|
|
||||||||
|
First published online April 22, 2005; 10.1104/pp.104.057869 Plant Physiology 138:131-141 (2005) © 2005 American Society of Plant Biologists
Characterization and Expression Patterns of UDP-D-Glucuronate Decarboxylase Genes in Barley1,[w]Australian Centre for Plant Functional Genomics, School of Agriculture and Wine, University of Adelaide, South Australia 5064, Australia
UDP-D-glucuronate decarboxylase (EC 4.1.1.35) catalyzes the synthesis of UDP-D-xylose from UDP-D-glucuronate in an essentially irreversible reaction that is believed to commit glycosyl residues to heteroxylan and xyloglucan biosynthesis. Four members of the barley (Hordeum vulgare) UDP-D-glucuronate decarboxylase gene family, designated HvUXS1 to HvUXS4, have been cloned and characterized. Barley HvUXS1 appears to be a cytosolic enzyme, while the others are predicted to be membrane-bound proteins with single transmembrane helices. Heterologous expression of a barley HvUXS1 cDNA in Escherichia coli yields a soluble enzyme that converts UDP-D-glucuronate to UDP-D-xylose, is associated with a single molecule of bound NAD+, and is subject to feedback inhibition by UDP-D-xylose. Quantitative PCR shows that the HvUXS1 mRNA is most abundant among the 4 HvUXS genes, accounting for more than 80% of total HvUXS transcripts in most of the tissues examined. The abundance of HvUXS1 mRNA is 10-fold higher in mature roots and stems than in leaves, developing grains, or floral tissues. Transcriptional activities of HvUXS2 and HvUXS4 genes are relatively high in mature roots, coleoptiles, and stems compared with root tips, leaves, and floral tissues, while HvUXS3 mRNA is low in all tissues. In barley leaf sections, levels of the most abundant mRNA, encoding HvUXS1, reflect the amount of soluble enzymic protein and activity. In selected tissues where HvUXS1 transcript levels are high, cell walls have higher arabinoxylan contents.
UDP-D-GlcUA decarboxylase (EC 4.1.1.35) catalyzes the formation of UDP-D-Xyl from UDP-D-GlcUA. The enzyme is also known as UDP-D-Xyl synthase (UXS) and the UXS designation is used here. The decarboxylation of UDP-D-GlcUA catalyzed by UXS is believed to involve a UDP-4-keto-hexose intermediate that is formed following the initial transfer of a hydride from C-4 to NAD+. The resulting 4-keto-intermediate loses its C-6 as CO2 through -decarboxylation. The hydride is subsequently transferred back to the C-4 atom to form UDP-D-Xyl (Schutzbach and Feingold, 1970
UXS activity has been reported in a wide variety of flowering plants, including mung bean (Vigna radiate; Feingold et al., 1960
The key, primary sugar nucleotide involved in wall biosynthesis in most plants is UDP-D-Glc, which is the activated sugar donor for the biosynthesis of cell wall polysaccharides such as cellulose, xyloglucans, and (1
The UXS enzyme occupies a particularly important position in sugar nucleotide interconversion pathways in the Poaceae, where cell walls are characterized by much higher levels of (1 Here, we have examined the barley (Hordeum vulgare) UXS gene family through the analysis of extensive barley expressed sequence tag (EST) databases. Genes encoding both cytosolic and membrane-bound UXS enzymes from barley have been cloned and their sequences used for the design of specific primers for quantitative, real-time PCR (Q-PCR) comparisons of relative transcriptional activities of individual members of the gene family in a range of barley tissues. One nearly full-length cDNA has been expressed in Escherichia coli for confirmation that UXS activity is associated with the cDNA and for the production of polyclonal antibodies against the protein. The expressed enzyme was also examined for the presence of bound NAD+. The availability of enzymic assays, together with the antibodies and the gene-specific PCR primers, has allowed comparisons of mRNA levels with soluble HvUXS protein levels and soluble enzymic activity. These parameters are compared with cell wall polysaccharide composition in selected tissues to investigate possible connections between the expression of HvUXS genes and wall composition.
