| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
|
First published online May 20, 2005; 10.1104/pp.104.057406 Plant Physiology 138:1046-1057 (2005) © 2005 American Society of Plant Biologists Tripeptidyl Peptidase II. An Oligomeric Protease Complex from Arabidopsis1Department of Genetics (A.J.B., P.Y., R.D.V.) and Department of Chemistry (M.S., L.M.S.), University of Wisconsin, Madison, Wisconsin 53706
The breakdown of most nuclear and cytoplasmic proteins involves their partial cleavage by the 26S proteasome followed by further disassembly to free amino acids by the combined action of endo- and exopeptidases. In animals, one important intermediate exopeptidase is tripeptidyl peptidase (TPP)II, which digests peptide products of the 26S proteasome and other endopeptidases into tripeptides. Here, we describe the purification and characterization of TPPII from Arabidopsis (Arabidopsis thaliana). Like its animal counterparts, Arabidopsis TPPII exists as a soluble, approximately 5- to 9-MD complex. Two related species of 153 and 142 kD are present in the purified preparations that are derived from a single TPP2 gene. Sequencing by Edman degradation of the intact polypeptides and mass spectrometry of proteolytic fragments demonstrated that the 142-kD form mainly differs from the 153-kD form by a truncation at the C-terminal end. This serine protease is a member of the subtilisin superfamily and is sensitive to the inhibitors alanine-alanine-phenylalanine-chloromethylketone and butabindide, which are diagnostic for the TPPII subfamily. The Arabidopsis TPP2 gene is widely expressed in many tissue types with related genes evident in other plant genomes. Whereas the 26S proteasome is essential, TPPII appears not as important for plant physiology. An Arabidopsis T-DNA mutant defective in TPP2 expression displays no phenotypic abnormalities and is not hypersensitive to either amino acid analogs or the 26S proteasome inhibitor MG132. As a consequence, plants likely contain other intermediate exopeptidases that assist in amino acid recycling.
Proteolysis serves a variety of essential functions, including the elimination of misfolded or damaged proteins, the precise removal of regulatory proteins, and the maintenance of free amino acid pools needed for continual protein synthesis (Vierstra, 1996  ; Tomkinson, 1999). To facilitate this breakdown, plants and animals have evolved several proteolytic mechanisms for each subcellular compartment. In the vacuole/lysosome, proteins are catabolized by a variety of proteases and peptidases following their delivery to this hydrolytic compartment via endocytic and autophagic mechanisms (Thompson and Vierstra, 2005). For nuclear and cytoplasmic proteins, as well as abnormal polypeptides transported in a retrograde fashion from the endoplasmic reticulum to the cytoplasm, a major route involves ubiquitin (Ub) and the 26S proteasome (Smalle and Vierstra, 2004). Here, proteins destined for degradation are selectively tagged by the covalent attachment of multiple Ubs. These ubiquitinated proteins are then recognized and cleaved into smaller fragments by the 26S proteasome, a self-compartmentalized ATP-dependent protease complex with broad substrate and cleavage specificity.
Products of the 26S proteasome are predominantly peptides 6 to 12 amino acids in length (Wenzel et al., 1994
In animals, tripeptidyl peptidase (TPP)II is an intermediate exopeptidase thought to be necessary for efficient protein turnover (EC 3.4.14.10; Tomkinson, 1999 Even though genes encoding exopeptidases like TPPII are evident in various plant genomes, none of the encoded proteins have been characterized. Here, we describe the purification and biochemical characterization of TPPII from Arabidopsis (Arabidopsis thaliana). The purified protein behaves as a Ser protease and, like its animal counterparts, assembles into a large oligomeric complex. This complex contains two proteins of 153 and 142 kD that are derived from a single TPP2 gene, with the smaller version missing part of the C-terminal end. A T-DNA disruption mutant of the TPP2 locus is phenotypically indistinguishable from the wild type, indicating that this exopeptidase is not essential and suggesting that it works in concert with other endo/exopeptidases in plants to complete the digestion of large peptides to free amino acids.
