|
|
||||||||
|
First published online April 22, 2005; 10.1104/pp.104.051144 Plant Physiology 138:255-266 (2005) © 2005 American Society of Plant Biologists Ethylene-Regulated Floral Volatile Synthesis in Petunia Corollas1,[w]Department of Environmental Horticulture (B.A.U., K.S., R.J.D., H.M.L., D.G.C.), Department of Horticultural Sciences (D.M.T., A.J.S., H.J.K.), and Department of Food Science and Human Nutrition (C.A.S.), University of Florida, Gainesville, Florida 32611; and Center of Medical, Agricultural, and Veterinary Entomology, United States Department of Agriculture-Agricultural Research Service, Gainesville, Florida 32608 (E.A.S.)
In many flowering plants, such as petunia (Petunia x hybrida), ethylene produced in floral organs after pollination elicits a series of physiological and biochemical events, ultimately leading to senescence of petals and successful fertilization. Here, we demonstrate, using transgenic ethylene insensitive (44568) and Mitchell Diploid petunias, that multiple components of emission of volatile organic compounds (VOCs) are regulated by ethylene. Expression of benzoic acid/salicylic acid carboxyl methyltransferase (PhBSMT1 and 2) mRNA is temporally and spatially down-regulated in floral organs in a manner consistent with current models for postpollination ethylene synthesis in petunia corollas. Emission of methylbenzoate and other VOCs after pollination and exogenous ethylene treatment parallels a reduction in PhBSMT1 and 2 mRNA levels. Under cyclic light conditions (day/night), PhBSMT mRNA levels are rhythmic and precede emission of methylbenzoate by approximately 6 h. When shifted into constant dark or light conditions, PhBSMT mRNA levels and subsequent methylbenzoate emission correspondingly decrease or increase to minimum or maximum levels observed during normal conditions, thus suggesting that light may be a more critical influence on cyclic emission of methylbenzoate than a circadian clock. Transgenic PhBSMT RNAi flowers with reduced PhBSMT mRNA levels show a 75% to 99% decrease in methylbenzoate emission, with minimal changes in other petunia VOCs. These results implicate PhBSMT1 and 2 as genes responsible for synthesis of methylbenzoate in petunia.
Many flowers exhibit a colorful display of petals and emit a complex mixture of floral volatile organic compounds (VOCs) that are together attractive to both pollinators and humans. Regulation of floral volatiles corresponds to pollinator activity times and receptivity of the flower to a pollination event (Dudareva et al., 2000
In many plants, ethylene is synthesized and perceived in a localized, specific, and reproducible manner after pollination, underscoring the importance of understanding the progression of events and role of ethylene during pollination and fertilization. Petunia (Petunia x hybrida) is an excellent model system for studying postpollination responses because ethylene synthesis has been well characterized (Hoekstra and Weges, 1986
Floral fragrance is composed of low Mr VOCs that, together with other floral cues, are thought to stimulate pollinator activity. Floral VOCs are derived from multiple biosynthetic pathways in plant cells and include benzenoids, fatty acid derivatives, isoprenoids, and others (Knudsen et al., 1993
In this study, we investigated the physiological importance of ethylene in the regulation of floral volatile synthesis after pollination in petunia cv Mitchell Diploid (MD) and ethylene-insensitive CaMV35S::etr1-1 (44568). PhBSMT1 and PhBSMT2 expression were examined in detail in individual floral organs after ethylene treatments and pollination. Our results indicated not only that PhBSMT expression and MeBA emission were ethylene regulated in a temporal and spatial manner, but also that there was additional rhythmic regulation that appeared to be controlled by both light and circadian factors. Changes in floral VOC emission after pollination provided strong evidence for ethylene regulation and rhythmic emission of overall floral VOC synthesis. The biochemical function of PhBSMT1 and 2 in vivo was determined using an RNAi approach to complement in vitro enzyme assays (Negre et al., 2003