Cloning HvUXS cDNAs A 1,433-bp cDNA obtained after PCR amplification of cDNA from RNA extracted from young barley leaves, using a forward primer derived from a barley EST sequence (accession no. BE421348) and an oligo(dT) primer, had a high level of sequence identity with UXS genes from rice (94%, accession no. BAB84334), Arabidopsis (AtUXS3, 85%, accession no. NP200737), chickpea (84%, accession no. CAB61752), and pea (84%, accession no. BAB40967). The barley cDNA was named HvUXS1. Analysis of extensive barley EST databases revealed four independent HvUXS consensus sequences. One corresponded to the HvUXS1 cDNA sequence. To clone the other cDNAs, 5'-end PCR primers were designed, based on the EST sequences, and PCR amplifications of barley cDNA from leaf RNA were conducted with these primers paired with the oligo(dT) primer. Three additional cDNAs (HvUXS2, HvUXS3, and HvUXS4) that corresponded to the other EST consensus sequences were obtained. The HvUXS1 cDNA contained an open reading frame of 1,044 bp that encoded a polypeptide of 348 amino acid residues. The HvUXS2, HvUXS3, and HvUXS4 cDNA sequences were 1,380 bp, 1,576 bp, and 1,455 bp in length and encoded polypeptides of 400, 436, and 408 amino acid residues, respectively. It should be noted that the HvUXS2 cDNA is not full-length at its 5'-end and that the encoded amino acid sequence is probably missing about 35 residues at the NH2-terminal end (Fig. 1). The amino acid sequence alignments of the HvUXS enzymes showed sequence identities of more than 65% (Table I). The UXS enzymes have relatively low amino acid sequence identities, normally less than 30%, with other sugar nucleotide interconversion enzymes from barley for which we have cloned cDNAs (Table I).
Expression of the HvUXS1 cDNA in E. coli When the open reading frame of the HvUXS1 cDNA was expressed in E. coli, a soluble protein of 39 kD was purified from the cell extract on nickel-nitrilotriacetic acid agarose (Ni-NTA) resin (Fig. 2A). The molecular size of the polypeptide was as expected from the amino acid sequence deduced from the cDNA. The NH2-terminal amino acid sequence determined directly from the purified, expressed enzyme was MAQKDATNGN (Fig. 1), after excluding the sequence of the poly(His) tag. Both the crude protein extract of E. coli homogenates and the Ni-NTA purified protein were active, as shown both by the release of CO2 and the formation of UDP-D-Xyl from UDP-D-GlcUA. Typical HPLC profiles for the reaction are shown in Figure 2, B to D.
Biochemical Characterization of Barley HvUXS1 Both recombinant HvUXS1 and the ammonium sulfate fraction of native enzyme extracted from barley leaves showed pH optima of 6.5 (data not shown). The recombinant barley HvUXS1 had an apparent Km of 0.12 mM for UDP-D-GlcUA, a kcat of 2.7 s1, and a specific activity of 99 nmol min1 mg protein1. Added divalent cations Mg2+, Ca2+, and Mn2+ had relatively little effect on the activities of native enzyme or the expressed, recombinant HvUXS1 (Table II). Consistent with this result, the addition of 5 mM EDTA into the reaction mixture had no effect on enzyme activity (Table II). Addition of glycerol and dithiothreitol (DTT) slightly increased enzyme activity for the recombinant protein (Table II). UDP-D-Xyl at 0.6 mM strongly inhibited the HvUXS reaction, while UDP-D-Glc and UDP-D-Gal showed only slightly inhibitory effects on HvUXS1 activity (Table II).
Exogenous NAD+ did not dramatically stimulate the reaction rate (Table II). To investigate whether this observation was attributable to the presence of bound NAD+ on the enzyme, the expressed, recombinant HvUXS1 was treated with 80% (v/v) ethanol. The enzymic protein precipitated under these conditions. The 80% ethanol-soluble supernatant contained one major component that eluted at the same position as standard NAD+ (Fig. 3, A and B) and had an absorption spectrum similar to standard NAD+ (Fig. 3B). When this component was treated with Gal dehydrogenase in the presence of Gal, a new peak was generated in the HPLC profile. The new peak was in the same position as standard NADH and had an absorption spectrum similar to standard NADH (Fig. 3C). In addition, the mass spectrum of the 80% ethanol-soluble component corresponded with that for standard NAD+ (Fig. 3D).
Transcript Levels of HvUXS Genes in Different Tissues Transcript levels of HvUXS genes were determined by Q-PCR using gene-specific primers designed from 3'-untranslated sequences and normalized against a series of internal control genes. The expression profiles showed that HvUXS1 mRNA levels were 5- to 500-fold higher than levels of the other HvUXS mRNAs in all tissues examined (Fig. 4, A and B). HvUXS3 mRNA levels were the lowest in all tissues (Fig. 4B).