Purification of TPPII from Arabidopsis
During our previous attempts to purify the 26S proteasome from Arabidopsis seedlings (Yang et al., 2004
Given the potential connection of TPPII with the Ub/26S proteasome pathway in other eukaryotes (Glas et al., 1998
Purification of the TPPII to near homogeneity was achieved by differential polyethylene glycol (PEG) 8000 precipitation and sequential FPLC using a UnoQ anion-exchange column and a Superose HR6 size exclusion column (Fig. 1). While little purification was achieved by the PEG precipitation steps, they did remove most of the contaminating activity toward the AAF-AMC substrate (butabindide resistant; Table I). Subsequent MALDI-TOF analysis of tryptic and Glu-C peptides confirmed that the 153- and 142-kD forms were TPPII (see below). A minor contaminant of approximately 45 kD was also detected in the final preparations that eluted from the HR6 column as a 3-MD complex (Fig. 1, B and C). MALDI-TOF-MS fingerprinting of this polypeptide identified it as a chloroplast precursor chaperonin orthologous in sequence to human and yeast (Saccharomyces cerevisiae) heat shock protein-60 (At3g13470). The 20S CP of the 26S proteasome was also detected after HR6 FPLC, but eluted as a much smaller particle than TPPII (Fig. 1, B and C). We typically obtained a 500-fold purification of TPPII with an approximately 5% overall yield (based on the butabindide-inhibitable peptidase activity; Table I). Approximately 50 µg of TPPII were isolated from 200 g fresh weight of green seedlings. The Km of 0.11 mM and the Vmax of 4.8 nmol/min were determined for the AAF-AMC substrate; the former value is close to those determined for the rat and human orthologs (Balow et al., 1986
The 153- and 142-kD TPPII species eluted from the size exclusion column as oligomers of 5 to 9 MD, indicating that Arabidopsis TPPII, like its animal counterparts (Geier et al., 1999 ; Rockel et al., 2002), assembles into higher order complexes (Fig. 1, B and C). The higher mass complexes appeared to have more peptidase activity, suggesting that the individual subunits are more active when assembled. A similarly large complex could be seen by native PAGE as detected by both protein and activity staining (Fig. 2). Prolonged electrophoresis also revealed a uniform laddering of discrete subpopulations with smaller native sizes that retained peptidase activity. Although the precise masses of these species were not determined, they appeared to differ by much more than the mass of a single 153- or 142-kD polypeptide, suggesting that this laddering was caused by the loss of discrete segments containing multiples of these polypeptides. Native PAGE coupled with SDS-PAGE of the complex showed that both the 153- and 142-kD polypeptides had a coincident electrophoresis pattern during native PAGE (Fig. 2). A similar coincident elution was evident by size exclusion chromatography (Fig. 1, B and C). Consequently, it appears that both polypeptides were present together at a constant ratio within the purified TPPII superstructure.
Sequence Analysis of the Arabidopsis TPP2 Gene
Alignment of the Arabidopsis TPP2 genomic sequence with those of several cDNAs present in the expressed sequence tag (EST) database allowed us to assemble the complete open reading frame encoding this protease. The predicted initial transcript of 4,143 bp encodes a 1,380-amino acid protein with a calculated mass of 154 kD, which is close to the apparent molecular mass of the larger 153-kD species as determined by SDS-PAGE. Overall, Arabidopsis TPPII is 36%/53% and 32%/51% identical/similar to its human and Schizosaccharomyces pombe orthologs, respectively. Alignment of the Arabidopsis TPPII with related sequences from yeast, Caenorhabditis elegans, and humans confirmed its inclusion within the subtilisin superfamily (Fig. 3). Like other subtilisin-type Ser proteases, Arabidopsis TPPII has the positionally conserved Asp, His, and Ser residues (positions 147, 372, and 558, respectively) that form the catalytic triad as well as the Asn (residue 469) that stabilizes the tetrahedral intermediate (Hilbi et al., 2002
