Go). Our study shows that MDH is regulated too, but with a simplified mechanism. On the other hand, for glyceraldehyde-phosphate dehydrogenase, the B isoform bearing the extension is absent, the enzyme being an A4 tetramer, whereas it is an A2B2 form in higher plants (Graciet et al., 2004Go; verified in Chlamydomonas genome database). However, phosphoribulokinase, the partner of glyceraldehyde-phosphate dehydrogenase in protein-protein interactions, is TRX regulated, like its higher plant homolog. A 2-Cys peroxiredoxin has been identified in Chlamydomonas and its TRX dependence has been demonstrated (Goyer et al., 2002Go). No data on redox regulation of ADP-Glc pyrophosphorylase are available for Chlamydomonas; however, the regulatory Cys is missing in the small subunit, suggesting that this enzyme is not redox regulated (Zabawinski et al., 2001Go). All these data suggest that carbon metabolism is less strictly redox regulated in Chlamydomonas than in higher plants.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 RESULTS AND DISCUSSION
 CONCLUSION
 MATERIALS AND METHODS
 LITERATURE CITED
 

Cloning, Site-Directed Mutagenesis, and Expression

The coding region of mature Chlamydomonas reinhardtii NADP-MDH was PCR amplified to substitute Ala-32 by Met and cloned into Pet11d vector (Novagen, Madison, WI) between NcoI and BamHI restriction sites (Gomez et al., 2002Go). For the site-directed substitution of selected Cys, the following oligonucleotides were used (mutagenic primers are in bold): C330Aup, gagatcgccgacaacttcattg; C330Adown, agttgtcggcgatctcgtagtc; C356Aup, ggaggccgtgagccacctcatc; C356Adown, ggtggctcacggcctccttctc; C368Aup, gggcggtagcgccgcgctgc; and C368Adown, cgcggcgctaccgcccatca.


Purification and Enzymatic Assays

The purification of the wild-type recombinant protein followed the procedures described for the sorghum (Sorghum vulgare) protein (Issakidis et al., 1992Go), except that it was eluted from Matrex RedA column with a 0 to 3 M NaCl gradient. The same procedure was used for mutant proteins, but with an NaCl gradient up to 4 M. Sorghum MDH mutants were produced as previously indicated (Issakidis et al., 1992Go, Ruelland et al., 1997Go). Recombinant TRXs from Chlamydomonas used in activation assays were produced and purified as described in Stein et al. (1995)Go. NADP-MDH was preincubated with DTT-reduced TRXs (TRX m from Chlamydomonas, unless otherwise indicated), aliquots were withdrawn periodically and injected into a spectrophotometer cuvette containing the substrates, and the activity was measured by the decrease in A340, linked to the oxidation of NADPH. All the experiments have been repeated at least three times, with two replicates. Typical data are presented. The reproducibility is usually better than ±10%.


Redox Potential Determination

Oxidation-reduction titrations, using NADP-MDH activity to monitor the redox state of the regulatory disulfide and mixtures of oxidized and reduced DTT to poise the ambient-redox potential, were carried out essentially as described previously for the sorghum enzyme (Hirasawa et al., 2000Go). Data fitting to the Nernst Equation and calculation of midpoint potential (Em) and n values were also carried out as described previously (Hirasawa et al., 1999Go). The data from all titrations gave an excellent fit to the Nernst Equation for a single two-electron process (n = 2), and no improvement in the fit was obtained by including a second Em component. The Em value was independent of the redox equilibration time, over a range from 10 to 30 min, and of the total DTT concentration of the redox buffer, over a range from 5.0 to 10.0 mM. As was the case for the titrations of sorghum NADP-MDH, it was necessary to add a small amount of Escherichia coli TRX to the redox equilibration buffer to speed the achievement of redox equilibrium. The Em value measured for the regulatory disulfide of NADP-MDH was independent of the amount of E. coli TRX used, over the range from 2.0 to 10.0 µg. The average deviation of four independent titrations of Chlamydomonas NADP-MDH, ± 6 mV, was taken as a measure of the experimental uncertainty in Em.

