|
|
||||||||
|
First published online February 22, 2005; 10.1104/pp.104.056028 Plant Physiology 137:1147-1159 (2005) © 2005 American Society of Plant Biologists Salicylic Acid-Dependent Expression of Host Genes in Compatible Arabidopsis-Virus Interactions1,[w]Department of Plant Pathology, Iowa State University, Ames, Iowa 500111020 (Z.H., J.D.H., S.A.W); and Illumina, Incorporated, San Diego, California 92121 (J.M.Y., E.W.G., J.-B.F.)
Plant viruses elicit the expression of common sets of genes in susceptible hosts. Studies in Arabidopsis (Arabidopsis thaliana) and tomato (Lycopersicon esculentum) indicate that at least one-third of the genes induced in common by viruses have been previously associated with plant defense and stress responses. The genetic and molecular requirements for the induction of these stress and defense-related genes during compatible host-virus interactions were investigated with a panel of Arabidopsis mutant and transgenic plants defective in one or more defense signaling pathways. pad4, eds5, NahG, npr1, jar1, ein2, sid2, eds1, and wild-type Columbia-0 and Wassilewskija-2 plants were infected with two different viruses, cucumber mosaic virus and oilseed rape mosaic virus. Gene expression was assayed by a high-throughput fiber-optic bead array consisting of 388 genes and by RNA gel blots. These analyses demonstrated that, in compatible host-virus interactions, the expression of the majority of defense-related genes is induced by a salicylic acid-dependent, NPR1-independent signaling pathway with a few notable exceptions that did require NPR1. Interestingly, none of the mutant or transgenic plants showed enhanced susceptibility to either cucumber mosaic virus or oilseed rape mosaic virus based on both symptoms and virus accumulation. This observation is in contrast to the enhanced disease susceptibility phenotypes that these mutations or transgenes confer to some bacterial and fungal pathogens. These experimental results suggest that expression of many defense-related genes in compatible host plants might share components of signaling pathways involved in incompatible host-pathogen interactions, but their increased expression has no negative effect on viral infection.
Viruses are obligate pathogens that use various strategies to coopt cellular resources of compatible host plants to promote their infections. Compatible host-virus interactions result in systemic infections that are typically accompanied by the onset of disease symptoms. By contrast, incompatible interactions result in cessation of virus replication and movement at or near the sites of inoculation. In compatible hosts, viral invasion triggers numerous biochemical and physiological changes in cells, tissues, and even whole plants (Maule et al., 2002
These spatial and temporal studies involving in situ hybridization in cotyledons cited above were applied to only a handful of plant genes. To gain a more global perspective on how viruses alter host gene expression patterns, DNA microarrays and other genomics methods are beginning to be applied, albeit with less spatial resolution at this time. cDNA subtraction followed by macroarray analysis identified at least 55 tomato (Lycopersicon esculentum) genes that were differentially expressed after infection with two potato spindle tuber viroid strains. Functional classification of these genes suggested that they are involved in defense/stress response, cell wall structure, chloroplast function, and other diverse cellular processes (Itaya et al., 2002
The mechanisms by which plant viruses alter the expression of different groups of host genes are beginning to be deciphered and in part have revealed the underlying causes of virus-induced symptoms (Whitham and Wang, 2004
Since little is known about the signal transduction pathways that are involved in compatible plant-virus interactions, we were interested to expand our understanding of how the SA and JA/ET signaling pathways influence expression of host genes in susceptible plants and if either of these pathways play significant roles in basal antiviral defenses. To accomplish these objectives, pad4-1, eds5-1, NahG, npr1-1, jar1-1, ein2-1, and wild-type Columbia-0 (Col-0) plants were infected with cucumber mosaic virus strain Y (CMV-Y) and oilseed rape mosaic virus (ORMV). The expression of 388 selected genes, accumulation of viral RNAs, and disease symptoms were monitored. These studies were facilitated by recent development of a high-throughput gene expression profiling system using the cDNA-mediated annealing, selection, extension, and ligation (DASL) assay coupled with universal fiber-optic bead array matrices (Fan et al., 2004
Expression-Profiling Responses to Viral Infection in Mutant and Wild-Type Plants by the High-Throughput DASL Assay and Fiber-Optic Bead Array Method
Our previous work demonstrated that genes associated with plant defense responses, including PR genes, are induced in compatible Arabidopsis leaves during virus infection (Whitham et al., 2003
To interrogate Arabidopsis gene expression in response to ORMV and CMV infections in the defense signaling mutants, we used a recently developed gene expression method called the DASL assay (Fan et al., 2004 To allow the use of universal microarrays, the query oligos also contain a unique address sequence that is associated with each targeted site. This address sequence allows the amplified product, which is labeled during PCR with a fluorescent primer, to hybridize to a microarray bearing the complementary address sequences. The DASL assay used 100 ng of total RNA to analyze the 388 genes, 5- to 100-fold less than that required by quantitative PCR, which usually takes 2 to 50 ng per reaction (per gene). All these advantages make it an ideal platform for validation of candidate genes or for studying the transcriptional regulation of preselected gene sets derived from initial genome-wide screenings, such as in this study.