The larger predicted size of Arabidopsis TPPII relative to its animal orthologs is mainly due to a long N-terminal extension of 102 amino acids (Fig. 3). Although both the C. elegans and S. pombe versions are predicted to have N-terminal extensions, these extensions are shorter than that for Arabidopsis TPPII and appear unrelated in sequence. Reverse transcription (RT)-PCR analysis confirmed that the nucleotide sequence for this extension is present in the Arabidopsis TPP2 transcript (data not shown). Whether this entire sequence is translated is unclear because a second Met codon can be found at codon 69. The full extension is notably enriched in Ser and Gly residues and displays some homology with Arabidopsis transit peptides that direct the transport of proteins into chloroplasts (Psort software; http://psort.nibb.ac.jp). We consider this predicted localization to be unlikely based on data with its mammalian and yeast counterparts showing that TPPII is a cytosolic protein (Rose et al., 1996 ; Geier et al., 1999). Searches of the near-complete Arabidopsis genomic sequence with TPP2 failed to find related loci. We also failed to detect variant cDNAs among the 28 ESTs present in the Arabidopsis database (http://www.arabidopsis.org) that would imply alternate splicing of the TPP2 transcript. Related genes were evident in rice (Oryza sativa [AK067099]) and maize (Zea mays [AY105477]), suggesting that TPPII-like activities are present in all plants. Analysis of the Arabidopsis EST and massively parallel signature sequences (http://mpss.udel.edu/at) databases indicated that TPP2 is widely expressed in most tissues (data not shown). TPP2 mRNA levels were highest in callus as compared to differentiated tissues such as leaves, roots, and siliques.
Sensitivity of Arabidopsis TPPII to various protease inhibitors confirmed the expectation, based on sequence comparisons, that it is a member of the TPPII subfamily of subtilisin-type proteases (Fig. 4A). Whereas the Ser protease inhibitor PMSF attenuated its activity, the Cys (E64c, leupeptin) and metalloprotease inhibitors (EDTA) were without an effect. Mammalian and Drosophila TPPIIs are sensitive to thiol-reactive compounds, mainly through their reaction with a positionally conserved Cys (residue 760 in Drosophila TPPII; Renn et al., 1998
Like TPPII preparations from animals, the Arabidopsis peptidase was effectively quenched by the inhibitors AAF-chloromethylketone (CMK) and butabindide (Fig. 4, A and B), thus placing the enzyme in the TPPII clade of the subtilisin superfamily (Siezen and Leunissen, 1997 ; Renn et al., 1998). Butabindide was specifically designed as a competitive inhibitor of TPPII, using the rat peptidase for the assay (Rose et al., 1996). The concentration needed for 50% inhibition of initial activity for butabindide and AAF-CMK (using 100 µM AAF-AMC) was approximately 5 µM, with 100 µM of each effectively inhibiting >97% of the peptidase activity of TPPII (Fig. 4B). For butabindide, assays with a range of substrate concentrations provided a Ki of 0.21 µM (Fig. 4B), which is close to the value determined for Drosophila TPPII (Renn et al., 1998). Of the AAF-AMC degrading activity in crude seedling extracts, only 19% was inhibited by butabindide (Table I), suggesting that peptidases other than TPPII can also break down this substrate in crude plant extracts and likely in vivo. Possible candidates include TPPI, a structurally distinct but functionally related tripeptidase that may be located in the vacuole (Tomkinson, 1999), and various aminopeptidases working in concert.
In the absence of either additional Arabidopsis TPP2 genes or evidence for alternative splicing of a single TPP2 transcript, synthesis of the 142-kD form of TPPII could occur by either differential translation of the TPP2 mRNA, processing of the initial translation product, and/or by posthomogenization proteolysis of the 153-kD species. Calculations of apparent molecular masses suggested that the two forms differ by approximately 100 amino acids. To help determine which regions in the 153-kD species account for this difference, we subjected both species to thorough sequencing by MS. The 153- and 142-kD polypeptides were separated by SDS-PAGE, individually excised from the gels, and digested with either trypsin or Glu-C. The resulting peptides were then subjected to online liquid chromatography followed by electron spray ionization (ESI) ion trap tandem MS (MS/MS) analysis. As can be seen in Table II and Figure 3, this sequencing identified a large array of peptides from both the 142- and 153-kD forms (56% coverage for the 153-kD species). All these peptides could be located in the derived amino acid sequence from the TPP2 gene, indicating that no genes other than TPP2 were responsible for their synthesis. Both sets of peptides showed similar coverage at the N-terminal end of the TPPII protein, with each set failing to contain fragments upstream of Lys-107. Several peptides corresponding to the C-terminal end could be found for the 153-kD species, including a pentapeptide that covered the predicted C-terminal Phe residue. However, for the 142-kD species, the most C-terminal peptide we identified ended at Lys-1297, with no coverage for the last 84 residues (Table II; Fig. 3).
