Plant Physiol.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


First published online February 11, 2005; 10.1104/pp.104.055715

Plant Physiology 137:1067-1081 (2005)
© 2005 American Society of Plant Biologists

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow All Versions of this Article:
137/3/1067    most recent
pp.104.055715v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Web of Science (28)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Duan, H.
Right arrow Articles by Schuler, M. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Duan, H.
Right arrow Articles by Schuler, M. A.
Agricola
Right arrow Articles by Duan, H.
Right arrow Articles by Schuler, M. A.
ENVIRONMENTAL STRESS AND ADAPTATION

Differential Expression and Evolution of the Arabidopsis CYP86A Subfamily1,[w]

Hui Duan and Mary A. Schuler*

Department of Cell and Structural Biology, University of Illinois, Urbana, Illinois 61801


    ABSTRACT
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 
Some members of the Arabidopsis (Arabidopsis thaliana) CYP86A and CYP94B cytochrome P450 monooxygenase subfamilies, which share some sequence homology with the animal and fungal fatty acid hydroxylases, have been functionally defined as fatty acid {omega}-hydroxylases. With these activities, these and other fatty acid hydroxylases have potential roles in the synthesis of cutin, production of signaling molecules, and prevention of accumulation of toxic levels of free fatty acids. The constitutive and stress-inducible patterns of the five Arabidopsis CYP86A subfamily members have been defined in 7-d-old seedlings and 1-month-old plant tissues grown under normal conditions, and 7-d-old seedlings treated with different hormones (indole-3-acetic acid, abscisic acid, gibberellin, methyl jasmonic acid, brassinosteroid, salicylic acid), chemicals (clofibrate, 1-aminocyclopropane-1 carboxylic acid), or environmental stresses (cold, wounding, drought, mannitol, etiolation). Very distinct expression patterns exist for each of these fatty acid hydroxylases under normal growth conditions and in response to environmental and chemical stresses. Analysis of the promoter sequences for each of these genes with their expression patterns has highlighted a number of elements in current databases that potentially correlate with the responses of individual genes.


Multiple forms of cytochrome P450-dependent monooxygenases (P450s) catalyze in-chain hydroxylations, end-terminal hydroxylations, and epoxidations of medium- and long-chain fatty acids (Salaün and Helvig, 1995Go; Scheller et al., 1996Go; Simpson, 1997Go). Evidence exists that some of these enzymes have distinct substrate preferences and regiospecificities, with some modifying terminal positions on medium-chain fatty acids and others modifying internal positions on long-chain fatty acids. In plants, fatty acid hydroxylases are particularly important in the synthesis of plant cuticles and signaling molecules derived from fatty acids (Kolattukudy, 1980Go; Schweizer et al., 1996aGo; Fauth et al., 1998Go; Pinot et al., 1999Go). They also represent the primary enzymes responsible for preventing the accumulation of high, possibly toxic, concentrations of free fatty acids in the plant cells liberated by phospholipases in the early stress responses (Kahn and Durst, 2000Go). Because the fatty acid profiles of many crop plants are not ideal, there is much potential for the genetic manipulation of fatty acid hydroxylases aimed at improving commercial properties of crop plants.

In the broad set of activities catalyzed by fatty acid hydroxylases, those that catalyze the hydroxylation of the terminal methyl group on aliphatic fatty acid chains are designated as {omega}-hydroxylases, falling within many divergent P450 families and subfamilies. In mammalian systems that contain relatively large numbers of P450 genes, these P450s included in the CYP4 family are induced by groups of compounds known to induce peroxisome proliferation (Gibson, 1989Go; Johnson et al., 1996Go; Simpson, 1997Go). In yeast (Saccharomyces cerevisiae) strains that contain a very limited number of P450s, these P450s included in the CYP52 family are induced by aliphatic hydrocarbons (Seghezzi et al., 1991Go; Scheller et al., 1996Go, 1998Go; Ohkuma et al., 1998Go). Based on sequence conservations among these mammalian and yeast hydroxylases, the first plant fatty acid {omega}-hydroxylase designated CYP86A1 was cloned from Arabidopsis (Arabidopsis thaliana; Benveniste et al., 1998Go). Subsequent {omega}-hydroxylase clones have included CYP86A8 (Arabidopsis; Wellesen et al., 2001Go), CYP94A1 (Vicia sativa; Tijet et al., 1998Go), CYP94A2 (Vicia; LeBouquin et al., 1999Go), CYP94A3 (Vicia; GenBank accession no. AF092914), and CYP94A5 (Nicotiana tabacum; LeBouquin et al., 2001Go).

Heterologous expressions of these fatty acid hydroxylases have indicated that each has distinct substrate specificities. For example, CYP94A1 {omega}-hydroxylates saturated and unsaturated fatty acids with aliphatic chains ranging from C10 to C18 as well as 9,10-epoxystearic acid and 9,10-dihydroxysteric acid (Tijet et al., 1998Go; Pinot et al., 1999Go). CYP94A2 preferentially {omega}-hydroxylates short-chain fatty acids such as lauric acid (C12:0), and in-chain hydroxylates myristic acid (C14:0) and palmitic acid (C16:0) with varying proportions of the alternate activity on each of these substrates (Kahn et al., 2001Go). CYP94A5, CYP86A1, and CYP86A8 {omega}-hydroxylate saturated and unsaturated fatty acids with aliphatic chains ranging from C12 to C18 (Benveniste et al., 1998Go; LeBouquin et al., 2001Go; Wellesen et al., 2001Go). In contrast with the broad specificities defined for these {omega}-hydroxylases, the less extensively characterized CYP92B1 (Petunia hybrida) {omega}-hydroxylates one saturated fatty acid (lauric) and in-chain hydroxylates two unsaturated fatty acids (linoleic [C18:2] and linolenic [C18:3]; Petkova-Andonova et al., 2002Go). Two others that have not been extensively characterized (Zea mays CYP78A1 [Imaishi et al., 2000Go] and Petunia CYP703A1 [Imaishi et al., 1999Go]) have been reported to {omega}-hydroxylate lauric acid.

Given the involvement of many P450 families in mediating fatty acid hydroxylations occurring in different plants and animals, it is clear that P450s metabolizing these types of endogenous compounds are among the earliest and most diversified of the P450s that exist in eukaryotes. But, because of the multiplicity of related P450 genes in various plant species with potentially overlapping functions and the dearth of information on their expression patterns, the physiological significance of many of these enzymes has still not been completely established.

Among their many potential roles, fatty acid hydroxylases are important in the production of cutin in the aerial parts of plants and suberin in the roots of plants, which serve as structural components of the permeability barrier protecting plants against water loss and pathogen, insect, and mechanical damage. Derived from cellular lipids, cutin and suberin are polymeric networks of oxygenated C16 and C18 fatty acids cross-linked by ester bonds, such that the carboxyl group of one fatty acid is linked to a primary or secondary hydroxyl group of another (Kolattukudy, 2001Go). Characterization of the Arabidopsis lcr (cyp86a8) mutant has implicated the CYP86A8 protein in the synthesis of epidermal cutin (Wellesen et al., 2001Go). Characterization of the Arabidopsis att1 (cyp86a2) mutant has directly indicated that the CYP86A2 protein is involved in cutin synthesis with the att1 mutant containing only 30% of the cutin content present in wild-type plants (Xiao et al., 2004Go).

Once incorporated into elongated cutin, cutin polymers and monomers released from it play important roles in plant development and pathogen defense mechanisms. Cutin monomers released by fungal cutinase in the course of pathogenic infections are perceived as signals enhancing fungal cutinase expression and formation of fungal appressorial structures (Francis et al., 1996Go; Gilbert et al., 1996Go), as well as plant resistance components (Schweizer et al., 1996aGo, 1996bGo) and H2O2 production (Fauth et al., 1998Go). Induction of CYP94A1 transcript levels in Vicia plants in response to jasmonate (a defense hormone) and clofibrate (an inducer of mammalian peroxisome proliferation) indicates that plants amplify their responses to the initial levels of released cutin monomers by inducing expression of P450 proteins capable of generating additional cutin monomers (Pinot et al., 1998Go, 1999Go).