The fiber-optic bundles are assembled into an array matrix (Sentrix Array Matrix, Illumina, San Diego) comprising 96 bundles (i.e. arrays) arranged in an 8 x 12 matrix that matches the dimensions of standard microtiter plates. This arrangement allows simultaneous processing of 96 samples at once, which permits rapid analyses of expression patterns in hundreds of samples. The 63 RNA samples (3 treatments x 7 genotypes x 3 biological replicates) from each time point were grouped together on separate 96-well plates (126 total samples) for labeling by the DASL procedure and hybridization to array matrices. For details on labeling, hybridization, and scanning, see "Materials and Methods" (see also Fan et al., 2003 A linear mixed-effects model was fit to the data, ANOVA was used to compute an F-statistic, and then P values were assigned to each gene in the normalized data set. We first analyzed the data to identify the genes that had expression patterns that were significantly altered by plant genotype (P < 0.01). This analysis identified 187 and 176 genes from the 2 and 5 DAI data sets, respectively. Extensive overlap between the resulting gene lists was expected, and indeed 133 genes were present at both time points. In total, this analysis indicated that the expression of 230 of the 388 Arabidopsis genes on the array was significantly affected (P < 0.01) by genotype of the plants at one or both time points.
To understand how genotype affected the expression of these 230 genes in the context of virus treatment, their expression profiles were grouped using average linkage-hierarchical clustering, and the output was viewed with the TreeView program (Eisen et al., 1998
Effects of NahG Transgene on Genes Induced by Viral Infection and Affected by Genotype
Here, we focus on genes that were induced in response to CMV-Y and/or ORMV at 2 and 5 DAI in wild-type plants and that had expression profiles that were significantly altered in one or more of the mutant genotypes (P
Effects of NahG and Mutants on Basal Expression Levels of Virus-Induced Genes The sensitivity of the DASL assay allowed us to examine the basal expression levels of these genes, which is typically not possible by RNA gel blots or other array-based technologies. To further examine the effects of genotype on basal expression, we plotted the expression values of some selected genes at 2 and 5 DAI (Fig. 2) and determined P values of each gene for pairwise comparisons of the mock-inoculated Col-0 versus each of the mock-inoculated mutants (Supplemental Table IV). The expression of PR-1, Bgl2, and PR-5 was consistently lower in mock-inoculated NahG plants versus mock-inoculated Col-0 plants (Fig. 2). Expression of PR-1 and Bgl2 was significantly lower (P < 0.01) in mock-inoculated NahG plants than in Col-0. PR-5 was consistently lower in NahG plants, but the biological variability did not result in a P < 0.01. As shown in Supplemental Table IV, 27 of these 65 genes have P < 0.01 for the mock-infected NahG versus the Col-0 suggesting that SA is an important component in determining their basal expression levels. Furthermore, PR-1 and another gene, At2g14560, have a strong requirement for EDS5 and NPR1 for their basal accumulation levels (Fig. 2). Thus, SA and other components of defense signaling pathways are not only required in the induction process but function in maintaining some steady-state level of expression.