MS analyses implied that the difference between the 153- and 142-kD species was generated by loss of the
To help assess the phenotypic functions of TPPII in planta, we analyzed an Arabidopsis mutant in the Columbia (Col-0) ecotype background that harbored a T-DNA disruption (SALK_085776) of the corresponding gene. The TPP2 gene encompasses 8,988 bp and contains 34 exons and 33 introns (Fig. 5A). Sequence analysis of the tpp2-1 locus indicated that the T-DNA inserted within the fifth exon upstream of nucleotide 248 (Fig. 5A). Kanamycin resistance associated with the T-DNA segregated in a 3:1 pattern, indicating that the T-DNA inserted at a single site. Both the right- and left-border T-DNA primers, in combination with gene-specific primers, amplified the upstream and downstream regions of TPP2, respectively. Sequence analysis of these products showed that insertion of the T-DNA did not induce any secondary effects on the TPP2 locus. RT-PCR analysis of total RNA isolated from wild-type and homozygous tpp2-1 seedlings demonstrated that the mutation altered expression of the TPP2 gene. Whereas we could detect the expected TPP2 PCR product from wild-type RNA using primers upstream of the T-DNA (primers 2 and 3), no products were evident from the tpp2-1 RNA (Fig. 5B). When primers downstream of the T-DNA were used (primers 4 and 5 or 6 and 7), we could reproducibly detect a low amount of the expected PCR products from the tpp2-1 RNA, indicating that the region downstream of the T-DNA was transcribed, albeit at low levels (Fig. 5B). Since this shorter transcript would lack the codon for the essential Asp (residue 152) of the catalytic triad, the resulting truncated protein would be enzymatically inactive even if translated (Figs. 3 and 5). Consequently, we predict that this mutant represents a null allele.
Phenotypic analysis of tpp2-1 seedlings indicated that the corresponding protein is not essential in Arabidopsis. Homozygous mutant seeds germinated normally and the plants developed, flowered, and set seeds indistinguishable to wild type under standard growth conditions (data not shown; Fig. 5C). It has been shown that mammalian TPPII can partially substitute for the 26S proteasome when the activity of the latter is blocked by the 26S proteasome inhibitors such as MG132 (Glas et al., 1998 ; Geier et al., 1999; Princiotta et al., 2001). To test for a similar connection in plants, we examined the effects of several inhibitors of the 26S proteasome and TPPII using root growth as the assay. Predicting that Arabidopsis tpp2-1 seedlings might then be hypersensitive to MG132, we examined their growth response to a range of MG132 concentrations. However, as can be seen in Figure 5C, both wild-type and tpp2-1 seedlings were similarly sensitive. Numerous Ub/26S proteasome pathway mutants are hypersensitive to amino acid analogs, presumably because they cannot efficiently remove the resulting abnormal proteins that incorporate these analogs (e.g. Girod et al., 1999; Yan et al., 2000). When tpp2-1 plants were tested similarly, no hypersensitivity was seen for canavanine or p-fluorophenylalanine (pFP), analogs of Arg and Phe, respectively (Fig. 5C). The specific inhibitor of animal TPPII, butabindide, was shown to hyperactivate at least one neuropeptide hormone response in mice, presumably via its ability to prevent TPPII from degrading the peptide (Rose et al., 1996). To test whether butabindide might have a pharmacological effect on Arabidopsis, we exposed roots to a range of butabindide concentrations. Even at a butabindide concentration approximately 400 times that of the Ki for TPPII in vitro (80 µM), no detectable effect on growth was observed (Fig. 5C). In a similar fashion, both wild-type and tpp2-1 seedlings were insensitive to another TPP-type peptidase inhibitor, AAF-CMK (data not shown).