The Q-PCR comparisons of transcriptional activities of the 4 genes in the various barley tissues examined here showed that HvUXS1 mRNA was relatively abundant in stems and in the maturation zone of roots, compared with leaves, floral tissues, developing grains, and coleoptiles. Although HvUXS2 and HvUXS4 mRNA levels were also high in stems and the maturation zone of roots, they were relatively higher in coleoptiles and early developing grains (Fig. 4B). The HvUXS3 gene was almost undetectable in leaves (Fig. 4B) but expressed with a relatively higher abundance in roots and developing grains (Fig. 4B).
HvUXS1 mRNA levels were at least 5-fold higher than any of the other gene members in all segments of 7-d-old leaves, except in leaf segment C, where HvUXS1 and HvUXS2 mRNA levels were similar (Fig. 5, A and B). Furthermore, HvUXS1 mRNA was most abundant in actively dividing basal segments (segment E) but decreased 3- to 8-fold toward the leaf tip (Fig. 5A). HvUXS2 and HvUXS4 genes were transcribed approximately equally along the leaf (Fig. 5B), while HvUXS3 mRNA levels were extremely low in all of these leaf segments.
When the abaxial epidermal layer was separated from the mesophyll and adaxial epidermal layers of 7-d-old barley leaves, a somewhat different gene expression profile was revealed, compared with patterns obtained from whole leaves or leaf segments. In this case, the HvUXS1 mRNA levels were lower than other HvUXS mRNA levels in the abaxial leaf epidermis where HvUXS2 mRNA levels were the highest (Fig. 6A). In the mesophyll and adaxial layer, HvUXS1 mRNA was again the most abundant (Fig. 6B).
In barley coleoptiles, levels of HvUXS1 mRNA were high at day 1 and day 3 but decreased by about 50% by day 5 (Fig. 7A). The relative abundance of HvUXS2 mRNA increased from about 20% of HvUXS1 levels at days 1 and 3 to be approximately equal with HvUXS1 mRNA levels by day 5 (Fig. 7A).
HvUXS Protein Levels and Enzyme Activity in Young Leaves and Coleoptiles Relative levels of HvUXS protein in young leaves and developing coleoptiles were estimated through western-blot analyses using polyclonal antibodies raised against heterologously expressed HvUXS1. It was assumed that the antibodies would cross-react with all HvUXS isoenzymes, given the high degree of amino acid sequence identity among the HvUXS proteins (Fig. 1; Table I). In the young leaf segments, HvUXS protein levels were high in basal leaves (segment E) where cell division would be high, and gradually decreased from the leaf base toward the tip (segment A; Fig. 5C, insert). Thus, total UXS protein was distributed along the leaves in a pattern that reflected the relative abundance of HvUXS1 mRNA (Fig. 5, A and C). In coleoptiles, HvUXS protein levels increased with time from day 1 to day 5 (Fig. 7A, insert). When HvUXS enzyme activity was measured in the ammonium sulfate fraction of leaf segment extracts, activity was found to be highest in the basal leaf segment E and decreased by 3- to 10-fold in leaf segments D and C (Fig. 5C). Activity in segments A and B was very low. In coleoptiles, enzyme activity was relatively low in day 1 extracts, but increased by about 40% in extracts from 3- and 5-d-old coleoptiles (Fig. 7B).
Neutral sugar compositions of wall preparations from barley leaves and roots were analyzed by gas chromatography-mass spectrometry and correlations between the sugar levels and mRNA abundance were examined. Levels of Xyl plus Ara, which are the major glycosyl constituents of arabinoxylans, vary significantly among the tissues examined (Table III). A comparison of neutral sugar levels in leaf segments shows that the actively dividing basal tissues (leaf segment E) contained more pentoses and fewer hexoses than mature leaf tips (Table III).
