|
|
||||||||
|
First published online January 21, 2005; 10.1104/pp.104.054908 Plant Physiology 137:713-723 (2005) © 2005 American Society of Plant Biologists
Alterations in Tocopherol Cyclase Activity in Transgenic and Mutant Plants of Arabidopsis Affect Tocopherol Content, Tocopherol Composition, and Oxidative Stress1Max-Planck-Institute of Molecular Plant Physiology, Department of Lothar Willmitzer, 14476 Golm, Germany
Tocopherol belongs to the Vitamin E class of lipid soluble antioxidants that are essential for human nutrition. In plants, tocopherol is synthesized in plastids where it protects membranes from oxidative degradation by reactive oxygen species. Tocopherol cyclase (VTE1) catalyzes the penultimate step of tocopherol synthesis, and an Arabidopsis (Arabidopsis thaliana) mutant deficient in VTE1 (vte1) is totally devoid of tocopherol. Overexpression of VTE1 resulted in an increase in total tocopherol of at least 7-fold in leaves, and a dramatic shift from -tocopherol to -tocopherol. Expression studies demonstrated that indeed VTE1 is a major limiting factor of tocopherol synthesis in leaves. Tocopherol deficiency in vte1 resulted in the increase in ascorbate and glutathione, whereas accumulation of tocopherol in VTE1 overexpressing plants led to a decrease in ascorbate and glutathione. Deficiency in one antioxidant in vte1, vtc1 (ascorbate deficient), or cad2 (glutathione deficient) led to increased oxidative stress and to the concomitant increase in alternative antioxidants. Double mutants of vte1 were generated with vtc1 and cad2. Whereas growth, chlorophyll content, and photosynthetic quantum yield were very similar to wild type in vte1, vtc1, cad2, or vte1vtc1, they were reduced in vte1cad2, indicating that the simultaneous loss of tocopherol and glutathione results in moderate oxidative stress that affects the stability and the efficiency of the photosynthetic apparatus.
Vitamin E encompasses a class of lipid antioxidants consisting of four forms each of tocopherol and tocotrienol. Because of its high economical value and importance for human nutrition, much effort has been invested to elucidate the tocopherol biosynthetic pathway in plants and Cyanobacteria and to identify limiting steps by overexpression of candidate genes in transgenic plants. The hydroquinone ring of tocopherol is derived from the shikimate pathway of aromatic amino acid synthesis. Homogentisate, the precursor for the synthesis of tocopherol, tocotrienol, and plastoquinone, is synthesized by p-hydroxyphenylpyruvate dioxygenase (HPPD; Fig. 1; Norris et al., 1998 -tocopherol by tocopherol cyclase (VTE1; Porfirova et al., 2002 -tocopherol methyltransferase ( -TMT, VTE4) results in the production of -tocopherol. -Tocopherol is the predominant form in leaves, whereas -tocopherol is most abundant in seeds of Arabidopsis (Shintani and DellaPenna, 1998 -tocopherol, -tocopherol; Fig. 1).
Under oxidative stress, the amounts of different antioxidants strongly increase in plants, and it is believed that this results in an increased capacity to scavenge reactive oxygen species (Noctor and Foyer, 1998
Ascorbate and glutathione are the most abundant low Mr compounds with antioxidant activity in higher plants (Noctor and Foyer, 1998
Different Arabidopsis mutants with deficiencies in the synthesis of ascorbate or glutathione have been isolated. The vtc1 (synonymous with soz1) mutant carries a mutation in the gene encoding GDP-Man pyrophosphorylase involved in ascorbate synthesis, and therefore this plant contains only 30% of wild-type amounts of ascorbate (Conklin et al., 1996 To further our understanding of the regulation of tocopherol biosynthesis and of the role of tocopherol in the antioxidant network of Arabidopsis, transgenic plants overexpressing VTE1 were generated and subjected to tocopherol analysis, and double mutants of vte1 and lines deficient in the synthesis of ascorbate (vtc1) or glutathione (cad2) were produced. From these studies, it became clear that tocopherol cyclase is limiting tocopherol synthesis in leaves, and that the simultaneous loss of tocopherol and glutathione affects photosynthesis and growth in a way different from what was observed for the parental lines.