Against this background of plant-fungal interactions, it is now evident that fatty acid hydroxylases play important roles in determining plant-bacterial interactions. Inactivation of the CYP86A2 protein in the att1 ethyl methanesulfonate mutant and the enhanced pathogenicity of Pseudomonas syringae associated with this mutation directly implicate cutin polymers derived from this P450 in establishing resistance to bacterial pathogens (Xiao et al., 2004Go). Cutin polymers also play important roles in plant development. Evidence of this is derived from studies of transgenic Arabidopsis plants overexpressing fungal cutinase, in which disruption of cuticular ultrastuctures coincides with postgenital organ fusions (Sieberer et al., 2000Go), and from studies of the Arabidopsis lcr mutant expressing inactive CYP86A8 protein, in which disruption of cuticular structures coincides with the loss of apical dominance, delayed senescence, and abnormal trichome differentiation (Wellesen et al., 2001Go).

In addition to CYP86A1 and CYP86A8, whose fatty acid hydroxylase activities on various substrates have been functionally defined in heterologous expression systems, and CYP86A2, whose fatty acid hydroxylase activities have been inferred from mutational analysis, two additional CYP86A genes (CYP86A4 and CYP86A7) exist in the Arabidopsis genome (http://www.p450.kvl.dk/p450.shtml; http://Arabidopsis-P450.biotec.uiuc.edu). All five of these CYP86A sequences are typical non-A P450s with significant sequence homology to the fatty acid- and alkane-metabolizing CYP4 proteins and CYP52 proteins previously mentioned from mammals and fungi (Durst and Nelson, 1995Go; Werck-Reichhart et al., 2002Go). The degree of sequence conservation that exists within this P450 subfamily has suggested that CYP86A proteins mediate some conserved enzymatic functions, a prediction that has been borne out by our biochemical analysis. Given the importance of fatty acid {omega}-hydroxylases in cutin synthesis, plant-pathogen interactions and development, and the lack of information on their regulation, we have examined the tissue specificity and stress inducibility of all five members of the CYP86A subfamily. The results provide insight into the cytological locations and stress inductions of these fatty acid hydroxylases.


    RESULTS
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 

Comparison of the CYP86A Coding Sequences

The five members of the CYP86A subfamily are scattered over four of the five Arabidopsis chromosomes. As indicated by their genomic locus numbers (At5g58860, At4g00360, At1g01600, At1g63710, At2g45970), CYP86A1 is located on the lower arm of chromosome 5, CYP86A2 is located on the very top of chromosome 2, CYP86A4 is located on the very top of chromosome 1, CYP86A7 is located on the lower arm of chromosome 1, and CYP86A8 is located very close to the bottom of chromosome 2 (http://www.p450.kvl.dk/p450.shtml).

Supported by the existence of full-length cDNA clones for each of these five loci (http://Arabidopsis-P450.biotec.uiuc.edu), comparisons conducted at the nucleotide level indicate that these genes have very different organizations, with CYP86A1 having a single intron interrupting the coding sequence at position 1,140 nt (relative to ATG), CYP86A2 and CYP86A4 having a single intron interrupting the coding sequence at position 422 (relative to ATG), and CYP86A7 and CYP86A8 having no introns. The intron of CYP86A1 is relatively large (457 nt) compared to the smaller conserved introns of CYP86A2 (166 nt) and CYP86A4 (130 nt) that are 51.9% identical to one another. Except for the splice-site junctions, no significant matches exist between the CYP86A1 intron and the CYP86A2 and CYP86A4 introns. Pairwise comparisons between the five Arabidopsis CYP86A sequences indicate that, as shown in Table I, CYP86A2 and CYP86A4 have the highest degree of nucleotide identity within their coding sequence (82.3%). CYP86A2 and CYP86A4 have similarly high degrees of identity with CYP86A8 (73.6% and 73.3%, respectively). CYP86A7 shares comparably high identity with CYP86A8 (70.1%), CYP86A4 (69.8%), and CYP86A2 (68.4%). CYP86A1 has distinctly lower identity with the other four members of this P450 subfamily (62.3%–64.5%).


View this table:
[in this window]
[in a new window]
 
Table I. Pairwise nucleotide comparisons of CYP86A proteins

 
Pairwise comparisons conducted at the protein level indicate that these proteins are well conserved throughout most of their coding sequence and display the same derived relationships as seen at the nucleotide level (Table II). CYP86A2 and CYP86A4 have the highest degree of sequence identity (87%), with both equally close to CYP86A8 (75% and 76%, respectively) and, to a lesser degree, to CYP86A7 (70% and 68%, respectively). CYP86A1 has lower similarity with the other four members of the CYP86A subfamily (61%–62%). Quite unusually, these P450s differ in their amino acid lengths from 513 (CYP86A1), 524 (CYP86A7), 537 (CYP86A8), and 553 (CYP86A2), to 557 (CYP86A4). Alignments at the primary sequence level indicate that nearly all of these length differences exist at the C terminus, with CYP86A7 extending 11 residues, CYP86A8 extending 22 residues, CYP86A4 extending 36 residues, and CYP86A2 extending 37 residues beyond the termination point of CYP86A1 (Fig. 1). Analysis of the sequence composition in the extended tails of CYP86A2 and CYP86A4 shows a disproportionate number of nonpolar Val, Ala, and Gly residues (67% and 58%, respectively).


View this table:
[in this window]
[in a new window]
 
Table II. Pairwise amino acid comparisons of CYP86A proteins

 


View larger version (33K):
[in this window]
[in a new window]
 
Figure 1. SRS regions of Arabidopsis CYP86A proteins. SRS regions, defined on the basis of molecular models built for each of these proteins, are aligned with red designating residues conserved in five sequences, green designating residues conserved in four sequences, blue designating residues conserved in three sequences, and black designating residues conserved in only two sequences. The SRS6 regions of these proteins are followed by the variable-length C-terminal sequences present on each of these proteins.

 
Molecular models have been developed for these five proteins using molecular operating environment (MOE, Chemical Computing Group, Montreal) programs as detailed by Rupasinghe et al. (2004)Go for other Arabidopsis P450s. Based on these structural predictions, assignments of the substrate recognition site (SRS; Gotoh, 1992Go) regions have indicated that all five P450s are nearly identical in SRS1, more variable in SRS4 and SRS5, and most variable in SRS2, SRS3, and SRS6 (Fig. 1; Supplemental Fig. 1). The identities in these regions, which are thought to contribute to defining catalytic site specificity, are striking given the level of overall sequence divergence in these proteins. Even more striking is the degree to which the backbones predicted for these proteins overlay one another (data not shown), with all displaying a longer J-K loop or {beta}-pleated sheet structure compared with the crystal structure determined for bacterial CYP102 (Ravichandran et al., 1993Go; Li and Poulos, 1994Go, 1997Go), and all except CYP86A2 displaying a longer F-G loop (SRS2). Among the few more divergent regions that do exist, CYP86A2 and CYP86A8 have longer G-H loops, potentially affecting interactions with P450 reductase; CYP86A2 and CYP86A4 have longer B'-C loops containing SRS1; and CYP86A2, CYP86A4, and CYP86A8 have longer exterior surface loops between {beta}-sheets 3-2 and 4-2. While this relatively small number of backbone differences between these proteins suggests that their catalytic sites have similar configurations, amino acid variations in SRS4, SRS5, and SRS6 suggest that these P450s have the potential to metabolize different ranges of fatty acids.


Phylogeny

An unrooted phylogenetic tree of potentially orthologous fatty acid {omega}-hydroxylases from different organisms was constructed based on multiple sequence alignments performed using ClustalW. Included in this comparison were all fatty acid {omega}-hydroxylases known to exist in plants, some representative fatty acid {omega}-hydroxylases from mammalian (CYP4 family) and yeast (CYP52 family) systems, a bacterial fatty acid hydroxylase (CYP102), as well as four A-type plant P450s, which are CYP73A5 (t-cinnamic acid hydroxylase), CYP83A1 (indole-3-acetyldoxime N-hydroxylase), CYP84A1 (ferulate 5-hydroxylase), and CYP98A3 (p-coumaryl shikimic/quinic acid 3'-hydroxylase). Different algorithms, including neighbor joining, maximum parsimony, and maximum evolution within the MEGA program, generated the same phylogenetic tree whether nucleotide or amino acid sequences were used. The organization of the CYP86A clade is completely concordant with the paralogous relationships determined by our pairwise comparisons. Taking into account the positions of introns in these various genes, it appears that, after the first gene duplication within the CYP86A clade, one copy of the ancestral sequence evolved into the present-day CYP86A1 gene, and another served as the common ancestor for the other four CYP86A genes. After the loss of an intron from this second ancestral sequence, the CYP86A7 gene evolved separately after a second duplication, the CYP86A8 gene evolved separately after a third duplication, and the most recent CYP86A4 and CYP86A2 genes duplicated and evolved after an intron was inserted at an alternate position in the coding sequence (Fig. 2B). Interestingly, the closest relatives of the CYP86A1 gene in Arabidopsis are the CYP86B1 and CYP86B2 genes (43%–45% overall identity), which both contain a single intron interrupting the coding sequence at the position only 12 nt downstream from the single intron in the CYP86A1 gene. The SRS regions of these two proteins share significant identity with the SRS1, SRS4, and SRS5 regions of the CYP86A1 protein, and limited identity with its SRS2, SRS3, and SRS6 regions.