The barley HvUXS gene family contains at least four members, and cDNAs corresponding to each of these genes have been cloned and sequenced in this study. Similar small UXS gene families have been reported in other plants (Reiter and Vanzin, 2001
The major difference between the barley HvUXS polypeptides lies in differences at their NH2- and COOH-terminal ends (Fig. 1). In particular, the barley HvUXS2, HvUXS3, and HvUXS4 proteins are extended at their NH2-terminal ends compared with the HvUXS1 sequence and each contain a putative transmembrane domain of 21 to 23 hydrophobic amino acid residues near their NH2-termini (Fig. 1). This suggests that they are membrane-bound enzymes and that they are anchored into the membrane by a single NH2-terminal transmembrane helix. Similar topological features have been detected in UXS enzymes from other plant species, and UXS activity has been found in membrane preparations of mung bean (Feingold et al., 1960
It has been suggested that the UXS enzymes of higher plants share sequence similarity with UDP-D-Glc epimerases and might be evolutionarily related to sugar nucleotide 4,6-dehydratases (Reiter and Vanzin, 2001
The recombinant barley HvUXS1 had an apparent Km of 0.12 mM for UDP-D-GlcUA, which was somewhat lower than the Km values reported for UXSs from Arabidopsis (0.1980.51 mM; Harper and Bar-Peled, 2002
The observation that activity was not greatly affected by the presence of exogenous NAD+ (Table II) was consistent with previous reports for plant UXS enzymes. This suggests that plant UXS enzymes use bound NAD+ for hydride exchange during the decarboxylation reaction and therefore do not require exogenous NAD+ for activity (Ankel and Feingold, 1966
Transcript analyses showed that mRNA encoding the cytosolic HvUXS1 enzyme is by far the most abundant in most of the tissues examined, and HvUXS1 mRNA levels are particularly high in mature roots and stems (Fig. 4). The orthologous Arabidopsis gene, AtUXS3, is also highly expressed in all tissues and also encodes a soluble enzyme (Harper and Bar-Peled, 2002 It is important to emphasize that transcriptional activity of genes, as measured by mRNA abundance, is not always reflected in the levels of enzymic protein. Moreover, levels of enzymic protein in the cell cannot always be assumed to equate to enzyme activity in those cells. Here we have investigated the relationships between HvUXS transcript abundance, the relative amounts of HvUXS proteins, and UXS activity in extracts from young leaves and developing coleoptiles (Figs. 5 and 7). In extracts of segments from young leaves, the abundance of HvUXS1 mRNA, protein recognized by the polyclonal antibodies raised against HvUXS1, and UXS enzyme activity were all highest in the basal segment of the leaves and decreased from the base toward the tip of the leaves (Fig. 5A, compare with Fig. 5C). Thus, in extracts of young leaves, the final enzymic activity accurately reflects the relative amounts of enzymic protein and the HvUXS1 mRNA levels. In contrast, the total amount of HvUXS1 and HvUXS2 mRNA in coleoptiles remains approximately constant in coleoptile extracts from 1 to 5 d (Fig. 7A), while the total amount of HvUXS protein steadily increases during this period (Fig. 7A, insert). The amount of enzyme activity increases between 1 and 3 d but remains about the same at 5 d (Fig. 7B). This suggests that the relative rates of turnover of HvUXS mRNA and HvUXS protein vary in leaves and coleoptiles. It is also possible that the membrane-bound HvUXS2 (Fig. 7A) may contribute to the high protein levels and high enzyme activities in coleoptiles, especially if its turnover rate is low.
As mentioned earlier, UXS catalyzes an irreversible reaction from UDP-D-GlcUA to UDP-D-Xyl, which is subsequently converted to UDP-Ara by UDP-D-Xyl epimerase (Feingold and Avigad, 1980 To further examine the relationship between HvUXS transcript abundance and cell wall composition, several tissues were selected for the isolation and analysis of wall preparations. Selected tissues had relatively low (leaf tip, central leaf segments) or high (leaf base, maturation zone of roots) levels of HvUXS mRNA (Figs. 4 and 5). Walls from the leaf base (segment E) and the maturation zone of roots had significantly higher pentose contents than walls from the leaf tip (Table III). Thus, walls from barley roots contain about 30% more pentoses than mature leaf segments (leaf tip and leaf center; Table III). In contrast, the hexose content (Glc and Gal) is lower in mature roots compared with mature leaf segments. This is consistent with the higher HvUXS transcript abundance in mature roots. The differences in wall composition are not as pronounced between leaf tip and leaf base, despite large apparent differences in HvUXS1 transcript abundance (Table III; compare with Fig. 5). Although the higher levels of HvUXS mRNAs in the selected tissues appear to correspond with higher contents of wall arabinoxylan, there remain technical and theoretical constraints that need to be addressed and it is not possible to conclude unequivocally that the activity of the HvUXS enzymes has a direct effect on carbon flux through the sugar nucleotide interconversion pathways or on cell wall composition. This will be the subject of a more detailed study in the future. It will also be necessary to define the specific functions of the individual HvUXS enzymes, their precise cellular locations, and their potential roles in carbon partitioning among polysaccharides during wall biosynthesis and remodeling.
Materials UDP-D-Xyl is from CarboSource Services, University of Georgia, Athens. UDP-D-Glc, UDP-D-GlcUA, Gal dehydrogenase, NADH, and NAD+ were purchased from Sigma-Aldrich, Sydney; [U-14C]UDP-D-GlcUA and PD-10 desalting column were from Amersham Biosciences (Piscataway, NJ); T4 DNA ligase, the 1-kb DNA ladder molecular mass standards, and the pGEM-T Easy vector system I were from Promega (Madison, WI); and the Superscript II RNase H Reverse Transcriptase and TRIZOL reagent were from Invitrogen Australia (Victoria, Australia).