Overexpression of VTE1 Results in Accumulation of Tocopherol and in a Shift in Tocopherol Composition in Leaves
VTE1 catalyzes the cyclization of DMPQ resulting in the formation of
A second construct that was introduced into Arabidopsis wild type and vte1 mutant contained the VTE1 cDNA under the control of the strong constitutive 35S promoter (lines WT-35VTE1 and vte1-35VTE1). Overexpression of VTE1 with 35S promoter resulted in an up to 7-fold increase in tocopherol in several lines, including transgenic plants with wild-type or vte1 mutant background (Fig. 2C). Furthermore, the dramatic increase in tocopherol led to a shift in tocopherol composition, because leaves of transgenic plants accumulated large amounts of -tocopherol (80.5%) instead of -tocopherol (16.5%) and low amounts of -tocopherol (2%; Fig. 2C). The accumulation of -tocopherol can be explained by a low activity of -TMT, which might become limiting for -tocopherol synthesis in the transgenic lines (Fig. 1). The presence of low amounts of -tocopherol is supposedly derived from conversion of 2-methyl-6-phytyl-1,4-hydroquinol (MPQ) to -tocopherol in VTE1 overexpressing lines. The high accumulation of total tocopherol in the 35S promoter plants correlated with a dramatic increase in VTE1 expression as shown by western analysis (Fig. 3A) and northern analysis (Fig. 3B). It is interesting to note that transgenic VTE1 plants of wild-type background (WT-35VTE1 no. 37) with low expression level had wild-type amounts of tocopherol. Therefore, accumulation of tocopherol was correlated with high expression of VTE1. It was previously reported that HPT1 limits tocopherol synthesis and that HPT1 overexpression leads to elevated tocopherol content in transgenic plants (Collakova and DellaPenna, 2003b
It is well established that the amount of tocopherol increases during oxidative stress in leaves (e.g. Collakova and DellaPenna, 2003b To unravel the contribution of VTE1 for tocopherol synthesis during stress, gene expression was measured in wild-type leaves exposed to high light conditions using northern hybridization. Expression of VTE1 was strongly induced, particularly during the early time points (days 1 to 4) of high light stress (Fig. 4B).
Mutants deficient in antioxidant synthesis offer an alternative approach to study the effects of oxidative stress on plant physiology. We selected two lines, vtc1 and cad2, which are deficient in ascorbate and glutathione synthesis, respectively (Howden et al., 1995 -tocopherol and a decrease in -tocopherol in vtc1 (90.0% -tocopherol; 9.9 -tocopherol) and cad2 (90.2% ; 9.7% ) as compared to wild type (86.6% ; 13.3 ; Fig. 4A). Thus, in contrast to the change in tocopherol composition observed under oxidative stress, the increase in tocopherol in vtc1 and cad2 was accompanied by a relative increase in -tocopherol, suggesting that -TMT was not limiting in antioxidant mutants. To address the question of whether the stimulation of tocopherol synthesis observed in leaves of vtc1 and cad2 originates from induction of gene expression, northern analysis was done. Indeed, we observed a strong up-regulation of VTE1 expression (Fig. 4B) in these two mutants. As judged by northern hybridization, expression levels for HPT1 and HPPD in vtc1 and cad2 were in the range of wild type (data not shown). Therefore, the increase in tocopherol synthesis observed under oxidative stress and in antioxidant mutants (vtc1 and cad2) clearly correlates with induction of VTE1 expression.
Growth and photosynthetic efficiency of the vte1 mutant of Arabidopsis were very similar to wild type under standard growth conditions (Porfirova et al., 2002
Ascorbate and glutathione were quantified in single and double mutant lines deficient in antioxidants (Fig. 6). Furthermore, vte1 carrying a genomic VTE1 construct and a VTE1 overexpression line were included in these analyses. Deficiency in tocopherol (in vte1) or glutathione (cad2) led to a moderate but significant increase in ascorbate (Fig. 6A). The accumulation of ascorbate was also visible when comparing vte1vtc1 with vtc1 and resulted in an even stronger ascorbate accumulation in vte1cad2 as compared to vte1 or cad2. Interestingly, the VTE1 overexpression line accumulated significantly reduced amounts of ascorbate as compared with wild type. The redox state of ascorbate was not affected by the vte1 or cad2 mutations (Fig. 6B). Total glutathione was increased in lines deficient for tocopherol (vte1) and increased even further in the vte1vtc1 double mutant (Fig. 6C). Glutathione was reduced to less than 10% of wild-type amounts in lines homozygous for cad2. The VTE1 overexpression lines contained reduced amounts of glutathione as compared to wild type. No change in the redox state of glutathione was observed (Fig. 6D). Taken together (Figs. 4A and 6), the reduction in one of the three antioxidants, tocopherol, ascorbate, or glutathione, resulted in an increase in the remaining antioxidants in single and double mutant plants, whereas high tocopherol contents resulted in a reduction of ascorbate and glutathione in VTE1 overexpression lines.