Floral VOC Emission Is Spatially Regulated
To determine how each part of a flower contributes to the overall aroma of petunia flowers, emission of VOCs was measured from individual floral organs (Fig. 1). Volatiles were collected between the hours of 7 PM and 8 PM at night from whole flowers, flowers with the limb removed, flowers with no corolla, and the gynoecium only. While there were measurable amounts of VOCs emitted from all floral organs tested, VOC production was primarily localized to the corolla and more specifically the petal limb (Fig. 1; Verdonk et al., 2003
Spatial and Temporal PhBSMT1 and PhBSMT2 Regulation in Petunia Flowers
Petunia flowers spatially and temporally produce ethylene in response to pollination in order to coordinate postpollination changes in the individual floral organs (Hoekstra and Weges, 1986
Since ethylene production is spatially and temporally regulated after pollination (Jones et al., 2003
We characterized the production of seven major floral VOCs in response to exogenous ethylene and pollination. Most of the floral VOCs were reduced to almost negligible levels within 10 h of ethylene treatment in MD, but not in 44568 (Fig. 5). After pollination, emission of overall floral VOCs was virtually identical for nonpollinated and pollinated MD and 44568 flowers for the first 24 h (Fig. 6). At 36 h after pollination, emission of most VOCs was significantly reduced in MD-pollinated flowers but not in flowers of any other treatments. This corresponded to a time after the second burst of ethylene was produced in the ovaries and corolla after fertilization. Floral volatiles that decreased in response to both of these treatments included MeBA benzaldehyde, phenylacetaldehyde, benzyl alcohol, 2-phenylethanol, iso-eugenol, and benzyl benzoate. Iso-eugenol and benzyl alcohol were the least affected of all of the volatiles measured. These results show there is a coordinated down-regulation of overall floral volatile emission that is dependent upon ethylene signaling.
Substrate Regulation in Response to Pollination and Ethylene Treatments
While regulation of VOC emission by exogenous ethylene and pollination via mRNA levels may be a key point of regulation in petunia, it is likely that other factors such as substrate availability may also regulate this process. To address the possibility of substrate level regulation of MeBA emission, benzoic acid (BA), salicylic acid (SA), and cinnamic acid (CA) levels were measured in MD and 44568 corollas after pollination (Table I). BA and CA levels increased from 0 h to the 36 h time point in corollas from all treatments except those collected from pollinated MD flowers (Table I), similar to rhythmicity in BA levels observed by Kolosova et al. (2001)
Rhythmic PhBSMT mRNA and MeBA Emission
The pollination time course experiments also indicated that MeBA emission and mRNA expression is rhythmic over time in petunia. This is in agreement with observations of MeBA emission by Kolosova et al. (2001)
Analysis of RNAi PhBSMT Transgenic Petunias
While there are multiple volatiles in petunia flowers whose synthesis is affected after pollination, we chose to focus on MeBA because we had isolated two PhBSMT cDNAs, characterized enzyme activity in vitro (Negre et al., 2003
Since the RNAi PhBSMT petunia plants were lacking the major component of the volatile profile with minimal changes in other floral VOCs (Fig. 10), we tested to see if humans could perceive a difference between the fragrances of flowers from the RNAi PhBSMT (BSMT9-9, T1 plants) and MD control flowers. A human sensory panel was able to discriminate the differences in floral fragrance of the MeBA knockouts from MD fragrance. In this panel, 80% of the participants were able to correctly detect a significant difference between MD fragrance and BSMT9-9 fragrance at a probability of <0.1% (Supplemental Table I). Overall, the participants commented negatively on the floral fragrance of BSMT9-9 flowers, with a general consensus that they had less fragrance than MD flowers.