Barley (Hordeum vulgare) L. cv Sloop grains were sown in vermiculite after soaking with aerated water at 22°C for 24 h. Seedlings were usually grown at 22°C under normal light conditions. However, if coleoptiles were to be harvested, germinated grains were placed in a dark chamber at 22°C. When the first leaves (13 cm in length at day 7 from sowing) were about 75% of their final length, they were sectioned into 5 fragments (segments A to E) according to Burton et al. (2004)
Total RNA was extracted from barley tissues (50100 mg) homogenized in 500 µL TRIZOL (Invitrogen) according to the manufacturer's instructions. Purified RNA was treated with DNase (DNA-Free, Ambion, Austin, TX). The quality and quantity of RNA were assessed in agarose gels (1.6%, w/v) and spectrophotometrically at 280/260 nm, respectively. First strand cDNA was synthesized using 2 µg total RNA and Superscript II reverse transcriptase as described by Frohman et al. (1988)
After searching barley EST databases, which contain about 360,000 entries, with a sequence of the Arabidopsis (Arabidopsis thaliana) AtUXS3 gene (accession no. NP200737), many barley cDNAs were identified. A forward primer (TAAGCCCAATCCCACCACC, based on barley sequence BE421348) was used with an oligo(dT) primer to amplify barley cDNA by PCR, and a near full-length cDNA encoding an HvUXS was obtained. This cDNA was named HvUXS1. When the barley EST databases were searched with the HvUXS1 sequence, 372 entries were detected. Analysis of these sequences with ContigExpress software (Informax, Frederick, MD) showed that the barley UXS gene family contained at least four members. Three oligonucleotide primers (TCGTCGGCATGCTCTTCGCCGC, TCCACCGCGTGATCCCATCGCCCG, and TCCCGCCATGAAGCAGCTCCACA) were derived from EST sequences (accession nos. BF267125, BF261472, and BI957438, respectively) and paired with the oligo(dT) primer to amplify barley cDNAs by PCR. Three additional barley cDNAs were obtained and named HvUXS2, HvUXS3, and HvUXS4. The 5'-ends of HvUXS1 and HvUXS2 sequences were extended by genomic DNA walking, as described by Siebert et al. (1995)
The near full-length HvUXS1 cDNA was expressed using the Gateway protein expression system (Invitrogen) according to the manufacturer's protocol. The near full-length barley HvUXS1 cDNA was amplified by PCR using the primer pair GGGGACAAGTTTGTACAAAAAAGCAGGCTTCGAAGGAGATAGAACCATGGGTCATCACCATCACCATCACCAGATGGCGCAGAAGGACGCCACCAATG/GGGGACCACTTTGTACAAGAAAGCTGGGTCCTATTAGGCCTTGGCCTTCTTGGGCACT. The sequences include gene-specific regions, as underlined, a (His)6 tag in the forward primer, and sequences required for the recombination reaction. The cDNA was inserted into the pDONR201 vector in a recombination reaction catalyzed by BP Clonase, to generate a HvUXS1-pDONR201 construct that was subsequently used to transform XL1Blue competent bacteria. Plasmid DNA was prepared from HvUXS1-pDONR201 transformants by the alkaline lysis method (Sambrook et al., 1989 Polyclonal antibodies against the recombinant HvUXS1 were raised in rabbits at the Institute of Medical and Veterinary Science (Gillies Plain, South Australia).
Barley coleoptiles and leaf tissues (0.2 g) were ground in liquid nitrogen and extracted with 1 mL 200 mM sodium phosphate buffer, pH 6.5. All subsequent procedures were conducted at 4°C. The mixture was centrifuged at 16,000g for 15 min. The supernatant was transferred to a fresh tube and solid ammonium sulfate was added to 50% saturation. The mixture was incubated for 15 min and centrifuged at 16,000g for 15 min. The supernatant was transferred to a fresh tube and solid ammonium sulfate was added to 65% saturation. The mixture was incubated for 15 min and centrifuged at 16,000g for 15 min. The pellet was resuspended in the 200 mM sodium phosphate buffer, pH 6.5, containing 65% saturated ammonium sulfate and centrifuged. The partially purified HvUXS preparation was dissolved in 100 µL 200 mM sodium phosphate buffer, pH 6.5, and activity was assayed immediately.