The nucleotide sequences reported in this paper have been submitted to the GenBank/EBI Data Bank with accession numbers AJ277281 (CrNADP-MDH) and AY180800 (CrTRXf1).

Received August 31, 2004; returned for revision October 20, 2004; accepted October 20, 2004.


    FOOTNOTES
 
1 This work was supported in part by the Spanish Ministerio de Ciencia y Technologica (grant no. BMC–2002–04126–C03–01 to A.Q.), by the Robert A. Welch foundation (grant no. D–0710 to D.B.K.), and by the Picasso grant from Egide (to A.Q. and M.M.-M.). Back

2 These authors contributed equally to this paper. Back

Article, publication date, and citation information can be found at www.plantphysiol.org/cgi/doi/10.1104/pp.104.052670.

* Corresponding author; e-mail miginiac{at}ibp.u-psud.fr; fax 33(0)–1–39–15–34–24.


    LITERATURE CITED
 TOP
 ABSTRACT
 RESULTS AND DISCUSSION
 CONCLUSION
 MATERIALS AND METHODS
 LITERATURE CITED
 
Bréhélin C, Laloi C, Setterdahl A, Knaff DB, Meyer Y (2004) Cytosolic, mitochondrial thioredoxins and thioredoxin reductases in Arabidopsis thaliana. Photosynth Res 79: 295–304

Carr P, Verger D, Ashton AR, Ollis D (1999) Chloroplast NADP-malate dehydrogenase: structural basis of light-dependent regulation of activity by thiol oxidation and reduction. Structure 7: 461–475[Medline]

Collin V, Issakidis-Bourguet E, Marchand C, Hirasawa M, Lancelin JM, Knaff DB, Miginiac-Maslow M (2003) The Arabidopsis plastidial thioredoxins: new functions and new insights into specificity. J Biol Chem 278: 23747–23752[Abstract/Free Full Text]

Fu Y, Ballicora MA, Leykam JF, Preiss J (1998) Mechanism of reductive activation of potato tuber ADP-glucose pyrophosphorylase. J Biol Chem 273: 25045–25052[Abstract/Free Full Text]

Geck M, Larimer F, Hartman F (1996) Identification of residues of spinach thioredoxin f that influence interactions with target enzymes. J Biol Chem 271: 24736–24740[Abstract/Free Full Text]

Gomez I, Merchan F, Fernandez E, Quesada A (2002) NADP-malate dehydrogenase from Chlamydomonas: prediction of new structural determinants for redox regulation by homology modeling. Plant Mol Biol 48: 211–221[Medline]

Goyer A, Haslekås C, Miginiac-Maslow M, Klein U, Le Maréchal P, Jacquot J-P, Decottignies P (2002) Isolation and characterization of a thioredoxin-dependent peroxidase from Chlamydomonas reinhardtii. Eur J Biochem 269: 272–281[Web of Science][Medline]

Graciet E, Lebreton S, Gontero B (2004) Emergence of new regulatory mechanisms in the Benson-Calvin pathway via protein-protein interactions: a glyceraldehyde-3-phosphate dehydrogenase/CP12/phosphoribulokinase complex. J Exp Bot 55: 1245–1254[Abstract/Free Full Text]

Guex N, Peitsch MC (1997) SWISS-MODEL and the Swiss-PdbViewer: an environment for comparative protein modeling. Electrophoresis 18: 2714–2723[CrossRef][Web of Science][Medline]

Gutman BL, Niyogi KK (2004) Chlamydomonas and Arabidopsis: a dynamic duo. Plant Physiol 135: 607–610[Abstract/Free Full Text]

Hirasawa M, Ruelland E, Schepens I, Issakidis-Bourguet E, Miginiac-Maslow M, Knaff DB (2000) Oxidation-reduction properties of the regulatory disulfides of sorghum chloroplast NADP-malate dehydrogenase. Biochemistry 39: 3344–3350[CrossRef][Medline]

Hirasawa M, Schürmann P, Jacquot JP, Manieri W, Jacquot P, Keryer E, Hartman FC, Knaff DB (1999) Oxidation-reduction properties of chloroplast thioredoxins, ferredoxin-thioredoxin reductase and thioredoxin-f regulated enzymes. Biochemistry 38: 5200–5205[CrossRef][Medline]