The petunia floral volatile synthesis profile is complex and regulated at many levels. There are factors that direct tissue specificity, ethylene sensitivity, and rhythmic regulation. Petunia VOCs are emitted primarily from the corolla limb with lower emission from other floral parts. Six of these volatiles exhibited temporal down-regulation after pollination and ethylene treatments. The down-regulation of VOC biosynthesis by ethylene is physiologically meaningful because the timing of regulation corresponds to the second major phase of pollination-induced ethylene production, when ethylene is simultaneously being produced from multiple floral organs as a result of a successful fertilization event. These results demonstrate that ethylene sensitivity regulates total floral fragrance output in addition to controlling petal senescence. Once the flowers are pollinated, they begin making ethylene, which leads to petal senescence and a reduction in fragrance VOC synthesis and emission. This occurs as the flowers transition into a new phase of development from an attractive phase to one of seed production.
Floral VOC emission is spatially regulated in petunia flowers, and the greatest amount of VOCs were collected from the corolla limb. Emission of many VOCs was reduced at least 20-fold when the limb was removed from the flower. Perhaps this is the primary site of emission since there is such a large exposed surface area for VOCs to disperse into the surrounding environment. It appears from these data that the corolla is specialized for VOC synthesis and emission in petunia, making it similar to snapdragon (Kolosova et al., 2001
PhBSMT1 and PhBSMT2 were both down-regulated rapidly in response to exogenous ethylene and pollination in all MD floral organs, but not in ethylene-insensitive 44568 floral organs. Studies in petunia, Phalaenopsis spp., and carnation have shown that ethylene synthesis is temporally and spatially regulated in the flower and coordinates developmental changes such as pollen tube growth, petal senescence, and ovule development (O'Neill et al., 1993 Another layer of regulation of MeBA emission in petunia occurs at the substrate level. Free BA and CA levels decreased in pollinated MD corollas compared with corollas from nonpollinated control flowers (Table I). These data indicate that the decrease in MeBA synthesis after pollination results from both decreased substrate levels and decreased PhBSMT expression. After pollination, these substrates may be used in other processes or remobilized to other organs, resulting in the measurable decrease observed in corollas. There was little difference in BA levels in 44568 after pollination, suggesting that ethylene has a central role in controlling BA levels in the corollas. These results, combined with the observation that ethylene down-regulates emission of most floral VOCs in petunia, suggest that genes encoding enzymes upstream of MeBA or enzymes involved in the biosynthetic pathways of the other floral VOCs may also be down-regulated by ethylene. If this is the case, it will be imperative to determine whether there are common transcription factors influenced by ethylene that recognize common promoter elements in these genes. Levels of SA were relatively low compared with BA and CA and were not influenced to the same degree by pollination or ethylene sensitivity. Since SA is a plant hormone and MeSA is virtually undetectable in petunia flowers, low SA levels would be expected. Additionally, since SA is involved in eliciting cell death and plant defense responses, maintenance of stable SA levels in petals during pollination may assist in promoting ethylene-independent cell death processes or in defensive mechanisms against pathogen infection as the flower senesces around the developing fruit.
The nature of rhythmic MeBA emission was investigated to examine additional relationships between mRNA and MeBA emission and the influence of a possible circadian rhythm on VOC synthesis. Rhythmic emission of floral VOCs has been demonstrated in multiple species including petunia (Verdonk et al., 2003
This study examines many aspects of regulation of floral VOC synthesis in petunia, with particular attention given to MeBA synthesis. These data show that PhBSMT expression and MeBA emission are ethylene regulated, pollination regulated, and rhythmically regulated by light and circadian factors. Down-regulation of MeBA synthesis after pollination is controlled by ethylene through decreased mRNA and substrate levels in the corolla and, as observed by Negre et al. (2003)
Transgenic plants with decreased PhBSMT mRNA levels emit greatly reduced levels of MeBA, thus demonstrating a role for these genes in MeBA synthesis in vivo. These results are consistent with in vitro studies showing that the BSMT enzymes methylate SA and BA substrates (Negre et al., 2003