Single and double mutant lines were exposed to high light stress conditions (800 µE light for 4 d) and antioxidant contents determined. Under high light, all antioxidants (tocopherol, glutathione, and ascorbate) increased severalfold (data not shown). A large variation of antioxidant contents was observed under stress conditions. Furthermore, the differences in antioxidant levels as observed under control conditions (Figs. 4A and 6) were smaller under high light stress, probably because under oxidative stress, antioxidants increased to a maximal level in all mutant lines regardless of the deficiency in alternative antioxidants.
The susceptibility of the photosynthetic apparatus to oxidative stress prompted us to analyze the efficiency of photosynthesis in antioxidant mutants in more detail. Therefore, light response curves of chlorophyll fluorescence were recorded for wild-type and mutant plants. The maximum photochemical efficiency of PSII in the dark-adapted state (Fv/Fm) was very similar for all lines (0.816, 0.815, 0.816, 0.816, 0.813, 0.821, and 0.808 for wild type, vte1, vtc1, vte1vtc1, cad2, and vte1cad2, respectively). In addition, nonphotochemical quenching (NPQ) was calculated to reveal the fraction of light energy that is dissipated by means other than photosynthesis, e.g. heat. In accordance with previous studies (Smirnoff, 2000; Müller-Moulé et al., 2002
Deficiency in Tocopherol and Glutathione in vte1cad2 Affects Photosynthetic Efficiency and Pigment Content
The quantum yield of PSII (
Because antioxidants, in particular tocopherol, were implicated in protecting the photosynthetic apparatus from oxidative damage, chlorophyll and carotenoids were quantified in the mutant lines. Total chlorophyll content was only slightly reduced in vte1, vtc1, and the respective double mutant as compared to wild type (Fig. 8A). The chlorophyll a to chlorophyll b ratio was close to 2.90, except for lines homozygous for vtc1, where it was reduced to about 2.65. Chlorophyll content was lower in cad2, and the vte1cad2 double mutant showed the lowest chlorophyll content of all lines analyzed. To unravel whether the reduction in chlorophyll observed in vte1cad2 was caused by a general decline in photosynthetic units, carotenoids (neoxanthin, lutein,
Overexpression of VTE1 under the strong constitutive 35S promoter resulted in the accumulation of large amounts of tocopherol in leaves of transgenic plants. Tocopherol in transgenic VTE1 leaves was increased by a factor of 7 (Fig. 2A), representing the largest increase in total tocopherol content obtained in any transgenic plant to date. Previous studies reported an increase in leaf tocopherol by a factor of 1.4 and 4.4 by overexpression of HPPD or HPT1, respectively (Tsegaye et al., 2002
Overexpression of HPPD or HPT1 resulted in a strong increase in tocopherol synthesis (Tsegaye et al., 2002
In leaves of plants overexpressing VTE1, tocopherol was increased by a factor of 7, and this increase could be almost entirely attributed to an increase in
Expression of HPT1 and HPPD in VTE1 overexpression plants was slightly induced (2- and 1.5-fold as estimated from scanning northern blots). In contrast, overexpression of HPT1 or HPPD in transgenic plants using 35S promoter resulted in a much stronger accumulation of transgenes (e.g. 20100-fold for HPT1; Tsegaye et al., 2002
Interestingly, the pools of ascorbate and glutathione in tocopherol deficient lines were increased (Fig. 6). On the other hand, the pools of ascorbate and glutathione decreased in plants with high amounts of tocopherol. Ascorbate and glutathione are the two major soluble antioxidants in plant cells, and it is known that they are linked via the ascorbate-glutathione cycle (for review, see Noctor and Foyer, 1998
The vtc1 and cad2 mutants used in this study still contain residual amounts of ascorbate and glutathione, respectively (Conklin et al., 1996
Chlorophyll content was slightly decreased in all mutant lines (Fig. 8A), supposedly as a result of accumulation of reactive oxygen species. Nevertheless, photosynthetic efficiency of PSII was not affected in vte1, vtc1, vte1vtc1, and cad2, but was affected in the vte1cad2 double mutant (Fig. 7, A and B). Furthermore, the pool sizes of carotenoids (neoxanthin, lutein,
Origin of Mutant Lines and Plant Growth Conditions