Hodges M, Miginiac-Maslow M, Decottignies P, Jacquot JP, Stein M, Lepiniec L, Crétin C, Gadal P (1994) Purification and characterization of pea thioredoxin f expressed in Escherichia coli. Plant Mol Biol 26: 225–234[CrossRef][Web of Science][Medline]

Huppe H, Buchanan BB (1989) Activation of a chloroplast-type fructose-bisphosphatase from Chlamydomonas reinhardtii by light-mediated agents. Z Naturforsch [C] 44c: 487–494

Huppe H, Picaud A, Buchanan BB, Miginiac-Maslow M (1991) Identification of an NADP/thioredoxin system in Chlamydomonas reinhardtii. Planta 186: 115–121[Medline]

Issakidis E, Miginiac-Maslow M, Decottignies P, Jacquot JP, Crétin C, Gadal P (1992) Site-directed mutagenesis reveals the involvement of an additional thioredoxin-dependent regulatory site in the activation of recombinant sorghum leaf NADP-malate dehydrogenase. J Biol Chem 267: 21577–21583[Abstract/Free Full Text]

Issakidis E, Saarinen M, Decottignies P, Jacquot JP, Crétin C, Gadal P, Miginiac-Maslow M (1994) Identification and characterization of the second regulatory disulfide bridge of recombinant sorghum leaf NADP-malate dehydrogenase. J Biol Chem 269: 3511–3517[Abstract/Free Full Text]

Jacquot JP, Lopez-Jaramillo J, Miginiac-Maslow M, Lemaire S, Cherfils J, Chueca A, Lopez-Gorge J (1997) Cysteine-153 is required for redox-regulation of pea chloroplast fructose-1,6-bisphosphatase. FEBS Lett 401: 143–147[CrossRef][Web of Science][Medline]

Johansson K, Ramaswamy S, Saarinen M, Lemaire-Chamley M, Issakidis-Bourguet E, Miginiac-Maslow M, Eklund H (1999) Structural basis for light-activation of a chloroplast enzyme: the structure of NADP-malate dehydrogenase in its oxidized form. Biochemistry 38: 4319–4326[CrossRef][Medline]

Krimm I, Lemaire S, Ruelland E, Miginiac-Maslow M, Jacquot JP, Hirasawa M, Knaff DB, Lancelin JM (1998) The single mutation Trp35–>Ala in the 35-40 redox site of Chlamydomonas reinhardtii thioredoxin h affects its biochemical activity and the pH dependence of C36-C39 1H-13C NMR. Eur J Biochem 255: 185–195[Web of Science][Medline]

Lemaire SD, Collin V, Keryer E, Issakidis-Bourguet E, Lavergne D, Miginiac-Maslow M (2003a) Chlamydomonas reinhardtii: a model organism for the study of the thioredoxin family. Plant Physiol Biochem 41: 513–522[CrossRef]

Lemaire SD, Collin V, Keryer E, Quesada A, Miginiac-Maslow M (2003b) Characterization of thioredoxin y, a new type of thioredoxin identified in the genome of Chlamydomonas reinhardtii. FEBS Lett 543: 87–92[CrossRef][Web of Science][Medline]

Lemaire SD, Richardson JM, Goyer A, Keryer E, Lancelin JM, Makhatadze GI, Jacquot JP (2000) Primary structure determinants of the pH- and temperature-dependent aggregation of thioredoxin. Biochim Biophys Acta 1476: 311–323[CrossRef][Medline]

Miginiac-Maslow M, Issakidis E, Lemaire M, Ruelland E, Jacquot JP, Decottignies P (1997) Light-dependent activation of NADP-malate dehydrogenase: a complex process. Aust J Plant Physiol 24: 529–542

Miginiac-Maslow M, Lancelin JM (2002) Intrasteric inhibition in redox signalling: light activation of NADP-malate dehydrogenase. Photosynth Res 72: 1–12

Nishiyama M, Matsubara N, Yamamoto K, Iijima S, Uozumi T, Beppu T (1986) Nucleotide sequence of the malate dehydrogenase gene of Thermus flavus and its mutation directing an increase in enzyme activity. J Biol Chem 261: 14178–14183[Abstract/Free Full Text]