Plant Material
In all experiments, petunia (Petunia x hybrida) cv MD was used as the wild-type line and is also the genetic background of ethylene-insensitive 35S::etr1-1 line 44568 (Wilkinson et al., 1997
Three cDNA libraries were constructed from petunia MD whole flowers collected at multiple developmental stages (from early bud to anthesis), ethylene-treated flowers (2.5 µL L1 ethylene treatments for 30 min and 1, 3, 6, and 12 h), and pollinated flowers (1, 2, 5, 10, 24, and 34 h after pollination). Total RNA was extracted by a phenol:chloroform extraction method with lithium chloride precipitations as described in Ciardi et al. (2000)
All ethylene treatments and pollinations were initiated the day after anthesis at 10 AM under sunny weather conditions to help reduce developmental, temporal, and environmental variability. For ethylene and control air treatments, flowers were excised and placed into 1.5-mL centrifuge tubes containing 1.0 mL distilled water. Flowers were sealed in 37.85-L glass chambers and treated with 2 to 3 µL L1 ethylene. For air treatments, flowers were placed in the same conditions, but no ethylene was added and potassium permanganate (Fisher Scientific, Hampton, NH) was placed in the chambers. Concentrations of exogenous ethylene were verified at the beginning and end of indicated treatment times using a gas chromatograph (Hewlett-Packard model 5890, Series II; Palo Alto, CA) equipped with a flame ionization detector and an alumina column. For pollinated flower collections, flowers were pollinated and remained on the plant until collection time. For all experiments, all treated (ethylene or pollination) and control (air or nonpollinated) flowers were collected at the following times (with treatment times in parenthesis): 10 AM (0 h), 12 PM (2 h), 8 PM (10 h), 10 AM (24 h), 10 PM (36 h), and 10 AM (48 h) after ethylene treatment or pollination. For constant dark or light circadian studies, tissue was collected from plants placed into continuous darkness (0.06 µmol m2 s1) and plants in continuous light (380 µmol m2 s1) at a temperature of 25°C ± 3°C.
Spatial and temporal mRNA accumulation was analyzed after ethylene treatments and pollination in petunia MD and ethylene-insensitive 44568. Expression was examined from individual floral organs including petal limbs, petal tubes, stigma/styles, and ovaries dissected from ethylene-treated, air-treated, pollinated, and nonpollinated flowers. The day after anthesis, flowers were either collected for ethylene treatments or pollinated on the plant for the time courses described above. At each respective time point, tissue was harvested, dissected, and immediately frozen in liquid nitrogen and stored at 80°C. Total RNA was extracted using an RNeasy Mini Plant RNA extraction kit with on-column DNase digestion performed during the extraction (Qiagen). RNA was quantified by spectrophotometry, and RNA quality was verified by gel electrophoresis. Real-time RT-PCR was performed for quantification of PhBSMT mRNA transcripts from 100 ng of total RNA using TaqMan One-Step RT-PCR reagents (Applied Biosystems, Foster City, CA). Reactions were conducted in 25-µL volumes in 96-well optical reaction plates on a Gene Amp 5700 Sequence Detection System (Applied Biosystems). Primers and TaqMan probes were designed using Primer Express software (Applied Biosystems). Specificity of each of the primer and probe sets was verified by performing PCR reactions with in vitro transcribed PhBSMT1 template with the primer and probe set specific to PhBSMT2 and vice versa. In vitro transcribed RNA was synthesized using a MAXIscript In vitro Transcription kit (Ambion, Austin, TX) according to manufacturer's instructions. PhBSMT1 and PhBSMT2 were used as templates for in vitro transcription and the tritiated transcripts were collected from separate gels to prevent possible contamination. Primer and probe sequences used for individual detection of each gene corresponded to the 3'-untranslated region of the cDNA and are as follows: PhBSMT1 forward primer, AAATGTCATCATCTCCTTGACCAA; PhBSMT1 reverse primer, CGGATCACTACTAAAATATTCGGGTTT; PhBSMT TaqMan probe, 6FAM-AAGGCACTCAATGTCTATTTTCGGTCGA-BHQ1; PhBSMT2 forward primer, TGTACCAATTCTCTATTGTTGTTTTGC; PhBSMT2 reverse primer, CTGAAAGGACCCCTAGTGTACAAGA; PhBSMT2 TaqMan probe, 6FAM-CTTCATAGGTGGTCGAGGTGCTAATTTATCTAGTC-BHQ1. TaqMan Real-time PCR reactions were run under the following conditions: 48°C 30 min, 95°C 10 min, followed by 40 cycles of 95°C 15 s and 60°C 1 min. Reactions were repeated twice with one set of RNAs and once with RNA collected from a duplicate set of tissues. PCR reactions of tritiated in vitro-transcribed PhBSMT1 or PhBSMT2 standards were run in duplicate and in tandem with the sample RNAs to generate a standard curve from which the level of each PhBSMT mRNA in the samples was quantified.