View larger version (13K):
[in this window]
[in a new window]
 
Figure 2. Phylogenetic trees for fatty acid {omega}-hydroxylases. A, An unrooted phylogenetic tree, developed using MEGA version 2.1 (Kumar et al., 2001Go), includes the fatty acid {omega}-hydroxylases from Arabidopsis (CYP94B1, CYP94C1, CYP86A subfamily), V. sativa (CYP94A1, CYP94A2), N. tabacum (CYP94A5), P. hybrida (CYP92B1, CYP703A1), Z. mays (CYP78A1), Candida tropicalis (CYP52A1, CYP52A2), rat (CYP4a1), human (CYP4A11, CYP4B1, CYP4F2), and a number of Arabidopsis P450s not known for metabolizing fatty acids (CYP73A5, CYP84A1, CYP83A1, CYP98A3). B, The phylogenetic tree for the CYP86A subfamily is drawn proportional to branch lengths calculated using maximum parsimony analysis with the proportional bootstrap value shown below.

 
From the unrooted tree (Fig. 2A), it is apparent that, except for the less well-characterized CYP78A1, CYP92B1, and CYP703A1 proteins, all fatty acid {omega}-hydroxylases exist in one phylogenetic group, regardless of the fact that they are present in different species and even different kingdoms. The fact that CYP703A1, CYP92B1, and CYP78A1 show up in the plant-specific A-type group, represented by the CYP73A5 and three others, suggests that conserved activities, such as fatty acid hydroxylation normally mediated by non-A-type P450s found in a variety of organisms, can be mediated at some marginal level by A-type P450s.


Fatty Acid Metabolism by CYP86A2, CYP86A4, and CYP86A7

As noted previously, CYP86A1 and CYP86A8 have been functionally defined as {omega}-hydroxylases by heterologous expression in yeast systems (Benveniste et al., 1998Go; Wellesen et al., 2001Go). To determine whether other members of this subfamily are also capable of metabolizing short-chain fatty acids, such as lauric acid (C12:0), all five CYP86A proteins were heterologously expressed in insect cells using baculovirus-mediated expression systems. As demonstrated by metabolism of [1-14C]lauric acid in the presence and absence of NADPH followed by thin-layer chromatography (TLC) analysis of the radioactive products, all five of these CYP86A proteins produce {omega}-hydroxylauric acid (designated M1 in Fig. 3). The second metabolite, designated M2 in Figure 3, is a metabolite of [1-14C]lauric acid generated in the absence of NADPH in control Sf9 cell microsomes and likely represents the product of an endogenous Sf9 cell fatty acid desaturase.



View larger version (50K):
[in this window]
[in a new window]
 
Figure 3. TLC analyses of [1-14C]lauric acid and its metabolites. The metabolism of lauric acid was assayed according to the method described in "Materials and Methods." Positions of unmetabolized substrate and metabolites (M1 and M2) are labeled. Microsomes containing individual heterologously expressed CYP86A proteins (lanes 3 and 4, CYP86A1; lanes 5 and 6, CYP86A2; lanes 7 and 8, CYP86A4; lanes 9 and 10, CYP86A7; lanes 11 and 12, CYP86A8) were incubated with substrate in the presence or absence of NADPH. Samples in the left two lanes were incubated with buffer (lane 1) or control microsomes obtained from insect cells infected with nonrecombinant virus (lane 2).

 

Tissue Profiling of CYP86A Transcripts

To elucidate the physiological functions of different members within this subfamily, we next defined the constitutive expression levels of the CYP86A transcripts in different tissues of Arabidopsis seedlings and mature plants. For this, RNA samples from 7-d-old shoots and roots, 3-week-old rosettes, and 1-month-old mature leaves, roots, siliques, and flowers were reverse transcription (RT)-PCR amplified using 5' gene-specific primers and a 3' primer complementary to the poly(A) tract present on mature mRNAs, and varying PCR cycle numbers determined to quantitatively amplify each transcript. RT-PCR products were subsequently gel blotted, hybridized with probes corresponding to the gene-specific microarray elements, and quantified by phosphor imager analysis. Normalization of each total RNA sample against its level of constitutive elongation factor EF-l{alpha} transcript and subsequently against the level of P450 transcript present in seedling shoots was performed to allow for comparisons between tissues and with microarray data described elsewhere (http://Arabidopsis-P450.biotec.uiuc.edu). As shown in Figure 4, A to C, RT-PCR analyses show strong tissue-specific patterns of expression for these genes. CYP86A1 transcripts are 17-fold more abundant in seedling roots than in seedling shoots, and 20-fold more abundant in mature roots (Fig. 4A). Contrasting with this, CYP86A8 transcripts are abundant in seedling shoots, 2-fold more abundant in flowers than in seedling shoots, and less abundant in all other tissues than in seedling shoots. CYP86A2 transcripts are similarly abundant in seedling shoots and most other tissues analyzed, and 2- to 10-fold less abundant in seedling roots, mature roots, and flowers. CYP86A4 and CYP86A7 transcripts display significantly more tissue specificity, with both expressed at their highest levels in flowers and at lower levels in stems and siliques, and CYP86A4 transcripts also expressed in seedling shoots and roots and older rosettes. These tissue fluctuations are in strong agreement with microarray analysis (Fig. 4, B and C), using P450 gene-specific microarrays constructed with 3' untranslated region sequences (http://Arabidopsis-P450.biotec.uiuc.edu). Together, these data highlight the tissue-specific expression patterns of genes categorized within the same P450 subfamily and support the tissue profiles obtained by microarray analysis.



View larger version (36K):
[in this window]
[in a new window]
 
Figure 4. Tissue profiling of CYP86A transcripts. A, Total RNAs isolated from 7-d-old seedling shoots (lane 1) or roots (lane 2), 3-week-old rosettes (lane 3), 1-month-old plant leaves (lane 4), stems (lane 5), roots (lane 6), flowers (lane 6), and green siliques (lane 7) were RT-PCR amplified as outlined in "Materials and Methods," using gene-specific primers for each of the CYP86A transcripts or the EF-1{alpha} transcript shown at the left of each image. The RT-PCR products were electrophoresed on 1.0% agarose gels, blotted to Hybond-N nylon membranes, and probed with 32P-labeled gene-specific fragments. The induction level for each transcript calculated after normalization to the amount of EF-1{alpha} transcript is recorded below each lane relative to the transcript level in seedling shoots. B and C, The relative expression levels defined from RT-PCR analysis in A are compared with those defined by microarray analysis on P450-specific microarrays (http://Arabidopsis-P450.biotec.uiuc.edu).

 