Effects of ein2 and jar1 Mutants on Genes that Are Induced and Regulated by SA
Inspection of Figure 1 reveals some distinct profiles of gene expression among the remaining mutant genotypes. To further examine the relationships of the expression profiles for the different combinations of treatment and genotype, we used average linkage-hierarchical clustering to group the samples at 2 or 5 DAI (Fig. 3). jar1 mock-infected plants do not cluster with other mock-infected plants at 2 or 5 DAI. At 5 DAI, jar1 mock-infected plants are most similar to jar1 plants inoculated with CMV-Y, and ein2 mock-inoculated plants are most similar to ein2 plants inoculated with CMV-Y. This point is illustrated best in Figure 1; here, the ein2-1 and jar1-1 mock-inoculated samples have overall higher basal levels of expression (less intense green) when compared to the Col-0 mock-inoculated sample. This was not the case for mock-inoculated samples of the other mutants. This is also illustrated in Figure 2A, in which the average signal values for PR-1 are plotted. PR-1 was the gene most significantly affected by the jar1 and ein2 mutations. In the mock-infected plants, PR-1 expression is significantly higher compared to wild-type plants (P < 0.01; Supplemental Table IV), and its induced levels in jar1 mutants are significantly higher than virus-infected Col-0 plants (P < 0.01; Table I). Thus, EIN2 and JAR1 repress the expression of PR-1. This observation is consistent with cross talk between the SA and JA/ET pathways that has previously been described in incompatible host-pathogen interactions (Glazebrook, 2001
Effects of eds5, npr1, and pad4 Mutants on Genes That Are Induced and Regulated by SA At 2 DAI, the CMV-Y- and ORMV-infected npr1-1 samples cluster with their Col-0 counterparts (Fig. 3A), indicating that early expression of these genes is not dependent on NPR1. However, at 5 DAI the CMV-infected npr1-1 sample clusters with NahG and mock-infected samples (Fig. 3B), indicating that sustained induction of these genes in response to CMV-Y requires NPR1. The ORMV-infected npr1-1 sample clusters with the corresponding eds5-1 treatment. As illustrated in Figure 1B, the overall expression of genes in response to ORMV in these 2 mutants is reduced compared with the ORMV-infected Col-0 plants. These results suggest a partial requirement for NPR1 in the virus-induced expression of this set of genes, especially at the 5 DAI time point. pad4-1 mutants cluster with other infected plants at 2 DAI (Fig. 3A) and cluster with their corresponding infected wild-type Col-0 samples at 5 DAI (Fig. 3B). This indicates that PAD4 has less effect on the expression of defense-related genes, although its function is needed for maximal induction in compatible host-virus interactions.
The dramatic effects of an SA-mediated signaling pathway on host gene expression profiles in these compatible host-virus interactions led us to investigate if any of the corresponding signaling mutants had a significant effect on the accumulation of CMV-Y or ORMV. For both viruses, the 2-DAI time point is within the interval when virus accumulation is increasing rapidly with time, and 5 DAI represents a relatively late time point at which the accumulation rate is decreasing. To further investigate the susceptibility of these plants to CMV-Y and ORMV, northern-blot hybridization was used to determine the accumulation of viral RNAs in inoculated leaves of each of the seven Arabidopsis genotypes. Displayed in Figure 4 are data from a single biological replicate illustrating that the accumulation of ORMV and CMV-Y genomic and subgenomic RNAs was not enhanced at 5 DAI in mutant and NahG lines compared to Col-0 wild-type plants. Conclusions from these northern-blot data were supported by quantitative real-time PCR assays performed on the virus-infected mutant and wild-type RNA samples at 2 and 5 DAI. Among the three replicates of this experiment, CMV-Y and ORMV did not accumulate to significantly higher levels in the mutants compared to Col-0 at early or late time points (P > 0.15 for all mutants; Supplemental Table V). In each replicate, a set of mock- and virus-inoculated plants was also saved and monitored for symptoms through 14 DAI. However, no consistent differences in symptoms were observed on the mutants or NahG plants in comparison to wild-type Col-0 plants (data not shown). To ensure that all plants had the expected genotype, we confirmed the sequence of the corresponding mutant alleles by sequencing PCR products amplified from mutant and wild-type genomic DNA samples. Taken together, these results suggested that the basal susceptibility of Arabidopsis to CMV-Y and ORMV was not significantly enhanced when the SA-, JA-, or ET-dependent signaling pathways were disrupted, which is unlike the case for bacterial and fungal pathogens (e.g. Nawrath and Metraux, 1999
Expression of Defense-Related Genes in sid2 and eds1 Mutants in Response to Virus Infection
To extend our findings and confirm the requirement for SA in the expression of the defense-related genes, we inoculated sid2-1 and eds1-1 mutants with ORMV and CMV. sid2 was of particular interest, because it is deficient in SA biosynthesis (Wildermuth et al., 2001