Proteins (20 µg) prepared from the extracts of barley coleoptiles and leaf tissues were separated by SDS-PAGE on 12% gels according to Laemmli (1970)
The standard reaction assay contained 100 mM sodium phosphate buffer, pH 6.5, 2 mM NAD+, 2 mM DTT, 3% (v/v) glycerol, 0.12 mM UDP-D-GlcUA and recombinant or the ammonium sulfate fraction of the native HvUXS preparation, in a volume of 50 µL, unless otherwise specified. The assay was performed at 25°C for 10 min unless otherwise specified and was stopped by adding 50 µL phenol-chloroform (1:1, v/v). After mixing, the tube was centrifuged at 16,000g for 5 min. The aqueous phase (40 µL) was transferred to a fresh Eppendorf tube and 40 µL chloroform was added. The mixture was vortexed and centrifuged as before. An aliquot of the aqueous phase was analyzed by HPLC (Agilent 1090 LC) using a Hypersil C18 column (250 x 2.1 mm, 5 µm, Agilent, PTH-AA). Nucleotide sugars were eluted using acetonitrile gradients (0.5%3.5% [v/v] from 04 min, 3.5%35% [v/v] from 45 min, and 35% [v/v] thereafter) in 40 mM triethylamine acetate, pH 6.8. Peak areas were integrated with the Chemstation software (Agilent Technologies, Palo Alto, CA). The HPLC assay (Harper and Bar-Peled, 2002
When the inhibitory effects of UDP-D-Xyl on the recombinant enzyme reaction were studied, the enzymic reaction was assayed through CO2 generation, according to John et al. (1977b)
After resin affinity purification, the recombinant UXS1 was desalted on a PD10 column (Amersham Biosciences). An aliquot (0.1 mg) was denatured in 80% ethanol and centrifuged at 16,000g for 15 min. The supernatant was transferred to an Eppendorf tube and dried. The NAD+ was determined by HPLC (Hewlett-Packard 1090) using a Phenomenex Luna C18 column (250 x 2.1 mm, 5 µm, Phenomenex, Sydney). The NAD+ was eluted with acetonitrile gradients (5%25% [v/v] for 05 min, 25%100% [v/v] from 56 min, and 100% [v/v] thereafter) in 40 mM triethylamine acetate buffer, pH 6.8.
Reduction of NAD+ was performed in a reaction mixture containing 50 mM Tris-HCl buffer, pH 8.7, 2 mM Gal, and 0.1 unit Gal dehydrogenase. The mixture was incubated for 1 h at 37°C and its A340 was monitored using a Shimadzu spectrophotometer (Shimadzu, Tokyo). An extinction coefficient of 6,200 M1 cm1 was used for the calculation of NADH concentration. The reaction mixture was also concentrated under vacuum and injected onto the HPLC column for NADH analysis. The amount of UXS1 protein was determined by the Lowry method (Lowry et al., 1951 Mass spectrometric analyses of the 80% ethanol-soluble material prepared from the expressed HvUXS1 protein were performed using an API-300 triple quadrupole mass spectrometer equipped with an electrospray ion source (MDS-Sciex, Concord, Canada). The eluent from the HPLC was split using a T-piece and delivered at 22.5% of the total flow to the mass spectrometer and at 77.5% to a UV detector (HP1100, Agilent) for monitoring wavelengths at 263 and 340 nm. Positive ion mass spectra from m/z 300 to 1,000 were recorded with a step size of 0.2 D and dwell time of 0.5 m s. The electrospray ion source needle, orifice, and ring potentials were set at 5,000 V, 50 V, and 250 V, respectively. The curtain (nitrogen) and nebulizer (air) gases were set at 8 and 12 units, respectively.
Barley leaves and roots were ground in liquid N2 and extracted with 80% ethanol at 75°C. The crude cell wall material was washed 7 times with 80% ethanol, once each with 100% acetone and 100% methanol, and air-dried. Starch was removed by incubating the cell wall material with
Levels of barley HvUXS mRNAs were determined by quantitative Q-PCR in a RG 2000 Rotor-Gene Real Time Thermal Cycler (Corbett Research, Sydney) according to Burton et al. (2004) An optimal temperature for data acquisition for each pair of primers was obtained by performing melting curve analysis after heating PCR products at the end of the amplification from 70°C to 99°C and monitoring fluorescence intensity. For measuring transcript levels in tissue samples, 1 µL 1:10 dilution of a cDNA population was used to prepare a similar PCR reaction mixture as described above, but with addition of 0.6 µL 10x SYBR Green and 2.4 µL water. Quantitative PCR was performed with cycling parameters similar to those described above, but with a modified extension step at optimal acquisition temperature for 15 s. The Rotor-Gene v4.6 software (Corbett Research) was used for data acquisition and manipulation.