Stress Profiling of CYP86A Transcripts

To further elucidate the inducibilities of transcripts in this P450 subfamily, the inducible transcript levels were defined by RT-PCR gel-blot analysis, with RNAs isolated from 7-d-old seedlings treated with different hormones such as indole-3-acetic acid (IAA), abscisic acid (ABA), gibberellin (GA), methyl jasmonic acid (MeJA), brassinosteroid (BR), and salicylic acid (SA) or chemicals such as clofibrate and 1-aminocyclopropane-1-carboxylic acid (ACC), for varying times, or stressed with cold, wounding, drought, mannitol, or etiolation. Normalization of each total RNA sample was done against its level of constitutive EF-l{alpha} transcript, and induction levels were recorded against the transcript levels in the corresponding control samples (0.1% ethanol for IAA, ABA, JA, SA, BR; sterile water for ACC, mannitol, clofibrate; unstressed light-grown tissue for cold, wounding, drought, etiolated, dark adapted). As shown in Figure 5, CYP86A1 transcripts were transiently induced 2.7-fold by 3 h of ABA treatment and 2.5-fold by 3 h of ACC treatment, more continuously induced 1.7- to 1.8-fold by 3 and 27 h of mannitol treatment and 1.6- to 1.9-fold by 3 and 27 h of clofibrate treatment, and more slowly induced 1.9-fold by 27 h of cold treatment and 1.6-fold by 27 h of BR treatment. CYP86A1 transcripts were repressed 2.4-fold by 27 h of IAA treatment and 5.9-fold by 27 h of SA treatment. CYP86A2 transcripts were transiently induced 2.5-fold by 3 h of wounding and ABA treatment, 2.3-fold by 3 h of mannitol treatment, 1.7-fold by 3 h of IAA treatment, 1.6-fold by 3 h of clofibrate treatment, more continuously induced 2.0- and 1.9-fold by 30 and 120 min of drought treatment, and induced 1.9- to 2.3-fold in etiolated and dark-adapted seedlings compared to light-grown seedlings of the same age. CYP86A2 transcripts were not significantly repressed under any of the conditions tested here. CYP86A4 transcripts were transiently induced 1.9-fold and 3.0-fold by 3 h of ABA and IAA treatment, respectively, and more continuously induced 1.9- to 1.7-fold by 3 and 27 h of cold treatment. In contradiction to the transient responses of other CYP86A transcripts, CYP86A4 transcripts were repressed 9.0-fold by short-term ACC treatment and induced 1.9-fold by long-term ACC treatment. CYP86A4 transcripts were also repressed 3.6-fold by 3 h of wounding and 2.4-fold in etiolated seedlings. CYP86A7 transcripts were transiently induced 1.9-fold by 3 h of clofibrate treatment, more continuously induced 1.6- and 1.5-fold by 3 and 27 h of MeJA treatment, and slowly induced 1.7-fold by 27 h ABA treatment. CYP86A7 transcripts were significantly repressed by 2 h of drought treatment, 3 h of SA and wounding treatments, 3 and 27 h of ACC and mannitol treatments, and in both etiolated and dark-adapted seedlings. CYP86A8 transcripts, encoding the last member of this subfamily, were induced only by 3-h IAA and ABA treatments and repressed by 30 min of wounding. Notably, most of these genes did not respond significantly to MeJA or BR treatment. Only CYP86A7 was moderately increased by MeJA, and CYP86A1 was moderately increased by BR.




View larger version (112K):
[in this window]
[in a new window]
 
Figure 5. Stress profiling of CYP86A transcripts. Total RNAs isolated from intact 7-d-old seedlings treated with 0.1% ethanol (controls in left image) or water (control in right image), 100 µM IAA, 50 µM ABA, 1 mM SA, 100 µM MeJA, 1 µM BR, 500 mM mannitol, 1 µM ACC, or 1 mM clofibrate, stressed with cold, drought, or wounding for the times indicated, were RT-PCR amplified with gene-specific primers for the CYP86A transcripts and EF-1{alpha} transcripts shown at the left. The RT-PCR products were electrophoresed on 1.0% agarose gels, blotted to Hybond-N nylon membranes, and probed with 32P-labeled gene-specific fragments. The induction level for each transcript calculated after normalization to the amount of EF-1{alpha} transcript is recorded below each lane relative to the transcript level in its matched control sample. Red designates normalized ratios induced more than 1.5-fold, and green designates normalized ratios repressed more than 2.0-fold.

 

Promoter Analysis

Searches for identifiable promoter elements in sequences 2 kb upstream of the translation start site were performed using two databases, Arabidopsis Gene Regulatory Information Server (AGRIS; http://Arabidopsis.med.ohio-state.edu) and PlantCARE (http://intra.psb.ugent.be:8080/PlantCARE). The first one contains cis-elements characterized only in Arabidopsis studies, and the second one contains cis-elements characterized in a variety of different plant species. Elements from the AGRIS database found in the CYP86A promoters and 5' untranslated region are listed in Table III (under Elements Found in AGRIS) and a partial list of elements from the PlantCARE database is included in Table III (under Elements Found in PlantCARE). The chemical/stress treatments inducing transcript accumulation at least 1.5-fold in our RT-PCR analyses are listed below each column, with an asterisk indicating the existence of a known cis-element for a particular chemical/environmental inducer. Among the elements identified in the first Arabidopsis-specific database, there is good agreement between the cis-element search and RT-PCR analysis of responses to ABA for all five CYP86A genes, as well as response to IAA for CYP86A4. Likewise, the CYP86A1 and CYP86A2 responses to cold/mannitol and drought/mannitol treatments correlate with the presence of ABA response element (ABRE)-like elements (dehydration/low temperature) and/or AtMYC2 elements (drought/ABA) in their promoters. However, stress-specific elements correlating with the CYP86A4 response to cold at 3 and 27 h, the CYP86A7 response to MeJA at 3 and 27 h, the CYP86A2 response to wounding at 3 h, and the CYP86A1/CYP86A4 responses to ethylene do not exist either due to the existence of novel elements in these promoters or to the high stringency of search functions in this database. In the second plant-specific database, multiple cis-elements not highlighted in the first search correlate with the responses of individual genes. Additional elements identified in this search include some correlating with the CYP86A1/CYP86A4 responses to ACC, the CYP86A2 response to wounding, the CYP86A4 response to cold, and the CYP86A7 response to MeJA. But, in three of these cases (ACC, wounding, MeJA), the additional elements identified in this search exist in multiple copies in promoters not responding to these stresses. In addition, emphasizing the differences between the array of consensus sequences present in these two promoter search sites, the second broader search identified no auxin response elements putatively mediating the CYP86A2 and CYP86A4 response to IAA. Based on these comparisons, the Arabidopsis-specific promoter search process more accurately highlights elements that may be involved in the responses of individual promoters, although, because of the stringencies applied, there is potential to miss response elements.


View this table:
[in this window]
[in a new window]
 
Table III. Analysis of CYP86A promoters

*, Indicates agreement between our RT-PCR results and existence of a known cis-element for the same inducer.

 
Because both databases lack elements known to mediate responses to some of these chemicals, these promoters were searched for novel sequence identities using the PromoterWise program. The initial results from this pairwise comparison were manually checked to eliminate direct and inverted matches having less than seven contiguous nucleotides within aligned regions and less than two guanosines or cytosines. The final compilation of conserved elements, shown in Table IV, indicates that the CYP86A2/CYP86A8 and CYP86A4/CYP86A8 promoter pairs contain the greatest number of extended sequence elements (nine total), with many in the CYP86A4/CYP86A8 alignment occurring in the same orientation (designated D in Table IV). The CYP86A1/CYP86A2 and CYP86A1/CYP86A4 promoter pairs contain slightly fewer shared sequences with seven and eight extended sequence elements, respectively. The CYP86A2/CYP86A4 promoter pair has the fewest extended sequence elements (three total), but two of these are the longest ones (14 and 25 nt) identified in this search process. Interestingly, pairwise alignments between the CYP86A2 and CYP86A4 promoters indicate that they have high degrees of identity, with 52.1% identity in 1.5 kb upstream from the translation start site decreasing only slightly to 50.5% identity in 2.0 kb upstream from the translation start site. Notably, the region from –442 to –373 (Fig. 6) has more than 88% (61/69) identity. Pairwise alignments of the other CYP86A promoters indicated no other significant identities.


View this table:
[in this window]
[in a new window]
 
Table IV. Direct and inverted elements conserved between CYP86A promoters

*, Numbers in parentheses are positions of the elements relative to ATG start codon. D, Same element is in same direction on two promoters; I, same element is in inverted direction on two promoters.

 


View larger version (16K):
[in this window]
[in a new window]
 
Figure 6. Comparison of the CYP86A2 and CYP86A4 promoters. Absolute conservations in the CYP86A2 and CYP86A4 promoters identified using the PromoterWise program (http://www.ebi.ac.uk/Wise2/promoterwise.html) are shaded.

 

    DISCUSSION
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 
Current data indicate that plants have different types of enzymes responsible for fatty acid hydroxylations (Blee and Schuber, 1993Go; van De Loo et al., 1993Go; Cabello-Hurtado et al., 1998Go), but among these, only P450-dependent enzymes are responsible for hydroxylations at the {omega}-position (Wellesen et al., 2001Go). Multiple P450 families appear to mediate this hydroxylation with the plant CYP86 and CYP94 families representing two major groups of fatty acid {omega}-hydroxylases (Benveniste et al., 1998Go; Tijet et al., 1998Go; Pinot et al., 1999Go; Kahn et al., 2001Go; LeBouquin et al., 2001Go; Wellesen et al., 2001Go; Petkova-Andonova et al., 2002Go). In the CYP86A subfamily of Arabidopsis, which contains five different members that function as fatty acid {omega}-hydroxylases, CYP86A1 is the oldest member and CYP86A2 and CYP86A4 are the most recently duplicated members. Compared to other plant P450 subfamilies, these five CYP86A proteins share high degrees of primary sequence identity (between 62% and 82%) despite very different lengths (between 513 and 557 amino acids). Nearly all of the length differences are attributable to C-terminal extensions on these proteins, with CYP86A2 and CYP86A4 having 14 to 15 more C-terminal amino acids than CYP86A8, 25 to 27 more amino acids than CYP86A7, and 36 to 37 more amino acids than CYP86A1. Because these additional amino acids lie outside presumed SRSs, it is not known whether they affect the biochemical activities and/or physiological functions of the CYP86A proteins. Molecular modeling of these C-terminal extensions, which contain an unusually high number of nonpolar Val, Ala, and Gly residues, predicts that they form random coil structures extending from the external surface of these proteins.