Attenuation of 26S proteasome activity in Arabidopsis by mutation of specific subunits leads to a coordinated transcriptional up-regulation of most, if not all, genes encoding components of the complex, indicating that plants like yeast contain a feedback loop to adjust 26S proteasome levels to meet demand (Smalle et al., 2003
Recycling of amino acids appears to require the coordinated action of endopeptidases, like the 26S proteasome, which selects targets and makes the initial cleavages, followed by intermediate endo/exopeptidases that further process the oligopeptides into di- and tripeptides, and finally various carboxy- and aminopeptidases that digest the short peptides into free amino acids (Tomkinson, 1999 ). Among other possible functions, TPPII has been proposed to be a key intermediate exopeptidase responsible for the generation of tripeptides from longer peptides. Several previous studies have characterized Drosophila and mammalian TPPII at the biochemical and structural levels. Here we report the purification and preliminary genetic characterization of the Arabidopsis version. Like its counterparts from other species, Arabidopsis TPPII is a Ser protease with sequence similarity to subtilisin-type peptidases. Although we have not confirmed that TPPII is a tripeptidyl peptidase, the fact that it digests AAF-AMC, a peptide substrate preferred by TPPII orthologs from other eukaryotes, and that it is effectively blocked by micromolar concentrations of AAF-CMK and butabindide, both specific inhibitors of TPPII-type activities, strongly support this mechanism of action. Preliminary genomic analyses suggest a wide distribution of TPPII in both monocotyledonous and dicotyledonous plants. Although the TPP2 gene has not yet been identified in soybeans, a >1-MD protease with related enzymatic properties has been described (Shimotsuura et al., 1992).
Purified Arabidopsis TPPII consists of two related polypeptides of 153 and 142 kD, which are derived from a single TPP2 gene. Both polypeptides are processed from a larger precursor by cleavage at the N-terminal end. MS fingerprinting demonstrated that the interior sequence of the two proteins appears to be contiguous. However, we could not identify peptides beyond Lys-1297 in the 142-kD species, implying that it is missing as much as 10 kD from the C-terminal end. Why the C-terminal end is absent from the 142-kD species remains unclear. Among the numerous ESTs from the TPP2 gene, there is no evidence for alternative transcripts, thus precluding differential RNA processing as the mechanism. Another possible scenario is that proteolytic processing of the 153-kD polypeptide, either in vivo or in vitro, generates the 142-kD species. It is notable that the purified TPPII complex from both Drosophila and mouse lymphoma cells also contains two species, the larger of which is typically more abundant (Renn et al., 1998
A striking feature of animal TPPIIs is their ability to assemble into a large oligomeric complex of approximately 5 to 9 MD, with EM pictures of the mammalian and Drosophila particles showing that it resembles a twisted double-strand ribbon (Geier et al., 1999
The EM pictures of TPPIIs also show that the strands are composed of discrete segments that may represent individual or multimers of the TPPII polypeptide (Geier et al., 1999
Even though TPPII has been proposed to participate in numerous processes, final confirmation awaits genetic analyses. A role for TPPII in antigen presentation by human cells was inferred by the ability of AAF-CMK to block the production of antigenic peptides (Seifert et al., 2003
The observations that TPPII is up-regulated in mammalian cells adapted to high concentrations of 26S proteasome inhibitors have been used to suggest that TPPII and the 26S proteasome work cooperatively in degrading proteins to amino acids (Glas et al., 1998 While the 26S proteasome is clearly a key protease in the removal of abnormal polypeptides and the breakdown of important regulatory proteins, the entire process of amino acid recycling likely requires a host of additional endo/exopeptidases to complete the task. Our discovery of Arabidopsis TPPII hopefully identifies one such additional component important to this process in plants. While the functions of TPPII remain unclear, the coupling of the tpp2 mutant with those in other amino acid recycling systems (e.g. Ub/26S proteasome and autophagy) may eventually reveal its roles in plant biology.