Ocheretina O, Haferkamp I, Tellioglu H, Scheibe R (2000) Light-modulated NADP-malate dehydrogenases from mossfern and green algae: insights into evolution of enzyme's regulation. Gene 258: 147–154[CrossRef][Web of Science][Medline]

Ruelland E, Lemaire-Chamley M, Le Maréchal P, Issakidis-Bourguet E, Djukic N, Miginiac-Maslow M (1997) An internal cysteine is involved in the thioredoxin-dependent activation of sorghum leaf NADP-dependent malate dehydrogenase. J Biol Chem 272: 19851–19857[Abstract/Free Full Text]

Ruelland E, Miginiac-Maslow M (1999) Regulation of chloroplast enzyme activities by thioredoxins: activation or relief from inhibition? Trends Plant Sci 4: 136–141[CrossRef][Web of Science][Medline]

Scheibe R (2004) Malate valves to balance cellular energy supply. Physiol Plant 120: 21–26[CrossRef][Medline]

Schepens I, Johansson K, Decottignies P, Gillibert M, Hirasawa M, Knaff DB, Miginiac-Maslow M (2000) Inhibition of the thioredoxin-dependent activation of the NADP-malate dehydrogenase and cofactor specificity. J Biol Chem 275: 20996–21001[Abstract/Free Full Text]

Slaby I, Cerna V, Jeng MF, Dyson HJ, Holmgren A (1996) Replacement of Trp28 in Escherichia coli thioredoxin by site-directed mutagenesis affects thermodynamic stability but not function. J Biol Chem 271: 3091–3096[Abstract/Free Full Text]

Stein M, Jacquot JP, Jeannette E, Decottignies P, Hodges M, Lancelin JM, Mittard V, Schmitter JM, Miginiac-Maslow M (1995) Chlamydomonas reinhardtii thioredoxins: structure of the genes coding for the chloroplastic m and cytosolic h isoforms; expression in Escherichia coli of the recombinant proteins, purification and biochemical properties. Plant Mol Biol 28: 487–503[CrossRef][Web of Science][Medline]

Zabawinski C, Van den Koornhuyse N, D'Hulst C, Schlichting R, Giersch C, Delrue B, Lacroix JM, Presis J, Ball S (2001) Starchless mutants of Chlamydomonas reinhardtii lack the small subunit of a heterotetrameric ADP-glucose pyrophosphorylase. J Bacteriol 183: 1069–1077[Abstract/Free Full Text]




This article has been cited by other articles:


Home page
Mol PlantHome page
L. Marri, M. Zaffagnini, V. Collin, E. Issakidis-Bourguet, S. D. Lemaire, P. Pupillo, F. Sparla, M. Miginiac-Maslow, and P. Trost
Prompt and Easy Activation by Specific Thioredoxins of Calvin Cycle Enzymes of Arabidopsis thaliana Associated in the GAPDH/CP12/PRK Supramolecular Complex
Mol Plant, March 1, 2009; 2(2): 259 - 269.
[Abstract] [Full Text] [PDF]


Home page
Plant Cell PhysiolHome page
C. Oesterhelt, S. Klocke, S. Holtgrefe, V. Linke, A. P. M. Weber, and R. Scheibe
Redox Regulation of Chloroplast Enzymes in Galdieria sulphuraria in View of Eukaryotic Evolution
Plant Cell Physiol., September 1, 2007; 48(9): 1359 - 1373.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
S. G. Ball
Eukaryotic Microalgae Genomics. The Essence of Being a Plant
Plant Physiology, February 1, 2005; 137(2): 397 - 398.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
137/2/514    most recent
pp.104.052670v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Web of Science (12)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lemaire, S. D.
Right arrow Articles by Miginiac-Maslow, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lemaire, S. D.
Right arrow Articles by Miginiac-Maslow, M.
Agricola
Right arrow Articles by Lemaire, S. D.
Right arrow Articles by Miginiac-Maslow, M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
ASPB Publications PLANT PHYSIOLOGY® THE PLANT CELL
Copyright © 2005 by the American Society of Plant Biologists