Phylogenetic analysis of all functionally defined plant, mammalian, and fungal fatty acid {omega}-hydroxylases indicate that plant fatty acid {omega}-hydroxylases can be divided into two groups. One well-characterized group (CYP86A, CYP94A, CYP94B) shares a common ancestor with mammalian and fungal sequences, and the other, less well-characterized group (CYP78A, CYP92B, CYP703A) shares a common ancestor with the plant-specific group involved in the synthesis and metabolism of many secondary metabolites. These groups are consistent with the enumerations of plant P450s (http://drnelson.utmem.edu/Arablinks.html) as well as the functional analysis of CYP86A and CYP94B proteins, showing that they are involved in the synthesis and metabolism of fatty acids common to all organisms. Analysis of the more divergent CYP78A1, CYP92B1, and CYP703A1 proteins indicate that, although they have lauric acid {omega}-hydroxylase activity, their activities are generally very low for this substrate, possibly because they have other physiological substrates.

Phylogenetic comparisons at the gene level indicate that the Arabidopsis CYP86A sequences, which contain introns at different positions, arose either from the divergence of a common ancestral gene by a complicated series of intron deletions and reinsertions or from the convergence of several ancestral genes for a common function. Alignments of the intron-containing CYP86A1, CYP86A2, and CYP86A4 genes with one another indicate that introns occur at different positions in the CYP86A1 and CYP86A2/CYP86A4 genes, suggesting that the single intron in the CYP86A1 gene was lost during the evolution of these genes and that the reinserted intron in the CYP86A2/CYP86A4 genes is not related to original CYP86A1 intron. The alignment of the intron in the CYP86A1 gene with single introns in the CYP86B1 and CYP86B2 genes in Arabidopsis supports this hypothesis of intron loss from the ancestral CYP86A gene existing in dicots. Phylogenetic comparisons of the Arabidopsis CYP86A genes with the recently identified three CYP86A genes and six CYP86A pseudogenes in the Oryza sativa genome (Nelson et al., 2004Go) have begun to resolve this evolutionary history by showing that, at the protein level, Arabidopsis CYP86A1 is most closely related to Oryza CYP86A9, Arabidopsis CYP86A2 and CYP86A4 are most closely related to Oryza CYP86A10 and CYP86A11, and the remaining Arabidopsis CYP86A7 and CYP86A8 are most closely related to Oryza pseudogenes. Notably, none of these rice CYP86A genes contain introns.

The significant conservation that these five CYP86A proteins share at the primary sequence level becomes even more significant when one examines the very limited set of amino acid variations that occur in the six putative SRSs. Based on this higher level of primary sequence conservation and molecular modeling of these proteins, it appears that they might mediate some redundant substrate specificities. Our data support this notion in showing that all five of these proteins metabolize various lengths of saturated and unsaturated fatty acids and evolve it in showing that these proteins have different substrate preferences for long-chain (C18) fatty acids (H. Duan and M.A. Schuler, unpublished data). Importantly, these redundant in vitro catalytic activities do not necessarily translate into redundant in vivo functions since transcript analysis shows that each CYP86A gene is regulated in its own tissue-specific manner. The nonredundant nature of these genes is obvious in the case of CYP86A8 and CYP86A2, where cyp86a8 mutant plants show severe pleiotropic phenotypes associated with developmental cuticular deficiencies under normal growth conditions (Wellesen et al., 2001Go), and cyp86a2 mutant plants display severe phenotypic changes only in response to bacterial pathogens (Xiao et al., 2004Go).

Comparison of transcript profiles in various tissues by both microarray and RT-PCR analysis indicates that members of the CYP86A subfamily are expressed at quite different constitutive levels. CYP86A1 transcripts are expressed significantly only in root tissue, CYP86A4 and CYP86A7 transcripts are expressed at their highest levels in mature stems and flowers, and CYP86A2 and CYP86A8 transcripts are expressed at moderate levels in most tissues analyzed. The very high levels of CYP86A4 and CYP86A7 transcripts in reproductive tissues suggest that they may play roles in the recognition of the stigma by pollen and/or in the process of pollen tube growth, both processes that have substantial requirements for hydroxylated fatty acids (Koiwai and Matsuzaki, 1988Go; Wolters-Arts et al., 1998Go). The high levels of CYP86A8 transcript in flower tissues as well as many other tissues are consistent with its roles in preventing postgenital organ fusion and in synthesizing epidermal cutin (Wellesen et al., 2001Go). The high levels of CYP86A1 transcripts selectively expressed in root tissue coupled with the broad range of fatty acids metabolized by this P450 (Benveniste et al., 1998Go) suggest that this P450 helps generate the large quantities of fatty acids needed for root growth, elongation, and/or other root-specific functions. Transcript profiling alongside biochemical analysis of different tissues is clearly needed to tease physiological functions apart from biochemical functions.

Just as these CYP86A genes show different tissue profiles, they also display different responses to chemical and environmental stresses. This is not unexpected, given the putative roles of CYP86A2, CYP86A8, and CYP94A1 in epidermal cutin and suberin synthesis (Pinot et al., 1999Go; Wellesen et al., 2001Go) and suggestions that hydroxylated fatty acids released from cutin are involved in stress signaling and physiological responses (Schweizer et al., 1996aGo, 1996bGo; Fauth et al., 1998Go; Kauss et al., 1999Go). In analysis of plant defense signaling molecules, it is clear that MeJA induces accumulation of spectrophotometrically detectable P450 levels, CYP94A1 transcripts, and lauric acid {omega}-hydroxylase activity in V. sativa (Pinot et al., 1998Go). This study presents the responses of the CYP86A subfamily with their potential roles in plant defense and stress responses. Testing the effects of several plant stress- and defense-related hormones (ABA, ethylene, MeJA, SA), other signaling molecules (IAA, BR), and mammalian activators of peroxisome proliferation (clofibrate) on the expression patterns of all CYP86A genes, our results indicate that the stress-related hormone ABA induces the expression of all five CYP86A transcripts, with CYP86A7 responding more slowly. Short-term application of IAA or clofibrate induces different sets of three CYP86A transcripts, short-term application of ACC induces CYP86A1 transcripts, whereas long-term application of ACC induces CYP86A4 transcripts. Drought, wounding, etiolation, and dark adaptation selectively induce CYP86A2 transcripts, osmotic treatment induces CYP86A2 and CYP86A1 transcripts, and cold stress induces CYP86A4 and CYP86A1 transcripts. Coupled with the importance of cutin in preventing water loss, our results suggest that expression of CYP86A2 is important for drought resistance. Consistent with this observation is the fact that cyp86a2 mutants are more water permeable and drought sensitive (Xiao et al., 2004Go). The notable absence of CYP86A responses to signaling molecules such as MeJA and SA, which have significant roles in plant defense, suggests that activation of these CYP86A genes does not involve SA- and MeJA-dependent pathways even though CYP86A2 is clearly involved in bacterial pathogen resistance (Xiao et al., 2004Go). The observed patterns of inducible expression suggest that, in addition to their roles in normal growth and development, each of these P450s has a particular role in stress response.

The array of elements in each of these promoters picked up with available promoter search programs suggests that the Arabidopsis-specific promoter search identifies sets of putative regulatory elements that for ABA, IAA, and cold correlate more closely with the chemical and environmental inducers of individual genes. Correlations on the regulatory elements for clofibrate, BR, and wounding cannot be drawn since consensus elements for these stresses do not exist in this database. The failure to detect elements for the ethylene responses of CYP86A1/CYP86A4, the MeJA response of CYP86A7, and the root-specific expression of CYP86A1 suggests that these responses are mediated by novel elements or indirectly by other signaling cascades and/or by more divergent elements. Deletion and mutational analysis of some of the novel elements identified in our promoter comparisons will determine the extent to which any one of these is involved in stress signaling.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 

Chemicals

Plant hormone and growth regulators, including IAA, ABA, MeJA, SA, ACC, BR, and clofibrate, were obtained from Sigma (St. Louis). NADPH, Glc-6-P, and Glc-6-P dehydrogenase were also obtained from Sigma, and [1-14C]lauric acid was obtained from Amersham Biosciences (Piscataway, NJ).