We explored the functions of signal transduction pathways involving SA, JA, and ET in mediating responses to infection in compatible host-virus interactions. This research was aided by an emerging technology, a fiber-optic bead array coupled with the DASL assay (Fan et al., 2004
The experimental design allowed for statistical analysis of the bead array data using a linear mixed-effects model as opposed to using a fold change cutoff. The use of a strict fold change cutoff is not appropriate for this gene expression assay or other types of microarray analysis, because they tend to underestimate fold change (Yuen et al., 2002
Previous studies have demonstrated that SA synthesis is not induced in tobacco (Nicotiana tabacum) or Arabidopsis in response to compatible viruses. For example, tobacco plants carrying the N gene conferring TMV resistance rapidly accumulate free and conjugated forms of SA following virus infection at temperatures permissive to the resistance response. In contrast, these same N plants do not develop a resistance response at 32°C, allow systemic TMV infection, and do not accumulate additional free or conjugated forms of SA (Malamy et al., 1992
It was also noteworthy that the basal expression levels of many of these defense-related genes were lower in the mock-inoculated NahG plants compared to wild-type Col-0 plants. This observation suggested to us that not only is SA important for induction of the defense-like responses, but in the absence of pathogen attack, SA may sustain basal levels of genes associated with resistance responses and keep the defense system primed. We were able to identify this role for SA, because the sensitivity of the DASL gene expression assay allows detection of low-abundance transcripts that are below the threshold of widely used assays such as RNA gel blots and other microarray techniques (Yeakley et al., 2002
In addition to SA, plant responses to pathogen infections are controlled by JA, ET, and several other regulatory genes. A role for JA and ET in the induction of these genes was excluded by using the ein2 and jar1 mutants, which are insensitive to ET and JA, respectively. These mutants are also compromised in their resistance to certain bacterial and fungal pathogens and fail to express defense marker genes such as PDF1.2 (Pieterse et al., 1998
Despite the significant negative effects of the defense signaling pathway mutants related to SA on basal expression of and induction of numerous defense-related genes in compatible virus infections, there was not a concomitant enhancement of susceptibility to CMV-Y or ORMV. None of the mutants tested accumulated significantly more viral genomic or subgenomic RNAs than wild-type Col-0 plants (Figs. 4 and 5A; Supplemental Table V) nor did they develop more severe symptoms (data not shown). These results suggest that the components of the SA, JA, and ET signaling pathways that were examined do not confer basal resistance to CMV-Y and ORMV nor do they have roles in symptomatology. We conclude that the lack of functional systemic-acquired resistance (SAR) or induced-systemic resistance pathways does not necessarily confer enhanced susceptibility to infection by ORMV and CMV. This is in contrast to the important role of SA in gene-for-gene types of resistant host-virus interactions that involve the hypersensitive response. For example, the N-, HRT-, and RCY1-mediated resistance responses to TMV, TCV, and CMV-Y, respectively, have an absolute requirement for SA (Friedrich et al., 1995
Overall, we propose the following model that incorporates elements from our studies and others to explain the transcriptional behavior of the set of genes investigated here. In the absence of an Avr/R gene interaction, virus invasion is somehow detected and then this information is relayed through PAD4 and EDS1. The response that is initiated requires SA to potentiate and sustain it, but appears to result from both NPR1-independent early events and later events that are both NPR1-dependent and -independent. Basal levels of SA are sufficient to activate defense-associated genes through both NPR1-dependent and NPR1-independent pathways. NPR1, EDS5, SID2, EDS1, PAD4, and SA are required for maximal accumulation of the transcripts. EDS5 and SID2 are likely to be involved via their roles in SA biosynthesis, whereas NPR1, EDS1, and PAD4 are involved in the signaling functions. The existence of the NPR1-independent pathway leading to PR gene expression has been noted by others in host responses to bacterial and fungal pathogens (Glazebrook et al., 1996 The data described here provide insight into a signaling pathway that accounts for one major facet of the gene expression changes elicited during compatible host-virus interactions. Many genes were induced that were not affected by the signal transduction pathways investigated here. This is apparent, because not all the induced genes were significantly affected by one of the plant genotypes that were tested. We also noted that many Arabidopsis genes were down-regulated by virus infection. Although our preliminary analyses suggest that one or more of the genotypes tested might perturb the expression of some of the down-regulated genes, more experiments are needed to clarify the mechanisms involved.