Petunia plants were transformed with and generated from one of two different BSMT RNAi constructs. Transgenic lines BSMT-9 and BSMT-14 were generated from transformations that utilized a pHANNIBAL-derived construct (Wesley et al., 2001
For ethylene treatment volatile collections, flowers were excised and treated with ethylene as described in tissue collection methods. An additional untreated control was included for the ethylene experiments to control for flower excision, induced variability in air, and ethylene treatments. For this control, flowers at the same developmental stages were collected fresh from the plants to compare with air-treated control flowers. For pollinated flower samples, flowers were pollinated on the plant and not excised until the time of volatile collection. Flowers used for spatial volatile analysis were collected from freshly opened flowers in the evening between 8 and 9 PM. Flowers and floral organs were weighed prior to volatile collection. Three flowers were collected per treatment and each time point/treatment was repeated three times. Flowers from the BSMT RNAi screen were collected three times with 3 to 5 flowers/collection at 8 PM for the initial screen and once more with putative positive lines at 12 AM to verify that reduced MeBA emission was reduced when MeBA emission is maximal in MD (Kolosova et al., 2001
BA and SA were extracted and quantified by gas chromatography-mass spectrometry (Schmelz et al., 2003
Human sensory panels were used to determine if differences in fragrance of the reduced MeBA flowers and MD wild-type flowers could be discriminated by human olfaction. The flower samples were prepared from freshly excised flowers at anthesis from MD and knockout line BSMT-9. Excised flowers were placed immediately into 5-mL water agarose blocks, then placed into 210-mL glass jars and sealed with lids for approximately 120 min before testing. A triangle test (Lawless and Heymann, 1998 Sequence data from this article have been deposited with the EMBL/GenBank data libraries under accession numbers AAO45012 and AAO45013. Received August 4, 2004; returned for revision February 1, 2005; accepted February 1, 2005.
1 This work was supported by the Fred Gloeckner Foundation (grant to D.G.C.), by the American Floral Endowment (grant to D.G.C.), by the U.S. Department of Agriculture Floral and Nursery Crops Initiative (grant to D.G.C.), by the Florida Agricultural Experiment Station, National Science Foundation (grant no. DBI0211875 to H.J.K.), and by the University of Florida (alumni fellowship to B.A.U.). This paper is contribution R-10643 from the Florida Agricultural Experiment Station.
2 Present address: The Institute for Genomic Research, 9712 Medical Center Drive, Rockville, MD 20850.
[w] The online version of this article contains Web-only data. Article, publication date, and citation information can be found at www.plantphysiol.org/cgi/doi/10.1104/pp.104.051144. * Corresponding author; e-mail geranium{at}ufl.edu; fax 3523923870.