Growth Conditions and Treatments

Arabidopsis (Arabidopsis thaliana ecotype Columbia) seeds were surface sterilized and grown on half-strength Murashige and Skoog-agar plates in a 22°C to 24°C growth room, with a 16-h-light/8-h-dark cycle. For IAA, ABA, MeJA, SA, and BR treatments, chemical compounds were dissolved in final 0.1% ethanol at the following concentrations: 100 µM (IAA, MeJA), 50 µM (ABA), 1 mM (SA), and 1 µM (BR). For ACC, clofibrate, and mannitol treatments, chemicals were dissolved in sterile water at the following concentrations: 1 µM (ACC), 1 mM (clofibrate), and 500 mM (mannitol). At the beginning of each treatment, 50 mL of each solution were poured onto the plates to cover the 7-d-old seedlings, and the plates were grown horizontally for the remainder of the treatment period. At the end of each treatment, whole seedlings were harvested directly from the Murashige and Skoog-agar plates, washed thoroughly with sterile water, and frozen in liquid nitrogen. For wounding treatment, 7-d-old seedlings were chopped with a sharp razor blade and left under a dim light for the indicated time period. For drought treatment, 7-d-old seedlings were placed on a piece of Whatman 3MM filter paper (Clifton, NJ) inside a chemical hood under dim light for the indicated time period. For etiolation, seeds were either germinated and grown in the dark for a total of 10 d (etiolated) or germinated under an 8-h-light/16-h-dark cycle for 3 d and then placed in the dark for an additional 4 d (dark adapted). Total RNA was isolated from each of the treatment and matched control samples (0.1% ethanol for IAA, ABA, JA, SA, BR; sterile water for ACC, mannitol, clofibrate) using TRIzol reagent (Invitrogen, Carlsbad, CA). For these, 1 g of tissue was ground in a mortar and pestle with 12 mL of TRIzol, transferred to a 15-mL Falcon tube, extracted with 3 mL of chloroform, incubated for 5 min at room temperature, and centrifuged at 5,000g at 4°C for 15 min. The supernatant was transferred to a fresh tube, and nucleic acids were precipitated by adding one-half volume of isopropanol, gently inverting the mixture, incubating at room temperature for 10 min, and centrifuging at 10,000g at 4°C for 10 min. Nucleic acids were redissolved in 500 µL of RNase-free water (Invitrogen), digested with 5 units of RQ DNase at 37°C for 1 h, reextracted with the same amount of phenol:chloroform (1:1) and then chloroform, reprecipitated with one-tenth volume of 3 M sodium acetate, pH 5.0, and two volumes of ethanol for 20 min at –20°C, centrifuged at 13,000g for 10 min at 4°C, dried, resuspended in 300 µL of sterile RNase-free water, and stored at –80°C.


RNA Quantitation

Quantitative RT-PCR gel-blot analysis of individual P450 transcripts was carried out by amplifying approximately 0.1 µg of total RNA of each sample in one-step RT-PCR reactions containing 50 mM KCl, 10 mM Tris-HCl, pH 8.4, 200 µM each dNTP, 200 µg/mL gelatin, 40 pmol of a 5' gene-specific primer, 40 pmol of a 3' oligo(dT)17-EcoRI primer, 4 units of AMV reverse transcriptase (Promega, Madison, WI), 20 units of RNasin, and 2.5 units of Taq polymerase (Gibco-BRL, Cleveland). First-strand cDNAs were synthesized for 40 min at 42°C and subsequently PCR amplified for 18 to 22 cycles, with each cycle consisting of denaturation at 95°C for 1 min, annealing at 62°C for 1 min, and extension at 72°C for 2.5 min, followed by a final extension step of 72°C for 10 min. The number of PCR cycles used for each transcript (20 for CYP86A1, CYP86A8, CYP86A2, and CYP86A4; 22 for CYP86A7; 18 for EF-l{alpha}) was determined to be within the linear PCR amplification range for each transcript. PCR products were fractionated on 1.0% agarose gels, transferred to Hybond-N (Amersham-Pharmacia Biotech, Uppsala), and probed with random hexamer 32P-labeled probes corresponding to approximately 400 nt derived from the 3' end of each P450 gene or to an Arabidopsis EF-1{alpha} cDNA clone. After hybridization, the blots were scanned using a Typhoon 8600 variable model imager (Amersham-Pharmacia Biotech) and quantified by ImageQuant 5.1 software. For comparisons between treatments and controls, hybridization signals were corrected for the level of background hybridization and normalized to the level of the EF-1{alpha} RT-PCR product. The gene-specific primers used in this analysis were: 86A1 5', 5'CTTTTCATGAAGAACGGTTT3'; 86A2 5', 5'TACCCAAAGAGAGAAACGAC3'; 86A4 5', 5'GGTGTCTCTAACGGTCAATG3'; 86A7 5', 5'TTGACGTTGTTCATGAAGTT3'; 86A8 5', 5'GCGGATCTACGAGAGTGTAA3'; oligo(dT), 5'CGGAATTCTTTTTTTTTTTTTTTTT3'; EF-1{alpha} 5', 5'ACCACCAAGTACTACTGCAC3'; and EF-1{alpha} 3', 5'GACCTCTCAATCATGTTGTC3'. Probe sequences for each of the CYP86A transcripts are as follows: CYP86A1, 60 nt upstream to 392 nt downstream from the stop codon of the At5g58860 locus; CYP86A2, 101 nt upstream to 299 nt downstream from the stop codon of the At4g00360 locus; CYP86A4, 94 nt upstream to 306 nt downstream from the stop codon of the At1g01600; CYP86A7, 99 nt upstream to 384 nt downstream from the stop codon of the At1g63710 locus; and CYP86A8, 66 nt upstream to 390 nt downstream from the stop codon of the At2g45970 locus.


TLC Assay for Fatty Acid Hydroxylase Activity

Recombinant viruses containing each of the CYP86A subfamily members were constructed by RT-PCR strategies and expressed in Sf9 insect cells as described previously (Duan et al., 2004Go). Microsomal fractions were prepared from packed Sf9 cells, and the metabolism of lauric acid was assayed in a total volume of 200 µL containing 1x phosphate-buffered saline, pH 7.4, 25 µM [1-14C]lauric acid, 50 pmol P450 (as defined by carbon monoxide difference analysis; Omura and Sato, 1964Go), 6.7 mM Glc-6-P, and 1 unit Glc-6-P dehydrogenase. After incubation at 30°C for 5 min, the reaction was initiated by the addition of NADPH to a final concentration of 1 mM. After 90-min incubations, reactions were stopped by the addition of 20 µL of 6 N HCl, directly spotted onto silica-gel TLC plates (EMD Chemicals, Gibbstown, NJ), and developed using a mixture of diethyl ether:petroleum ether:formic acid (70:30:1). TLC plates were exposed and quantified on a Typhoon 8600 phosphor imager (Amersham Biosciences).


Sequence Alignment and Promoter Analysis

Amino acid and nucleotide sequence alignments were performed using Vector NTI software version 8.0 (InforMax, Bethesda, MD) and ClustalW version 1.6 (Thompson et al., 1994Go). SRS domains were determined by aligning the five CYP86A protein sequences to the structure-defined CYP102 (BM3) template using MOE programs (Chemical Computing Group, Montreal) and manually adjusting according to secondary structure predictions. Phylogenetic analyses were conducted using MEGA version 2.1 (Kumar et al., 2001Go). Promoter searches for cis-elements were done using the Ohio State University Web site (http://Arabidopsis.med.ohio-state.edu; Davuluri et al., 2003Go) and the PlantCARE Web site (http://intra.psb.ugent.be:8080/PlantCARE; Lescot et al., 2002Go), with sequences extending 2,000 nt upstream from the translation start site in each CYP86A gene. Pairwise comparisons between promoters were done using the PromoterWise program from European Bioinformatics Institute (EBI; http://www.ebi.ac.uk/Wise2/promoterwise.html), using the default settings. Direct and inverted matches containing two or more guanosines or cytosines in a continuous region of seven or more nucleotides are selected as conserved elements.