Preparation of Virions
ORMV and CMV-Y were propagated in tobacco (Nicotiana tabacum) cv SR1 (nn genotype) and tobacco cv Xanthi nc (NN genotype), respectively. The virions were purified as previously described (Chapman, 1998
The pad4-1, npr1-1, eds1-1, eds5-1, ein2-1, sid2-1, and jar1-1 mutants were obtained from the Arabidopsis Biological Resource Center, and the NahG line was obtained from Dr. X. Dong (Duke University). These mutants and transgenic lines have the Col-0 ecotype as their background except for eds1-1, which has Ws-2 as its wild-type progenitor. Appropriate wild-type plants were used as controls in all experiments. Arabidopsis (Arabidopsis thaliana) plants were grown in a growth room set for a 14-h photoperiod and 22°C. Four leaves of 21-d-old plants were labeled with a felt pen and dusted with carborundum. Leaves were rub-inoculated with 10 µL of CMV or ORMV virions that were diluted to 101 in 20 mM potassium phosphate buffer, pH 7.2. Plants of each genotype were also mock inoculated with phosphate buffer alone. Leaves from 3 plants were harvested at 2 and 5 DAI, snap frozen in liquid nitrogen, and stored at 80°C. For each treatment and genotype, 3 additional plants were kept for symptom observation until 14 DAI. The three biological replicates of these experiments that were performed were consistent with a randomized complete block design. In total, 126 independent samples were collected for RNA extraction and array analysis.
Total RNA was isolated using a modified TRIzol method (38% saturated phenol, pH 4.3, 0.8 M guanidine thiocyanate, 0.4 M ammonium thiocyanate, 0.1 M sodium acetate, and 5% glycerol; Chomczynski and Sacchi, 1987
Total RNA, 2.5 µg, was diluted to 11 µL with diethyl pyrocarbonate-water, mixed with 4.5 µL 100 mM sodium phosphate, pH 7.0, 22.5 µL dimethyl sulfoxide, and 6.6 µL 6 M glyoxal (deionized pH > 5), and incubated 1 h at 50°C. Next, 6 µL of glyoxal-loading buffer (10 mM sodium phosphate, pH 7.0, 0.25% [w/v] bromphenol, 0.25% [w/v] xylene cyanol, and 50% [v/v] glycerol) was added to RNA samples. RNA samples were electrophoresed at 4 V cm1 in a 1% (w/v) agarose gel in 10 mM sodium phosphate running buffer, pH 7.0. Gels were rinsed with distilled water and equilibrated in 10 gel volumes of 20 x SSC (3 M sodium chloride and 0.3 M sodium citrate) for 45 min. RNA was transferred to nylon membranes (Zeta-probe GT, Bio-Rad Laboratories, Hercules, CA), which were washed in 20 mM Tris-HCl, pH 8.0, at 65°C to remove glyoxal after transfer, and UV cross-linked (1,200 Js cm2).