For comparisons of mRNA levels in different tissues, a normalization factor was calculated from at least three of five control genes run simultaneously with samples (Vandesompele et al., 2002 Upon request, all novel materials described in this publication will be made available in a timely manner for noncommercial research purposes, subject to the requisite permission from any third-party owners of all or parts of the material. Obtaining any permission will be the responsibility of the requestor. Sequence data from this article have been deposited with the EMBL/GenBank data libraries under accession numbers AY677177, AY677178, AY677179, and AY677176.
We thank Kristen Byford for cell wall sugar determinations, Andrew Harvey for EST database analysis and Q-PCR primer design, and Yoji Hayasaka for mass spectrometric analyses. We also thank Tony Bacic, Rachel Burton, David Gibeaut, Maria Hrmova, and Klaus Oldach for technical support and helpful discussions. Received December 8, 2004; returned for revision January 4, 2005; accepted January 4, 2005.
1 This work was supported by the Grains Research and Development Corporation.
[w] The online version of this article contains Web-only data. Article, publication date, and citation information can be found at www.plantphysiol.org/cgi/doi/10.1104/pp.104.057869. * Corresponding author; e-mail geoff.fincher{at}adelaide.edu.au; fax 61883037102.
Ankel H, Feingold DS (1966) Biosynthesis of uridine diphosphate D-xylose. II. Uridine diphosphate D-glucuronate carboxy-lyase of Cryptococcus laurentii. Biochemistry 5: 182189[CrossRef][Medline] Baker M, Blasco R (1992) Expansion of the mammalian 3 beta-hydroxysteroid dehydrogenase/plant dihydroflavonol reductase superfamily to include a bacterial cholesterol dehydrogenase, a bacterial UDP-galactose-4-epimerase, and open reading frames in vaccinia virus and fish lymphocystis disease virus. FEBS Lett 301: 8993[CrossRef][Web of Science][Medline]
Bar-Peled M, Griffith CL, Doering TL (2001) Functional cloning and characterization of a UDP-glucuronic acid decarboxylase: the pathogenic fungus Cryptococcus neoformans elucidates UDP-xylose synthesis. Proc Natl Acad Sci USA 98: 1200312008 Bellamacina CR (1996) The nicotinamide dinucleotide binding motif: a comparison of nucleotide binding proteins. FASEB J 10: 12571269[Abstract]
Burget EG, Reiter WD (1999) The mur4 mutant of Arabidopsis is partially defective in the de novo synthesis of uridine diphospho L-arabinose. Plant Physiol 121: 383389
Burton BA, Shirley NJ, King BJ, Harvey AJ, Fincher GB (2004) The CesA gene family of barley. Quantitative analysis of transcripts reveals two groups of co-expressed genes. Plant Physiol 134: 224236 Dalessandro G, Northcote DH (1977) Possible control sites of polysaccharide synthesis during cell growth and wall expansion of pea seedlings (Pisum sativum L.). Planta 134: 3944[CrossRef] Feingold DS, Avigad G (1980) Sugar nucleotide transformations in plants. In PK Stumpf, EE Conn, eds, The Biochemistry of Plants: A Comprehensive Treatise, Vol 3. Academic Press, New York, pp 101170
Feingold DS, Neufeld EF, Hassid WZ (1960) The 4-epimerization and decarboxylation of uridine diphosphate D-glucuronic acid by extracts from Phaseolus aureus seedlings. J Biol Chem 235: 910913 Fincher GB (1992) Cell wall metabolism in barley. In PR Shewry, ed, Barley: Genetics, Biochemistry, Molecular Biology and Biotechnology. CAB Publishing, Wallingford, UK, pp 413437 Fincher GB, Stone BA (2004) Chemistry of non-starch polysaccharides from cereal grains. In C Wrigley, H Corke, C Walker, eds, Encyclopedia of Grain Science, Vol 1. Elsevier Academic Press, Kidlington, UK, pp 207223
Frohman MA, Dush MK, Martin GR (1988) Rapid production of full-length cDNAs from rare transcripts: amplification using a single gene-specific oligonucleotide primer. Proc Natl Acad Sci USA 85: 89989002
Gotting C, Kuhn J, Zhan R, Brinkmann T, Kleesiek K (2000) Molecular cloning and expression of human UDP-D-xylose:proteoglycan core protein