Plants were grown on soil at long day conditions (16 h light, 8 h dark) under a light intensity of 120 µmol m2 s1, 60% relative humidity, and temperatures of 20°C (day) and 18°C (night). Isolation of the tocopherol deficient vte1 mutant (Columbia [Col]-2 background) was described previously (Porfirova et al., 2002
The entire open reading frame of VTE1 was amplified from first strand cDNA (RT of leaf mRNA; Superscript II, Invitrogen, Karlsruhe, Germany) by PCR using the oligonucleotides PD211 (AGCTGGTACCTATGGAGATACGGAGCTTGATTGTTT) and PD212 (GACTTCTAGAGTTACAGACCCGGTGGCTTGAAGAAA), introducing an Asp718 and XbaI site at the 5' and 3' end of the PCR product, respectively. The VTE1 cDNA was first cloned into the pGEM-Teasy vector (Promega, Mannheim, Germany) and then ligated into the Asp718, XbaI sites of the binary vector pBINAR containing the strong constitutive cauliflower mosaic virus 35S promoter (Höfgen and Willmitzer, 1990
A genomic fragment encompassing the VTE1 locus from chromosome 4 was isolated by colony hybridization of a cosmid library using the VTE1 PCR fragment as a probe. This library contains genomic DNA fragments (about 20,000 bp) from wild-type Arabidopsis (Arabidopsis thaliana) cloned into the HindIII site that is located inside a T-DNA cassette (Meyer et al., 1996
Binary vectors containing the VTE1 gene or cDNA were transferred into Arabidopsis plants by Agrobacterium mediated infiltration (Bent et al., 1994
The open reading frame of VTE1 lacking the apparent transit peptide was ligated into the Escherichia coli expression plasmid pQE31 (Qiagen, Hilden, Germany) and used for expression of a protein with N-terminal His6 fusion as described in Porfirova et al. (2002)
Total RNA was isolated from leaves and used for northern hybridization according to standard protocols (Sambrook et al., 1989
A double homozygous mutant vte1vtc1 was isolated from an F2 population of a cross between vte1 and vtc1 by first selecting F2 plants homozygous for vte1 using HPLC analysis of tocopherol. Subsequently, the VTC1 locus was amplified from genomic DNA of candidate plants by PCR using the primers PD323 (GATTTGATGACATAATGTCCCAGCCTT) and PD324 (TCCTTCAAGAAGTTCAGCATCACCTGT) and the PCR products sequenced. The vtc1 mutation results in a C-to-T base exchange in exon 1 of the structural gene encoding GDP-Man pyrophosphorylase (Conklin et al., 1999
The vte1 mutant was crossed to cad2-1 and tocopherol deficient lines were selected in the F2 population by HPLC analysis. A cleaved amplified polymorphic sequences marker (Konieczny and Ausubel, 1993
Tocopherol was extracted from leaves in 300 µL of 1 M KCl/0.2 M H3PO4 and 1 mL diethylether. The organic phase was removed and the solvent evaporated under a stream of nitrogen gas. Tocopherols were dissolved in 100 µL hexane and quantified by fluorescence HPLC using tocol as internal standard (Thompson and Hatina, 1979
Ascorbate and dehydroascorbate were extracted from frozen leaf material with 6% (w/v) TCA. Ascorbate was quantified by reduction of Fe3+ to Fe2+ and detection of a Fe2+ complex with 2,2'-dipyridyl as described by Kampfenkel et al. (1995)
Glutathione was extracted from frozen Arabidopsis leaves with 6% (v/v) TCA. The extract was neutralized with 1 M K2CO3. Total glutathione was determined using a cycling assay based on the reaction with 2-nitrobenzoic acid and the reduction by glutathione reductase as described by Griffith (1980)
Pigments were isolated from frozen leaf material with 80% acetone and analyzed by HPLC using a C18 reverse phase column according to Thayer and Björkman (1990)
Chlorophyll fluorescence of leaves was measured with a pulse amplitude modulation fluorimeter (PAM-2000, Heinz Walz, Effeltrich, Germany). A saturating light pulse was applied to dark-adapted plants and subsequently the PPFD stepwise increased to record light-response curves. The photosynthetic quantum yield of PSII was calculated from (Fm'Ft)/Fm' (Schreiber et al., 1986
We thank Dr. C. Cobbett (University of Melbourne, Australia) for seeds of the Arabidopsis cad2-1 mutant. We are grateful to Dr. D. Büssis and Dr. Joachim Fisahn (MPI Golm, Germany) for help with chlorophyll fluorescence measurements. We thank Regina Wendenburg (Max Planck Institute Golm) for isolating cosmid clones of VTE1 and for northern analysis. Received October 14, 2004; returned for revision November 19, 2004; accepted November 21, 2004.