The following oligonucleotide primer pairs were used to amplify the ORMV and CMV CP genes, BGL2, PDF1.2, and the 18S ribosomal RN:. ORMV CP FP (5'-TCACCCATGGTTTACAACATCACGAGCTCG-3'), ORMV CP RP (5'-CACTTCTAGACTATGTAGCTGGCGCAGTAGCC-3'), CMV CP FP (5'-TCATCCATGGCTTTCCAAGGTACCAGTA-3'), CMV CP RP (5'-CATATCTAGACTAAAGACCGTTAACCACCTGCG-3'), 18S rRNA FP (5'-GACAGACTGAGAGCTCTTTCTTGA-3'), 18S rRNA RP (5'-ACGTAGCTAGTTAGCAGGCTGAG-3'), BGL2 FP (5'-TCAACAGCTATAGCCACTGACAC-3'), BGL2 RP (5'-CTATCACTGGTTCGAGAAAGCTC-3'), PDF1.2 FP (5'-AATGAGCTCTCATGGCTAAGTTTGCTTCC-3'), and PDF1.2 RP (5'-AATCCATGGAATACACACGATTTAGCACC-3'; Penninckx et al., 1996
A set of 388 genes was selected for microarray analyses based upon previous experiments that identified genes that were up- or down-regulated in response to virus infection using Affymetrix GeneChip probe arrays (Whitham et al., 2003
To determine which of the 388 genes monitored by the bead array were most significantly affected by the plant genotype or various pairwise interactions, a linear mixed-effects statistical model was used to perform ANOVA analyses on the normalized gene expression data (Wolfinger et al., 2001
The SAS program version 9 (SAS Institute, Cary, NC) was used to analyze the microarray data using this mixed-effects model. This program was run independently for the 2-DAI and 5-DAI data sets. The null hypothesis was that there was no difference in gene expression among the genotypes. Genes at or below the P < 0.01 threshold were selected as likely to be reliably influenced by plant genotype. This analysis provided sets of 187 and 176 genes at the 2 -and 5-DAI time points, respectively. Additional pairwise comparisons were performed to examine specific relationships between individual treatments across the genotypes (Supplemental Tables III and IV). To better understand how the expression profiles of the genes were related to each other, these genes were subjected to average linkage-hierarchical clustering using the Cluster program, and the TreeView program was used to display the results (Eisen et al., 1998
Quantitative real-time reverse transcriptase (RT)-PCR assays of CMV-Y and ORMV were performed using the iScript One-Step RT-PCR kit with SYBR Green (Bio-Rad) on the iQ Real-Time PCR Detection System (Bio-Rad). Each reaction contained 12.5 µL (reaction mix), 5 pmol of forward and reverse primers, 0.5 µL (RT mix), 1.0 ng RNA template, and RNase free water to 25 µL. Samples were incubated for 10 min at 50°C followed by 40 cycles of 95°C for 10 s and 60°C for 30 s. Relative quantification was performed using the standard curve method, and all relative virus levels were normalized to the quantity of 18S. Normalized virus quantities were averaged for the three biological replicates and Student's t test was used determine if virus quantities in each mutant were significantly different from virus quantities in wild Col-0 leaves (Supplemental Table V). Primers used for quantitative PCR studies were: 18SF, GACAGACTGAGAGCTCTTTCTTGA; 18SR, ACGTAGCTAGTTAGCAGGCTGAG; ORMVREP1F, GATGCCTATGTGGTGAAGGAATTCAGCG; ORMVREP1R, GCCGGCAAATCCACAAAGTTGAAATCCG; CMVREP1F, AAACGTATTTGGAACATGGCAGGCGG; CMVREP1R, CCACCGACCCGTGGAGAAATGAATG.
We thank Dan Nettleton for guidance and assistance on the linear mixed-effects statistical analyses. The authors thank Philippe Rigault and Eugene Chudin for their assistance with assay probe design and initial data analysis. We thank Arnold Oliphant, David Barker, and Kan Wang for their support and guidance for this work. Received November 4, 2004; returned for revision November 30, 2004; accepted November 30, 2004.
1 This work was supported by the U.S. Department of Agriculture-National Research Initiative (grant no. 023531912566 to S.A.W.), by the Iowa State University Plant Sciences Institute, and by the Hatch Act and State of Iowa Funds.
[w] The online version of this article contains Web-only data. Article, publication date, and citation information can be found at www.plantphysiol.org/cgi/doi/10.1104/pp.104.056028. * Corresponding author; e-mail swhitham{at}iastate.edu; fax 5152949420.