    ACKNOWLEDGMENTS
 
We gratefully acknowledge Dr. Shahjahan Ali, Dr. Yurdagul Ferhatoglu, Dr. Jyothi Thimmapuram, Dr. Mark Band, Dr. Daniele Werck-Reichhart, and Mr. Albert Bari for their assistance in construction and for analysis of the microarrays associated with this study. We also acknowledge Ms. Wen Gu for help with cloning CYP86A2 and CYP86A4, Mr. Sangeewa Rupasinghe for modeling the SRS domains within these proteins, and Mr. Saranyan Palaniswamy and Dr. Erich Grotewold for help in promoter database searches.

Received October 28, 2004; returned for revision December 3, 2004; accepted December 9, 2004.


    FOOTNOTES
 
1 This work was supported by the National Science Foundation (NSF 2010 Project grant no. MCB 0115068 to M.A.S.). Back

[w] The online version of this article contains Web-only data. Back

Article, publication date, and citation information can be found at www.plantphysiol.org/cgi/doi/10.1104/pp.104.055715.

* Corresponding author; e-mail maryschu{at}uiuc.edu; fax 217–244–1336.


    LITERATURE CITED
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 
Benveniste I, Tijet N, Adas F, Philipps G, Salaün JP, Durst F (1998) CYP86A1 from Arabidopsis thaliana encodes a cytochrome P450-dependent fatty acid omega-hydroxylase. Biochem Biophys Res Commun 243: 688–693[CrossRef][Web of Science][Medline]

Blee E, Schuber F (1993) Biosynthesis of cutin monomers: involvement of a lipoxygenase/peroxygenase pathway. Plant J 4: 113–123

Cabello-Hurtado F, Batard Y, Salaün JP, Durst F, Pinot F, Werck-Reichart D (1998) Cloning, expression in yeast, and functional characterization of CYP81B1, a plant cytochrome P450 that catalyzes in-chain hydroxylation of fatty acids. J Biol Chem 273: 7260–7267[Abstract/Free Full Text]

Davuluri RV, Sun H, Palaniswamy SK, Matthews N, Molina C, Kurtz M, Grotewold E (2003) AGRIS: Arabidopsis gene regulatory information server, an information resource of Arabidopsis cis-regulatory elements and transcription factors. BMC Bioinformatics 4: 25[CrossRef][Medline]

Duan H, Civjan N, Sligar SG, Schuler MA (2004) Heterologous expression of Arabidopsis CYP73A5 in insect cells and incorporation into soluble nanoscale lipid bilayers. Arch Biochem Biophys 424: 141–153[CrossRef][Web of Science][Medline]

Durst F, Nelson DR (1995) Diversity and evolution of plant P450 and P450-reductases. Drug Metab Drug Interact 12: 189–206[Medline]

Fauth M, Schweizer P, Buchala A, Markstädter C, Riederer M, Kato T, Kauss H (1998) Cutin monomers and surface wax constituents elicit H2O2 in conditioned cucumber hypocotyl segments and enhance the activity of other H2O2 elicitors. Plant Physiol 117: 1373–1380[Abstract/Free Full Text]

Francis SA, Dewey FM, Gurr SJ (1996) The role of cutinase in germling development and infection by Erysiphe graminis f.sp. hordei. Physiol Mol Plant Pathol 49: 201–211[CrossRef]

Gibson GG (1989) Comparative aspects of the mammalian cytochrome P450 IV gene family. Xenobiotica 19: 1123–1148[Web of Science][Medline]

Gilbert RD, Johnson AM, Dean R (1996) Chemical signs responsible for appressorium formation in the rice blast fungus Magnaporthe grisea. Physiol Mol Plant Pathol 48: 335–346[CrossRef]

Gotoh O (1992) Substrate recognition sites in cytochrome P450 family 2 (CYP2) proteins inferred from comparative analyses of amino acid and coding nucleotide sequences. J Biol Chem 267: 83–90[Abstract/Free Full Text]

Imaishi H, Matsumoto Y, Ohkawa H (1999) Encoding of a cytochrome P450-dependent lauric acid monooxygenases by CYP703A1 specifically expressed in the floral buds of Petunia hybrida. Biosci Biotechnol Biochem 63: 2082–2090[CrossRef][Medline]

Imaishi H, Matsuo S, Swai E, Ohkawa H (2000) CYP78A1 preferentially expressed in developing inflorescences of Zea mays encoded a cytochrome P450-dependent lauric acid 12-monooxygenase. Biosci Biotechnol Biochem 64: 1696–1701[Medline]

Johnson EF, Palmer CN, Griffin KJ, Hsu MH (1996) Role of the peroxisome proliferator-activated receptor in cytochrome P450 4A gene regulation. FASEB J 10: 1241–1248[Abstract]

Kahn RA, Durst F (2000) Function and evolution of plant cytochrome P450. Recent Adv Phytochem 34: 151–189

Kahn RA, LeBouquin R, Pinot F, Benveniste I, Durst F (2001) A conservative amino acid substitution alters the regiospecificity of CYP94A2, a fatty acid hydroxylase from the plant Vicia sativa. Arch Biochem Biophys 391: 180–187[CrossRef][Web of Science][Medline]

Kauss H, Fauth M, Merten A, Jeblick W (1999) Cucumber hypocotyls respond to cutin monomers via both an inducible and a constitutive H2O2-generating system. Plant Physiol 120: 1175–1182[Abstract/Free Full Text]

Koiwai K, Matsuzaki T (1988) Hydroxy and normal fatty acid distribution in stigmas of Nicotiana and other plants. Phytochemistry 27: 2827–2830[CrossRef]

Kolattukudy PE (1980) Biopolyester membranes of plants: cutin and suberin. Science 208: 990–1000[Abstract/Free Full Text]

Kolattukudy PE (2001) Cutin from plants. In Y Doi, A Steinbüchel, eds, Biopolymers, Vol 3a. Wiley-VCH, Weinheim, Germany, pp 1–35

Kumar S, Tamura K, Jakobsen IB, Nei M (2001) MEGA2: molecular evolutionary genetics analysis software. Bioinformatics 17: 1244–1245[Abstract/Free Full Text]

Le Bouquin R, Pinot F, Benveniste I, Salaun JP, Durst F (1999) Cloning and functional characterization of CYP94A2, a medium chain fatty acid hydroxylase from Vicia sativa. Biochem Biophys Res Commun 261: 156–162[CrossRef][Web of Science][Medline]

Le Bouquin R, Skrabs M, Kahn R, Benveniste I, Salaun JP, Schreiber L, Durst F, Pinot F (2001) CYP94A5, a new cytochrome P450 from Nicotiana tabacum is able to catalyze the oxidation of fatty acids to the omega-alcohol and to the corresponding diacid. Eur J Biochem 268: 3083–3090[Web of Science][Medline]

Lescot M, Dehais P, Thijs G, Marchal K, Moreau Y, Van de Peer Y, Rouze P, Rombauts S (2002) PlantCARE, a database of plant cis-acting regulatory elements and a portal to tools for in silico analysis of promoter sequences. Nucleic Acids Res 30: 325–327[Abstract/Free Full Text]

Li H, Poulos TL (1994) Structural variation in heme enzymes: a comparative analysis of peroxidase and P450 crystal structures. Structure 2: 461–464[Medline]

Li H, Poulos TL (1997) The structure of the cytochrome P450BM-3 haem domain complexed with the fatty acid substrate, palmitoleic acid. Nat Struct Biol 4: 140–146[CrossRef][Web of Science][Medline]

Nelson DR, Schuler MA, Paquette SM, Werck-Reichhart D (2004) Comparative genomics of Oryza sativa and Arabidopsis thaliana. Analysis of 727 cytochrome P450 genes and psuedogenes from a monocot and a dicot. Plant Physiol 135: 756–772[Abstract/Free Full Text]

Ohkuma M, Zimmer T, Iida T, Schunck WH, Ohta A, Takagi M (1998) Isozyme function of n-alkane-inducible cytochromes P450 in Candida maltosa revealed by sequential gene disruption. J Biol Chem 273: 3948–3953[Abstract/Free Full Text]

Omura T, Sato R (1964) The carbon monoxide-binding pigment of liver microsomes: I. Evidence for its hemoprotein nature. J Biol Chem 239: 2370–2378[Free Full Text]

Petkova-Andonova M, Imaishi H, Ohkawa H (2002) CYP92B1, a cytochrome P450, expressed in petunia flower buds, that catalyzes monooxidation of long-chain fatty acids. Biosci Biotechnol Biochem 66: 1819–1828[Medline]