1 This work was supported in part by the Deutsche Forschungsgemeinschaft (research fellowship Por757/11 to S.P. and grant Do520/71 to P.D.).
2 Present address: Laboratory of Plant Biotechnology, ETH Zürich, LFW E57.1, 8092 Zürich, Switzerland. Article, publication date, and citation information can be found at www.plantphysiol.org/cgi/doi/10.1104/pp.104.054908. * Corresponding author; e-mail doermann{at}mpimp-golm.mpg.de; fax 00493315678250.
Bent AF, Kunkel BN, Dahlbeck D, Brown KL, Schmidt R, Giraudat J, Leung J, Staskawicz BJ (1994) RPS2 of Arabidopsis thaliana: a leucine-rich repeat class of plant disease resistance gene. Science 265: 18561860
Bergmüller E, Porfirova S, Dörmann P (2003) Characterization of an Arabidopsis mutant deficient in
Cahoon E, Shanklin J, Ohlrogge JB (1992) Expression of a coriander desaturase results in petroselinic acid production in transgenic tobacco. Proc Natl Acad Sci USA 89: 1118411188 Cahoon EB, Hall SE, Ripp KG, Ganzke TS, Hitz WD, Coughlan SJ (2003) Metabolic redesign of vitamin E biosynthesis in plants for tocotrienol production and increased antioxidant content. Nat Biotechnol 21: 10821087[CrossRef][Web of Science][Medline]
Chan AC, Khai T, Raynor T, Ganz PR, Chow CK (1991) Regeneration of vitamin E in human platelets. J Biol Chem 266: 1729017295
Cheng Z, Sattler S, Maeda H, Sakuragi Y, Bryant DA, DellaPenna D (2003) Highly divergent methyltransferases catalyze a conserved reaction in tocopherol and plastoquinone synthesis in Cyanobacteria and photosynthetic eukaryotes. Plant Cell 15: 23432356
Cobbett CS, May MJ, Howden R, Rolls B (1998) The glutathione-deficient, cadmium-sensitive mutant, cad2-1 of Arabidopsis thaliana is deficient in
Collakova E, DellaPenna D (2001) Isolation and functional analysis of homogentisate phytyltransferase from Synechocystis sp. PCC 6803 and Arabidopsis. Plant Physiol 127: 11131124
Collakova E, DellaPenna D (2003a) Homogentisate phytyltransferase activity is limiting for tocopherol biosynthesis in Arabidopsis. Plant Physiol 131: 632642
Collakova E, DellaPenna D (2003b) The role of homogentisate phytyltransferase and other tocopherol pathway enzymes in the regulation of tocopherol synthesis during abiotic stress. Plant Physiol 133: 930940
Conklin PL, Norris SR, Wheeler GL, Williams EH, Smirnoff N, Last RL (1999) Genetic evidence for the role of GDP-mannose in plant ascorbic acid (vitamin C) biosynthesis. Proc Natl Acad Sci USA 96: 41984203
Conklin PL, Williams EH, Last RL (1996) Environmental stress sensitivity of an ascorbic acid-deficient Arabidopsis mutant. Proc Natl Acad Sci USA 93: 99709974
Constantinescu A, Han D, Packer L (1993) Vitamin E recycling in human erythrocyte membranes. J Biol Chem 268: 1090610913
Fryer MJ (1992) The antioxidant effects of thylakoid vitamin E ( Gatzek S, Wheeler GL, Smirnoff N (2002) Antisense suppression of L-galactose dehydrogenase in Arabidopsis thaliana provides evidence for its role in ascorbate synthesis and reveals light modulated L-galactose synthesis. Plant J 30: 541553[CrossRef][Web of Science][Medline] Griffith OW (1980) Determination of glutathione and glutathione disulfide using glutathione reductase and 2-vinylpyridine. Anal Biochem 106: 207212[CrossRef][Web of Science][Medline] Höfgen R, Willmitzer L (1990) Biochemical and genetic analysis of different patatin isoforms expressed in various organs of potato (Solanum tuberosum). Plant Sci 66: 221230[CrossRef]