Aranda MA, Escaler M, Wang D, Maule AJ (1996) Induction of HSP70 and polyubiquitin expression associated with plant virus replication. Proc Natl Acad Sci USA 93: 1528915293 Barker DJT, Theriault G, Che D, Dickinson T, Shen R, Kain R (2003) Self-assembled random arrays: high performance imaging and genomics applications on high-density microarray platform. Proc SPIE 4966: 111[CrossRef]
Bibikova M, Talantov D, Chudin E, Yeakley JM, Chen J, Doucet D, Wickham E, Atkins D, Barker D, Chee M, et al (2004) Quantitative gene expression profiling in formalin-fixed, paraffin-embedded tissues using universal bead arrays. Am J Pathol 165: 17991807
Boyes DC, Zayed AM, Ascenzi R, McCaskill AJ, Hoffman NE, Davis KR, Gorlach J (2001) Growth stage-based phenotypic analysis of Arabidopsis: a model for high throughput functional genomics in plants. Plant Cell 13: 14991510
Chapman EJ, Prokhnevsky AI, Gopinath K, Dolja VV, Carrington JC (2004) Viral RNA silencing suppressors inhibit the microRNA pathway at an intermediate step. Genes Dev 18: 11791186 Chapman SN (1998) Tobamovirus isolation and RNA extraction. In GD Foster, SC Taylor, eds, Plant Virology Protocols: From Virus Isolation to Transgenic Resistance. Humana Press, Totowa, NJ
Chen J, Li WX, Xie D, Peng JR, Ding SW (2004) Viral virulence protein suppresses RNA silencing-mediated defense but upregulates the role of microrna in host gene expression. Plant Cell 16: 13021313 Chivasa S, Murphy AM, Naylor M, Carr JP (1997) Salicylic acid interferes with tobacco mosaic virus replication via a novel salicylhydroxamic acid-sensitive mechanism. Plant Cell 9: 547557[Abstract] Chomczynski P, Sacchi N (1987) Single-step method of RNA isolation by acid guanidinium thiocyanate- phenol-chloroform extraction. Anal Biochem 162: 156159[ISI][Medline] Clarke JD, Aarts N, Feys BJ, Dong X, Parker JE (2001) Constitutive disease resistance requires EDS1 in the Arabidopsis mutants cpr1 and cpr6 and is partially EDS1-dependent in cpr5. Plant J 26: 409420[CrossRef][ISI][Medline]
Clarke JD, Liu Y, Klessig DF, Dong X (1998) Uncoupling PR gene expression from NPR1 and bacterial resistance: characterization of the dominant Arabidopsis cpr6-1 mutant. Plant Cell 10: 557569
Clarke JD, Volko SM, Ledford H, Ausubel FM, Dong X (2000) Roles of salicylic acid, jasmonic acid, and ethylene in cpr-induced resistance in Arabidopsis. Plant Cell 12: 21752190
Delaney T, Uknes S, Vernooji B, Friedrich L, Weymann K, Negrotto D, Gaffney T, Gut-Rella M, Kessmann H, Ward E, et al(1994) A central role of salicylic acid in plant disease resistance. Science 266: 12471250 Dempsey DA, Pathirana MS, Wobbe KK, Klessig DF (1997) Identification of an Arabidopsis locus required for resistance to turnip crinkle virus. Plant J 11: 301311[CrossRef][ISI][Medline] Dewdney J, Reuber TL, Wildermuth MC, Devoto A, Cui J, Stutius LM, Drummond EP, Ausubel FM (2000) Three unique mutants of Arabidopsis identify eds loci required for limiting growth of a biotrophic fungal pathogen. Plant J 24: 205218[CrossRef][ISI][Medline]
Dunoyer P, Lecellier CH, Parizotto EA, Himber C, Voinnet O (2004) Probing the microRNA and small interfering RNA pathways with virus-encoded suppressors of RNA silencing. Plant Cell 16: 12351250
Eisen MB, Spellman PT, Brown PO, Botstein D (1998) Cluster analysis and display of genome-wide expression patterns. Proc Natl Acad Sci USA 95: 1486314868 Escaler M, Aranda MA, Thomas CL, Maule AJ (2000) Pea embryonic tissues show common responses to the replication of a wide range of viruses. Virology 267: 318325[CrossRef][ISI][Medline] Fan JB, Oliphant A, Shen R, Kermani BG, Garcia F, Gunderson KL, Hansen M, Steemers F, Butler SL, Deloukas P, et al (2003) Highly parallel SNP genotyping. Cold Spring Harb Symp Quant Biol 68: 6978[CrossRef][ISI][Medline]