Gu X, Bar-Peled M (2004) The biosynthesis of UDP-galacturonic acid in plants. Functional cloning and characterization of Arabidopsis UDP-D-glucuronic acid 4-epimerase. Plant Physiol 136: 42564264
Harper AD, Bar-Peled M (2002) Biosynthesis of UDP-xylose. Cloning and characterization of a novel Arabidopsis gene family, UXS, encoding soluble and putative membrane-bound UDP-glucuronic acid decarboxylase isoforms. Plant Physiol 130: 21882198
Hayashi T, Koyama T, Matsuda K (1988) Formation of UDP-xylose and xyloglucan in soybean Golgi membranes. Plant Physiol 87: 341345
John KV, Schutzbach JS, Ankel H (1977b) Separation and allosteric properties of two forms of UDP-glucuronate carboxy-lyase. J Biol Chem 252: 80138017
John KV, Schwartz NB, Ankel H (1977a) UDP-glucuronate carboxy-lyase in cultured chondrocytes. J Biol Chem 252: 67076710
Kobayashi M, Nakagawa H, Suda I, Miyagawa I, Matoh T (2002) Purification of UDP-D-glucuronate carboxy-lyase (UDP-D-xylose synthase) from pea seedlings. Plant Cell Physiol 43: 12591265
Kokubo A, Kuraishi S, Sakurai N (1989) Culm strength of barley. Plant Physiol 91: 876882 Laemmli UK (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227: 680766[CrossRef][Medline] Liu Y, Thoden JB, Kim J, Berger E, Gulick AM, Ruzicak FJ, Holden HM, Frey PA (1997) Mechanistic roles of tyrosine 149 and serine 124 in UDP-glucose 4-epimerase from Escherichia coli. Biochemistry 36: 1067510684[CrossRef][Medline] Lowry OH, Rosebrough NJ, Farr AL, Randall RJ (1951) Protein measurement with the Folin phenol reagent. J Biol Chem 193: 259262 Reiter WD, Vanzin GF (2001) Molecular genetics of nucleotide sugar interconversion pathways in plants. Plant Mol Biol 47: 95113[CrossRef][Web of Science][Medline] Robertson D, Beech I, Bolwell GP (1995a) Regulation of the enzymes of UDP-sugar metabolism during differentiation of French bean. Phytochemistry 39: 2128[CrossRef] Robertson D, McCormack BA, Bolwell GP (1995b) Cell wall polysaccharide biosynthesis and related metabolism in elicitor stressed cells of French bean (Phaseolus vulgaris L.). Biochem J 306: 745750 Saeman JF, Moore WE, Millet MA (1983) Sugar units present hydrolysis and quantitative paper chromatography. In RL Whistler, ed, Methods in Carbohydrate Chemistry, Vol 3, Chapter 12. Academic Press, New York, pp 5469 Sambrook J, Firtsch EF, Maniatis T (1989) Molecular Cloning. A Laboratory Manual, Ed 2. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, pp 1.211.31
Schutzbach JS, Feingold DS (1970) Biosynthesis of uridine diphosphate D-xylose. IV. Mechanism of action of uridine diphosphoglucuronate carboxy-lyase. J Biol Chem 245: 24762482 Seifert GJ (2004) Nucleotide sugar interconversions and cell wall biosynthesis: how to bring the inside to the outside. Curr Opin Plant Biol 7: 277284[CrossRef][Web of Science][Medline]
Siebert PD, Chenchik A, Kellog DE, Lukyanov KA, Lukyanov SA (1995) An improved PCR method for walking in uncloned genomic DNA. Nucleic Acids Res 23: 10871088 Strasser R, Mucha J, Mach L, Altmann F, Wilson IB, Glossl J, Steinkellner H (2000) Molecular cloning and functional expression of beta-1,2-xylosyltransferase cDNA from Arabidopsis thaliana. FEBS Lett 472: 105108[CrossRef][Web of Science][Medline]
Suzuki K, Suzuki Y, Kitamura S (2003) Cloning and expression of a UDP-glucuronic decarboxylase gene in rice. J Exp Bot 54: 19971999 Vandesompele J, De Preter K, Poppe B, Van Roy N, De Paepe A, Speleman F (2002) Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol 3: 111 Wellmann E, Baron D, Grisebach H (1971) Two different enzymes for the biosynthesis of UDP-xylose from UDP-glucuronic acid in cell suspension culture of parsley (Petroselinum hortense). Biochim Biophys Acta 244: 16[Medline] Wheatley ER, Davies DR, Bolwell GP (2002) Characterisation and immunolocation of an 87 kDa polypeptide associated with UDP-glucuronic acid decarboxylase activity from differentiating tobacco cells (Nicotiana tabacum L.). Phytochemistry 61: 771780[Medline] This article has been cited by other articles:
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ASPB Publications | PLANT PHYSIOLOGY® | THE PLANT CELL | |
|---|---|---|---|