Hofius D, Hajirezaei M-R, Geiger M, Tschiersch H, Melzer M, Sonnewald U (2004) RNAi-mediated tocopherol deficiency impairs photoassimilate export in transgenic potato plants. Plant Physiol 135: 12561268 Howden R, Andersen CR, Coldsbrough PB, Cobbett CS (1995) A cadmium-sensitive, glutathione-deficient mutant of Arabidopsis thaliana. Plant Physiol 107: 10671073[Abstract] Kago T, Terao J (1995) Phospholipids increase radical scavenging activity of vitamin E in a bulk oil model system. J Agric Food Chem 43: 14501454 Kamal-Eldin A, Appelqvist LA (1996) The chemistry and antioxidant properties of tocopherols and tocotrienols. Lipids 31: 671701[Web of Science][Medline] Kampfenkel K, van Montagu M, Inzé D (1995) Extraction and determination of ascorbate and dehydroascorbate from plant tissue. Anal Biochem 225: 165167[CrossRef][Web of Science][Medline] Konieczny A, Ausubel FM (1993) A procedure for mapping Arabidopsis mutations using co-dominant ecotype specific PCR-based markers. Plant J 4: 403410[CrossRef][Web of Science][Medline] Krause GH, Weis E (1991) Chlorophyll fluorescence and photosynthesis: the basics. Annu Rev Plant Physiol Plant Mol Biol 42: 313349[CrossRef][Web of Science] Leung H, Vang MJ, Mavis RD (1981) The co-operative interaction between vitamin E and vitamin C in suppression of peroxidation of membrane phospholipids. Biochim Biophys Acta 664: 266272[Medline] Lichtenthaler H, Prenzel U, Douce R, Joyard J (1981) Localization of prenylquinones in the envelope of spinach chloroplasts. Biochim Biophys Acta 641: 99105[Medline] Lichtenthaler HK (1987) Chlorophylls and carotenoids: pigments of photosynthetic biomembranes. Methods Enzymol 148: 350382[Web of Science]
Liebler DC, Kling DS, Reed DJ (1986) Antioxidant protection of phospholipid bilayers by Meyer K, Benning G, Grill E (1996) Cloning of plant genes based on the genetic map position. In AH Patterns, ed, Genome Mapping in Plants. Academic Press, New York, pp 137154 Mittler R (2002) Oxidative stress, antioxidants and stress tolerance. Trends Plant Sci 7: 405410[CrossRef][Web of Science][Medline]
Müller-Moulé P, Conklin PL, Niyogi KK (2002) Ascorbate deficiency can limit violaxanthin de-epoxidase activity in vivo. Plant Physiol 128: 970977 Munné-Bosch S, Alegre L (2002) The function of tocopherols and tocotrienols in plants. CRC Crit Rev Plant Sci 21: 3157[CrossRef]
Niki E, Saito T, Kawakami A, Kamiya Y (1984) Inhibition of oxidation of methyl linoleate in solution by vitamin E and vitamin C. J Biol Chem 259: 41774182 Noctor G, Foyer CH (1998) Ascorbate and glutathione: keeping active oxygen under control. Annu Rev Plant Physiol Plant Mol Biol 49: 249279[CrossRef][Web of Science]
Norris SR, Shen X, DellaPenna D (1998) Complementation of the Arabidopsis pds1 mutation with the gene encoding p-hydroxyphenylpyruvate dioxygenase. Plant Physiol 117: 13171323
Porfirova S, Bergmüller E, Tropf S, Lemke R, Dörmann P (2002) Isolation of an Arabidopsis mutant lacking vitamin E and identification of a cyclase essential for all tocopherol biosynthesis. Proc Natl Acad Sci USA 99: 1249512500
Provencher LM, Miao L, Sinha N, Lucas WJ (2001) Sucrose export defective1 encodes a novel protein implicated in chloroplast-to-nucleus signaling. Plant Cell 13: 11271141
Rippert P, Scimemi C, Dubald M, Matringe M (2004) Engineering plant shikimate pathway for production of tocotrienol and improving herbicide resistance. Plant Physiol 134: 92100 Russin WA, Evert RF, Vanderveer PJ, Sharkey TD, Briggs SP (1996) Modification of a specific class of plasmodesmata and loss of sucrose export ability in the sucrose export defective1 maize mutant. Plant Cell 8: 645658[Abstract] Sambrook J, Fritsch E, Maniatis T (1989) Molecular Cloning: A Laboratory Manual, Ed 2. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