Fan JB, Yeakley JM, Bibikova M, Chudin E, Wickham E, Chen J, Doucet D, Rigault P, Zhang B, Shen R, et al (2004) A versatile assay for high-throughput gene expression profiling on universal array matrices. Genome Res 14: 878885
Fan W, Dong X (2002) In vivo interaction between NPR1 and transcription factor TGA2 leads to salicylic acid-mediated gene activation in Arabidopsis. Plant Cell 14: 13771389 Feys BJ, Moisan LJ, Newman MA, Parker JE (2001) Direct interaction between the Arabidopsis disease resistance signaling proteins, EDS1 and PAD4. EMBO J 20: 54005411[CrossRef][ISI][Medline] Friedrich L, Vernooij B, Gaffney T, Morse A, Ryals J (1995) Characterization of tobacco plants expressing a bacterial salicylate hydroxylase gene. Plant Mol Biol 29: 959968[CrossRef][ISI][Medline] Gaffney T, Friedrich L, Vernooij B, Negrotto D, Nye G, Uknes S, Ward E, Kessmann H, Ryals J (1993) Requirement of salicylic acid for the induction of systemic acquired resistance. Science 261: 754756
Galinsky VL (2003) Automatic registration of microarray images. II. Hexagonal grid. Bioinformatics 19: 18321836 Glazebrook J (2001) Genes controlling expression of defense responses in Arabidopsis: 2001 status. Curr Opin Plant Biol 4: 301308[CrossRef][ISI][Medline] Glazebrook J, Rogers EE, Ausubel FM (1996) Isolation of Arabidopsis mutants with enhanced disease susceptibility by direct screening. Genetics 143: 973982[Abstract] Golem S, Culver JN (2003) Tobacco mosaic virus induced alterations in the gene expression profile of Arabidopsis thaliana. Mol Plant Microbe Interact 16: 681688[ISI][Medline] Gupta V, Willits MG, Glazebrook J (2000) Arabidopsis thaliana EDS4 contributes to salicylic acid (SA)-dependent expression of defense responses: evidence for inhibition of jasmonic acid signaling by SA. Mol Plant Microbe Interact 13: 503511[ISI][Medline]
Havelda Z, Maule AJ (2000) Complex spatial responses to cucumber mosaic virus infection in susceptible Cucurbita pepo cotyledons. Plant Cell 12: 19751986 Itaya A, Matsuda Y, Gonzales RA, Nelson RS, Ding B (2002) Potato spindle tuber viroid strains of different pathogenicity induces and suppresses expression of common and unique genes in infected tomato. Mol Plant Microbe Interact 15: 990999[ISI][Medline] Jirage D, Zhou N, Cooper B, Clarke JD, Dong X, Glazebrook J (2001) Constitutive salicylic acid-dependent signaling in cpr1 and cpr6 mutants requires PAD4. Plant J 26: 395407[CrossRef][ISI][Medline]
Kachroo P, Yoshioka K, Shah J, Dooner HK, Klessig DF (2000) Resistance to turnip crinkle virus in Arabidopsis is regulated by two host genes and is salicylic acid dependent but NPR1, ethylene, and jasmonate independent. Plant Cell 12: 677690 Kasschau KD, Xie Z, Allen E, Llave C, Chapman EJ, Krizan KA, Carrington JC (2003) P1/HC-Pro, a viral suppressor of RNA silencing, interferes with Arabidopsis development and miRNA unction. Dev Cell 4: 205217[CrossRef][ISI][Medline]
Katagiri F (2003) Attacking complex problems with the power of systems biology. Plant Physiol 132: 417419
Kinkema M, Fan W, Dong X (2000) Nuclear localization of NPR1 is required for activation of PR gene expression. Plant Cell 12: 23392350 Kloek AP, Verbsky ML, Sharma SB, Schoelz JE, Vogel J, Klessig DF, Kunkel BN (2001) Resistance to Pseudomonas syringae conferred by an Arabidopsis thaliana coronatine-insensitive (coi1) mutation occurs through two distinct mechanisms. Plant J 26: 509522[CrossRef][ISI][Medline] Kunkel BN, Brooks DM (2002) Cross talk between signaling pathways in pathogen defense. Curr Opin Plant Biol 5: 325331[CrossRef][ISI][Medline] Li J, Brader G, Palva ET (2004) The WRKY70 transcription factor: a node of convergence for jasmonate-mediated and salicylate-mediated signals in plant defense. Plant Cell 16: 319331 |