Pinot F, Benveniste I, Salaün JP, Durst F (1998) Methyl jasmonate induces lauric acid {omega}-hydroxylase activity and accumulation of CYP94A1 transcripts but does not affect epoxide hydrolase activities in Vicia sativa seedlings. Plant Physiol 118: 1481–1486[Abstract/Free Full Text]

Pinot F, Benveniste I, Salaün JP, Loreau O, Noël JP, Schreiber L, Durst F (1999) Production in vitro by the cytochrome P450 CYP94A1 of major C18 cutin monomers and potential messengers in plant-pathogen interactions: enantioselectivity studies. Biochem J 342: 27–32

Ravichandran KG, Boddupalli SS, Hasemann CA, Peterson JA, Deisenhofer J (1993) Crystal structure of hemoprotein domain of P450BM-3, a prototype for microsomal P450s. Science 261: 731–736[Abstract/Free Full Text]

Rupasinghe S, Baudry J, Schuler MA (2004) Common active site architecture and binding strategy of four phenylpropanoid P450s from Arabidopsis thaliana as revealed by molecular modeling. Protein Eng 16: 721–731

Salaün JP, Helvig C (1995) Cytochrome P450-dependent oxidation of fatty acids. Drug Metab Drug Interact 12: 261–283[Medline]

Scheller U, Zimmer T, Becher D, Schauer F, Schunck WH (1998) Oxygenation cascade in conversion of n-alkanes to alpha,omega-dioic acids catalyzed by cytochrome P450 52A3. J Biol Chem 273: 32528–32534[Abstract/Free Full Text]

Scheller U, Zimmer T, Kargel E, Schunck WH (1996) Characterization of the n-alkane and fatty acid hydroxylating cytochrome P450 forms 52A3 and 52A4. Arch Biochem Biophys 328: 245–254[CrossRef][Medline]

Schweizer P, Felix G, Buchala A, Muller C, Métraux JP (1996a) Perception of free cutin monomers by plant cells. Plant J 10: 331–341

Schweizer P, Jeanguenat A, Whitacre D, Métraux JP, Mösinge E (1996b) Induction of resistance in barley against Erysiphe graminis f.sp hordei by free cutin monomers. Physiol Mol Plant Pathol 49: 103–120[CrossRef]

Seghezzi W, Sanglard D, Fiechter A (1991) Characterization of a second alkane-inducible cytochrome P450-encoding gene, CYP52A2, from Candida tropicalis. Gene 106: 51–60[CrossRef][Medline]

Sieberer P, Schorderet M, Ryser U, Buchala A, Kolattukudy P, Métraux JP, Nawrath C (2000) Transgenic Arabidopsis plants expressing a fungal cutinase show alterations in the structure and properties of the cuticle and postgenital organ fusions. Plant Cell 12: 721–738[Abstract/Free Full Text]

Simpson AE (1997) The cytochrome P450 4 (CYP4) family. Gen Pharmacol 28: 351–359[Web of Science][Medline]

Thompson JD, Higgins DG, Gibson TJ (1994) CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positions-specific gap penalties and weight matrix choice. Nucleic Acids Res 22: 4673–4680[Abstract/Free Full Text]

Tijet N, Helvig C, Pinot F, Le Bouquin R, Lesot A, Durst F, Salaun JP, Benveniste I (1998) Functional expression in yeast and characterization of a clofibrate-inducible plant cytochrome P-450 (CYP94A1) involved in cutin monomers synthesis. Biochem J 332: 583–589

van De Loo FJ, Fox BG, Somermille C (1993) Unusual fatty acids. In TS Moore, ed, Lipid Metabolism in Plants. CRC Press, Boca Raton, FL, pp 91–126

Wellesen K, Durst F, Pinot F, Benveniste I, Nettesheim K, Wisman E, Steiner-Lange S, Saedler H, Yephremov A (2001) Functional analysis of the LACERATA gene of Arabidopsis provides evidence for different roles of fatty acid {omega}-hydroxylation in development. Proc Natl Acad Sci USA 98: 9694–9699[Abstract/Free Full Text]

Werck-Reichhart D, Bak S, Paquette S (2002) Cytochrome P450. In CR Somerville, EM Meyerowitz, eds, The Arabidopsis Book. American Society of Plant Biologists, Rockville, MD, http://www.aspb.org/publications/Arabidopsis

Wolters-Arts M, Lush WM, Mariani C (1998) Lipids are required for directional pollen-tube growth. Nature 392: 818–821[CrossRef][Medline]

Xiao F, Goodwin SM, Xiao Y, Sun Z, Baker D, Tang X, Jenks MA, Zhou JM (2004) Arabidopsis CYP86A2 represses Pseudomonas syringae type III genes and is required for cuticle development. EMBO J 23: 2903–2913[CrossRef][Web of Science][Medline]




This article has been cited by other articles:


Home page
Plant Physiol.Home page
A. A. Dobritsa, J. Shrestha, M. Morant, F. Pinot, M. Matsuno, R. Swanson, B. L. Moller, and D. Preuss
CYP704B1 Is a Long-Chain Fatty Acid {omega}-Hydroxylase Essential for Sporopollenin Synthesis in Pollen of Arabidopsis
Plant Physiology, October 1, 2009; 151(2): 574 - 589.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
O. Serra, M. Soler, C. Hohn, V. Sauveplane, F. Pinot, R. Franke, L. Schreiber, S. Prat, M. Molinas, and M. Figueras
CYP86A33-Targeted Gene Silencing in Potato Tuber Alters Suberin Composition, Distorts Suberin Lamellae, and Impairs the Periderm's Water Barrier Function
Plant Physiology, February 1, 2009; 149(2): 1050 - 1060.
[Abstract] [Full Text] [PDF]


Home page
J Exp BotHome page
R. Hofer, I. Briesen, M. Beck, F. Pinot, L. Schreiber, and R. Franke
The Arabidopsis cytochrome P450 CYP86A1 encodes a fatty acid {omega}-hydroxylase involved in suberin monomer biosynthesis
J. Exp. Bot., June 1, 2008; 59(9): 2347 - 2360.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
M. Efetova, J. Zeier, M. Riederer, C.-W. Lee, N. Stingl, M. Mueller, W. Hartung, R. Hedrich, and R. Deeken
A Central Role of Abscisic Acid in Drought Stress Protection of Agrobacterium-Induced Tumors on Arabidopsis
Plant Physiology, November 1, 2007; 145(3): 853 - 862.
[Abstract] [Full Text] [PDF]


Home page
Plant CellHome page
R. Kannangara, C. Branigan, Y. Liu, T. Penfield, V. Rao, G. Mouille, H. Hofte, M. Pauly, J. L. Riechmann, and P. Broun
The Transcription Factor WIN1/SHN1 Regulates Cutin Biosynthesis in Arabidopsis thaliana
PLANT CELL, April 1, 2007; 19(4): 1278 - 1294.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
M. C. Suh, A. L. Samuels, R. Jetter, L. Kunst, M. Pollard, J. Ohlrogge, and F. Beisson
Cuticular Lipid Composition, Surface Structure, and Gene Expression in Arabidopsis Stem Epidermis
Plant Physiology, December 1, 2005; 139(4): 1649 - 1665.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
M. Langlois-Meurinne, C. M.M. Gachon, and P. Saindrenan
Pathogen-Responsive Expression of Glycosyltransferase Genes UGT73B3 and UGT73B5 Is Necessary for Resistance to Pseudomonas syringae pv tomato in Arabidopsis
Plant Physiology, December 1, 2005; 139(4): 1890 - 1901.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
K. Kawaura, K. Mochida, and Y. Ogihara
Expression Profile of Two Storage-Protein Gene Families in Hexaploid Wheat Revealed by Large-Scale Analysis of Expressed Sequence Tags
Plant Physiology, December 1, 2005; 139(4): 1870 - 1880.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
H. Duan, M.-Y. Huang, K. Palacio, and M. A. Schuler
Variations in CYP74B2 (Hydroperoxide Lyase) Gene Expression Differentially Affect Hexenal Signaling in the Columbia and Landsberg erecta Ecotypes of Arabidopsis
Plant Physiology, November 1, 2005; 139(3): 1529 - 1544.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow All Versions of this Article:
137/3/1067    most recent
pp.104.055715v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Web of Science (28)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Duan, H.
Right arrow Articles by Schuler, M. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Duan, H.
Right arrow Articles by Schuler, M. A.
Agricola
Right arrow Articles by Duan, H.
Right arrow Articles by Schuler, M. A.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
ASPB Publications PLANT PHYSIOLOGY® THE PLANT CELL
Copyright © 2005 by the American Society of Plant Biologists