Sattler SE, Cahoon EB, Coughlan SJ, DellaPenna D (2003) Characterization of tocopherol cyclases from higher plants and Cyanobacteria. Evolutionary implications for tocopherol synthesis and function. Plant Physiol 132: 21842195
Sattler SE, Gilliland LU, Magallanes-Lundback M, Pollard M, DellaPenna D (2004) Vitamin E is essential for seed longevity and for preventing lipid peroxidation during germination. Plant Cell 16: 14191432
Savidge B, Weiss JD, Wong Y-HH, Lassner MW, Mitsky TA, Shewmaker CK, Post-Beittenmiller D, Valentin HE (2002) Isolation and characterization of homogentisate phytyltransferase genes from Synechocystis sp. PCC 6803 and Arabidopsis. Plant Physiol 129: 321332 Schreiber U, Schliwa U, Bilger W (1986) Continuous recording of photochemical and nonphotochemical quenching with a new type of modulation fluorometer. Photosynth Res 10: 5162
Shintani D, DellaPenna D (1998) Elevating the vitamin E content of plants through metabolic engineering. Science 282: 20982100 Smirnoff N (2000a) Ascorbic acid: metabolism and functions of a multi-facetted molecule. Curr Opin Plant Biol 3: 229235[Web of Science][Medline] Smirnoff N (2000b) Ascorbate biosynthesis and function in photoprotection. Philos Trans R Soc Lond B Biol Sci 355: 970978 Soll J, Schultz G, Joyard J, Douce R, Block MA (1985) Localization and synthesis of prenylquinones in isolated outer and inner envelope membranes from spinach chloroplasts. Arch Biochem Biophys 238: 290299[CrossRef][Web of Science][Medline] Thayer SS, Björkman O (1990) Leaf xanthophyll content and composition in sun and shade determined by HPLC. Photosynth Res 23: 331343[CrossRef] Thompson JN, Hatina G (1979) Determination of tocopherols and tocotrienols in foods and tissues by high performance lipid chromatography. J Liq Chromatogr 2: 327344 Tsegaye Y, Shintani DK, DellaPenna D (2002) Overexpression of the enzyme p-hydroxyphenolpyruvate dioxygenase in Arabidopsis and its relation to tocopherol biosynthesis. Plant Physiol Biochem 40: 913920[CrossRef]
van Eenennaam AL, Lincoln K, Durrett TP, Valentin HE, Shewmaker CK, Thorne GM, Jiang J, Baszis SR, Levering CK, Aasen ED, et al (2003) Engineering vitamin E content: from Arabidopsis mutant to soy oil. Plant Cell 15: 30073019
Veljovic-Jovanovic SD, Pignocchi C, Noctor G, Foyer CH (2001) Low ascorbic acid in the vtc-1 mutant of Arabidopsis is associated with decreased growth and intracellular redistribution of the antioxidant system. Plant Physiol 127: 426435
Vernoux T, Wilson RC, Seeley KA, Reichheld J-P, Muroy S, Brown S, Maughan SC, Cobbett CS, van Montagu M, Inzé D, et al (2000) The ROOT MERISTEMLESS1/CADMIUM SENSITIVE2 gene defines a glutathione-dependent pathway involved in initiation and maintenance of cell division during postembryonic root development. Plant Cell 12: 97110 Wefers H, Sies H (1988) The protection of ascorbate and glutathione against microsomal lipid peroxidation is dependent on vitamin E. Eur J Biochem 174: 353357[Web of Science][Medline]
Xiang C, Werner BL, Christensen EM, Liver DJ (2001) The biological functions of glutathione revisited in Arabidopsis transgenic plants with altered glutathione levels. Plant Physiol 126: 564574 This article has been cited by other articles:
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ASPB Publications | PLANT PHYSIOLOGY® | THE PLANT CELL | |
|---|---|---|---|