Atkinson DE (1977) Functional stoichiometric coupling and metabolic prices. In Cellular Energy Metabolism and Its Regulation. Academic Press, New York, pp 3183
Boatright J, Negre F, Chen X, Kish CM, Wood B, Peel G, Orlova I, Gang D, Rhodes D, Dudareva N (2004) Understanding in vivo benzenoid metabolism in petunia petal tissue. Plant Physiol 135: 19932011
Bui AQ, O'Neill SD (1998) Three 1-aminocyclopropane-1-carboxylate synthase genes regulated by primary and secondary pollination signals in orchid flowers. Plant Physiol 116: 419428 Burquez A, Corbet SA (1991) Do flowers resorb nectar? Funct Ecol 5: 369379 Chen F, D'Auria JC, Tholl D, Ross JR, Gershenzon J, Noel JP, Pichersky E (2003) An Arabidopsis thaliana gene for methylsalicylate biosynthesis, identified by a biochemical genomics approach, as a role in defense. Plant J 36: 577588[CrossRef][Web of Science][Medline]
Ciardi J, Tieman DM, Lund SD, Jones JB, Stall RE, Klee HJ (2000) Response to Xanthomonas campestris pv. vesicatoria in tomato involves regulation of ethylene receptor gene expression. Plant Physiol 123: 8192
Clark DG, Gubrium EK, Klee HJ, Barrett JE, Nell TA (1999) Root formation in ethylene insensitive plants. Plant Physiol 121: 5359 Dexter RJ, Shibuya K, Loucas HM, Clark DG, Underwood BA, Tieman DM, Klee HJ (2004) The isolation of BEBT from Petunia hybrida: a flower specific gene involved in floral volatile synthesis (abstract no. 273). In Plant Biology 2004, American Society of Plant Biologists, July 2428, 2004, Lake Buena Vista, FL
Dudareva N, Murfitt LM, Mann CJ, Gorenstein N, Kolosova N, Kish CM, Bonham C, Wood K (2000) Developmental regulation of methyl benzoate biosynthesis and emission in snapdragon flowers. Plant Cell 12: 949961
Gubrium EK, Clevenger DJ, Clark DG, Barrett JE, Nell TA (2000) Reproduction and horticultural performance of transgenic ethylene-insensitive petunias. J Am Soc Hortic Sci 125: 277281 Helsper JPFG, Davies JA, Bouwmeester HJ, Krol AF, van Kampen MH (1998) Circadian rhythmicity in emission of volatile compounds by flowers of Rosa hybrida L. cv. Honesty. Planta 207: 8895[CrossRef][Web of Science]
Hoekstra FA, Weges R (1986) Lack of control by early pistillate ethylene on the accelerated wilting of Petunia hybrida flowers. Plant Physiol 80: 403408 Holden MJ, Marty JA, Singh-Cundy A (2003) Pollination-induced ethylene promotes the early phase of pollen tube growth in Petunia inflata. J Plant Physiol 160: 261269[Medline] Jones MB, Mansfield TA (1975) Circadian rhythms in plants. Sci Prog Oxf 62: 103125 Jones ML, Langston BJ, Johnson F (2003) Pollination-induced senescence of ethylene sensitive and insensitive petunias. In M Vendrell, F Romojaro, eds, Biology and Biotechnology of the Plant Hormone Ethylene III. Kluwer Academic Publishers, Dordrecht, The Netherlands
Jones ML, Woodson WR (1999) Interorgan signaling following pollination in carnations. J Am Soc Hortic Sci 124: 598604 Jorgensen RA, Cluster PD, English J, Oue O, Napoli CA (1996) Chalcone synthase cosuppression phenotypes in petunia flowers: comparison of sense vs antisense constructs and single-copy vs complex T-DNA sequences. Plant Mol Biol 31: 957973[CrossRef][Web of Science][Medline] Knudsen JT, Tollsten L, Bergstrom LG (1993) Review article number 76: Floral scents: a checklist of volatile compounds isolated by head-space techniques. Phytochemistry 33: 253280[CrossRef][Web of Science]
Kolosova N, Gorenstein N, Kish CM, Dudareva N (2001) Regulation of circadian methyl benzoate emission in diurnally and nocturnally emitting plants. Plant Cell 13: 23332347 Lawless HT, Heymann H (1998) Sensory Evaluation of Food. Chapman and Hall Publishers, New York