TPPII Purification
TPPII was purified from Arabidopsis (Arabidopsis thaliana) ecotype Col-0 seedlings using a protocol similar to that for the 26S proteasome (Yang et al., 2004 The extract was filtered through 4 layers of cheesecloth and 2 layers of Miracloth and clarified at 30,000g for 15 min. The supernatant was made 2% (w/v) PEG 8000 (Sigma, St. Louis), stirred for 30 min, and reclarified at 30,000g for 30 min. The supernatant was made 8% (w/v) PEG 8000 and stirred for 30 min, and the TPPII-containing precipitate was collected by centrifugation at 12,000g for 15 min. The pellet was resuspended in extraction buffer, clarified, and fractionated by FPLC on a 6-mL UnoQ6 (Bio-Rad, Richmond, CA) anion-exchange column using a 120-mL 0 to 1 M KCl gradient in extraction buffer. Fractions (3 mL) containing TPPII activity (as determined by peptidase assay) eluted between 220 and 280 mM KCl; these fractions were pooled and reprecipitated with 10% (w/v) PEG 8000. The pellet was resuspended in the extraction buffer containing 20% glycerol and further resolved by size exclusion FPLC using a 24-mL Superose HR6 10/30 column (Pharmacia, Piscataway, NJ) with a flow rate of 0.1 mL/min. Peak fractions (0.5 mL) of TPPII activity were pooled and stored at –80°C.
Fractions were incubated for various times at 37°C with 0.01 to 1 mM AAF-AMC in 15 mM Tris, pH 7.0, and 5 mM MgCl2 (Balow et al., 1986
The in-gel tryptic or Glu-C digestion of TPPII followed the protocol as described (http://biotech.wisc.edu/ServicesResearch/MassSpec/ingel.htm). Briefly, sections of SDS-PAGE gels containing TPPII (visualized by Coomassie Blue staining) were excised, washed, treated with 50 mM DTT and 55 mM iodoacetamide, and incubated at 37°C overnight with 20 ng/µL trypsin (Promega, Madison, WI) or 25 ng/µL Glu-C (Roche, Indianapolis) in 100 mM ammonium bicarbonate, pH 8.0. The release peptides were extracted in 0.1% trifluoroacetic acid followed by 5% trifluoroacetic acid and 75% acetonitrile, and vacuum dried. MS sequencing employed capillary liquid chromatography-MS/MS system consisting of an HPLC connected to an ESI ion-trap MS (Surveyor HPLC and LCQ deca XPplus; ThermoFinnigan, San Jose, CA). A fritless 100- x 365-µm fused silica capillary microcolumn was prepared by pulling the tip of the capillary to approximately 2 µm with a P-2000 laser puller (Sutter Instruments, Novato, CA) and packing the capillary with 10 cm of 5 µm-diameter C18 beads (Western Analytical Products, Murrieta, CA). The vacuum-dried digests of TPPII were reconstituted in 10 µL of 95% water, 0.1% formic acid, and 5% acetonitrile. One-half of the sample was loaded onto the fused-silica capillary microcolumn at a flow rate of 1 µL/min for 30 min. The peptides were eluted over 150 min at a flow rate of 300 nL/min with a gradient of 5% to 80% acetonitrile in 0.1% formic acid. A full-mass scan was performed between 400 to 2,000 m/z, followed by 3 MS/MS scans of the 3 highest intensity parent ions at 45% relative collision energy. The acquired MS/MS spectra were searched against an Arabidopsis protein database derived from the National Center for Biotechnology Information (NCBI) nonredundant database (http://www.ncbi.nlm.nih.gov) using the SEQUEST program (ThermoFinnigan). For N-terminal sequencing of TPPII, the 153- and 142-kD species were separated by SDS-PAGE and electrophoretically transferred onto a PVDF membrane (Millipore, Bedford, MA). Regions of the membrane containing the two species were excised, washed extensively with water, and subjected to 8 cycles of Edman degradation using a 494 Procise protein sequencer followed by a 140C analyzer (Applied Biosystems, Foster City, CA).