Negre F, Kish CM, Boatright J, Underwood BA, Shibuya K, Wagner C, Clark DG, Dudareva N (2003) Regulation of methylbenzoate emission after pollination in snapdragon and petunia flowers. Plant Cell 15: 29923006 O'Neill SD (1997) Pollination regulation of flower development. Annu Rev Plant Physiol Plant Mol Biol 48: 547574[CrossRef][Web of Science] O'Neill SD, Nadeau JA, Zhang XS, Bui AQ, Halevy AH (1993) Interorgan regulation of ethylene biosynthetic genes by pollination. Plant Cell 5: 419432[Abstract] Pott MB, Pichersky E, Piechulla B (2002) Transcriptional and post-translational regulation of S-adenosyl-L-methionine: salicylic acid carboxyl methyltransferase (SAMT) during Stephanotis floribunda flower development. J Plant Physiol 159: 925934 Schiestl FP, Ayasse M (2001) Post-pollination emission of a repellent compound in a sexually deceptive orchid: a new mechanism for maximising reproductive success? Oecologia 126: 531534[CrossRef] Schmelz EA, Alborn HT, Tumlinson JH (2001) The influence of intact-plant and excised-leaf bioassay designs on volicitin- and jasmonic acid-induced sesquiterpene volatile release in Zea mays. Planta 214: 171179[Web of Science][Medline] Schmelz EA, Engelberth J, Alborn HT, O'Donnell P, Sammons M, Toshima H, Tumlinson JH (2003) Simultaneous analysis of phytohormones, phytotoxins, and volatile organic compounds in plants. Proc Natl Acad Sci USA 100: 1052210557 Schmelz EA, Engelberth J, Tumlinson JH, Block A, Alborn HT (2004) The use of vapor phase extraction in metabolic profiling of phytohormones and other metabolites. Plant J 39: 790808[CrossRef][Web of Science][Medline]
Shibuya K, Barry KG, Ciardi JA, Loucas HM, Underwood BA, Nourizadeh S, Ecker JR, Klee HJ, Clark DG (2004) The central role of PhEIN2 in ethylene responses throughout plant development in petunia. Plant Physiol 136: 29002912
Simkin AJ, Underwood BA, Auldridge M, Loucas HM, Shibuya E, Schmelz E, Clark DG, Klee HJ (2004) Circadian regulation of the PhCCD1 carotenoid dioxygenase controls emission of Tang XY, Woodson WR (1996) Temporal and spatial expression of 1-aminocyclopropane-1-carboxylate oxidase mRNA following pollination of immature and mature petunia flowers. Plant Physiol 112: 503511[Abstract] Tollsten L (1993) A multivariate approach to post-pollination changes in the floral scent of Platanthera bifolia (Orchidaceae). Nord J Bot 13: 495499 Underwood BA (2003) Effects of ethylene on floral fragrance in Petunia x hybrida Mitchell Diploid. PhD dissertation. University of Florida, Gainesville, FL van Doorn WG (1997) Effects of pollination on floral attraction and longevity. J Exp Bot 48: 16151622 Verdonk JC, de Vos CHR, Verhoeven HA, Haring MA, van Tunen AJ, Schuurink RC (2003) Regulation of floral scent production in petunia revealed by targeted metabolomics. Phytochemistry 62: 9971008[CrossRef][Web of Science][Medline] Wesley SV, Helliwell CA, Smith NA, Wang MB, Rouse DT, Liu Q, Gooding PS, Singh SP, Abbott D, Stoutjesdijk PA, et al (2001) Construct design for efficient, effective and high-throughput gene silencing in plants. Plant J 27: 581590[CrossRef][Web of Science][Medline] Wilkinson JQ, Lanahan MB, Clark DG, Bleecker AB, Chang C, Meyerowitz EM, Klee HJ (1997) A dominant mutant receptor from Arabidopsis confers ethylene insensitivity in heterologous plants. Nat Biotechnol 15: 444447[CrossRef][Web of Science][Medline] This article has been cited by other articles:
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ASPB Publications | PLANT PHYSIOLOGY® | THE PLANT CELL | |
|---|---|---|---|