Nondenaturing PAGE followed the protocol as described in Yang et al. (2004)
The Arabidopsis genomic and EST databases (http://genome-www.stanford.edu/Arabidopsis) were searched by BLAST (Altschul et al., 1997
The tpp2-1 insertion mutant (SALK-085776) in the Arabidopsis ecotype Col-0 background was identified in the SIGNAL T-DNA collection (Alonso et al., 2003
For RT-PCR, total RNA was isolated from 10-d-old seedlings using the Trizol protocol (Invitrogen, Carlsbad, CA). Each first-strand cDNA reaction was performed using a TPP2- specific primer (primer 1, GCCAGTTGATCACGTGTCACCTCCAT), a PAE2-specific primer, 1 µg of RNA, and Moloney murine leukemia virus reverse transcriptase (Promega). The first-strand cDNA was then PCR amplified using three sets of primer pairs for TPP2: set A (primer 2, TGCAGATTCACGGCGCGTTAATCAACAAAG and primer 3, CCAACTTGGAACCTACACGCCACTCTCC), set B (primer 4, GTGTGGCATGATGGAGAAGTATGGAGGGTTG and primer 5, TCTCCATAGCTCATGTTGACAAGATCACAG), and set C (primer 6, CAGACTATGGGCGCTTTGTTGATCTTGTTAC and primer 7, TATCAACTTGCATAAGCCCTTGTCCAGTAG); the position of each is identified left to right in Figure 2. The PAE2 primers are as described (Downes et al., 2003
The wild-type and homozygous mutant seeds were vapor-phase sterilized for 4 h, stratified at 4°C for 3 d in the dark, and germinated on solid GM containing 0.8% agar. The plants were grown under a long-day photoperiod (16-h light/8-h dark). Effects of various inhibitors on root growth were measured by transferring 4-d-old seedlings of equal size to solid GM containing the inhibitors and growing the seedlings vertically for an additional 7 d. For immunoblot analyses, seedlings were frozen to liquid nitrogen temperatures and homogenized in SDS-PAGE sample buffer. The clarified extracts were subjected to SDS-PAGE, transferred to PVDF membranes, and probed with antibodies against PBA1, RPN12a, RPN5a, RPN1a, UBC1, and Ub as described (Smalle et al., 2002
We thank Drs. Michael Westphall and Derek Gingerich for help with the MS analyses and genotyping, respectively. Received November 30, 2004; returned for revision January 25, 2005; accepted February 3, 2005.
1 This work was supported by the National Science Foundation Arabidopsis 2010 Initiative (grant no. MCB–0115870), by the U.S. Department of Energy Basic Energy Sciences program (grant no. DE–FG02–88ER13968 to R.D.V.), by the National Heart, Lung and Blood Institute-National Institutes of Health (grant no. N01–HV–28182 to L.M.S.), and by a Louis and Elsa Thomsen Wisconsin Distinguished Predoctoral Fellowship (to P.Y.). 
2 These authors contributed equally to the paper. Article, publication date, and citation information can be found at www.plantphysiol.org/cgi/doi/10.1104/pp.104.057406. * Corresponding author; e-mail vierstra{at}wisc.edu; fax 608–262–2976.
Alonso JM, Stepanova AN, Leisse TJ, Kim CJ, Chen HM, Shinn P, Stevenson DK, Zimmerman J, Barajas P, Cheuk R, et al (2003) Genome-wide insertional mutagenesis of Arabidopsis thaliana. Science 301: 653–657
Altschul S, Madden T, Schaffer A, Zhang J, Zhang Z, Miller W, Lipman D (1997) Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res 25: 3389–3402
Balow R, Tomkinson B, Ragnarsson U, Zetterqvist O (1986) Purification, substrate specificity, and classification of tripeptidyl peptidase II. J Biol Chem 261: 2409–2417 Callis J (1995) Regulation of protein degradation. Plant Cell 7: 845–857[CrossRef][ISI][Medline]
Decottignies A, Sanchez-Perez I, Nurse P (2003) Schizosaccharomyces pombe essential genes: a pilot study. Genome Res 13: 399–406 Downes B, Stupar R, Gingerich D, Vierstra R (2003) The HECT ubiquitin-protein ligase (UPL) family in Arabidopsis: UPL3 has a specific role in trichome development. Plant J 35: 729–742[CrossRef][ISI][Medline]
Geier E, Pfeifer G, Wilm M, Lucchiari-Hartz M, Baumeister W, Eichmann K, Niedermann G (1999) A giant protease with potential to substitute for some functions of the proteasome. Science 283: 978–981
Girod PA, Fu H, Zryd JP, Vierstra RD (1999) Multiubiquitin chain binding subunit MCB1 (RPN10) of the 26S proteasome is essential for developmental progression in Physcomitrella patens. Plant Cell 11: 1457–1471 Glas R, Bogyo M, McMaster J, Gaczynska M, Ploegh H (1998) A proteolytic system that compensates for loss of proteasome function. Nature 392: 618–622[CrossRef][Medline]
Gu YQ, Chao WS, Walling LL (1996) Localization and post-translational processing of the wound-induced leucine aminopeptidase proteins of tomato. J Biol Chem 271: 25880–25887 Hilbi H, Jozsa E, Tomkinson B (2002) Identification of the catalytic triad in tripeptidyl-peptidase II through site-directed mutagenesis. Biochim Biophys Acta 1601: 149–154[Medline] Kamath R, Fraser A, Dong Y, Poulin G, Durbin R, Gotta M, Kanapin A, Le Bot N, Moreno S, Sohrmann M, et al (2003) Systematic functional analysis of the Caenorhabditis elegans genome using RNAi. Nature 421: 231–237[CrossRef][Medline]
Kisselev AF, Akopian TN, Woo KM, Goldberg AL (1999) The sizes of peptides generated from protein by mammalian 26 and 20 S proteasomes: implications for understanding the degradative mechanism and antigen presentation. J Biol Chem 274: 3363–3371
Meiners S, Heyken D, Weller A, Ludwig A, Stangl K, Kloetzel PM, Kruger E (2003) Inhibition of proteasome activity induces concerted expression of proteasome genes and de novo formation of mammalian proteasomes. J Biol Chem 278: 21517–21525 Osmulski PA, Gaczynska M (1998) A new large proteolytic complex distinct from the proteasome is present in the cytosol of fission yeast. Curr Biol 8: 1023–1026[CrossRef][Medline]
Princiotta M, Schubert U, Chen W, Bennink J, Myung J, Crews C, Yewdell J (2001) Cells adapted to the proteasome inhibitor 4-hydroxy5-iodo-3-nitrophenylacetyl-Leu-Leu-leucinal-vinyl sulfone require enzymatically active proteasomes for continued survival. Proc Natl Acad Sci USA 98: 513–518 Reits E, Neijssen J, Herberts C, Benckhuijsen W, Janssen L, Drijfhout J, Neefjes J (2004) A major role for TPPII in trimming proteasomal degradation products for MHC class I antigen presentation. Immunity 20: 495–506[CrossRef][ISI][Medline]
Renn S, Tomkinson B, Taghert P (1998) Characterization and cloning of tripeptidyl peptidase II from the fruit fly, Drosophila melanogaster. J Biol Chem 273: 19173–19182 Rockel B, Peters J, Kuhlmorgen B, Glaeser R, Baumeister W (2002) A giant protease with a twist: the TPP II complex from Drosophila studied by electron microscopy. EMBO J 21: 5979–5984[CrossRef][ISI][Medline] Rose C, Vargas F, Facchinetti P, Bourgeat P, Bambal RB, Bishop PB, Chan SMT, Moore ANJ, Ganellin CR, Schwartz JC (1996) Characterization and inhibition of a cholecystokinin-inactivating serine peptidase. Nature 380: 403–409[CrossRef][Medline]
Saric T, Graef C, Goldberg A (2004) Pathway for degradation of peptides generated by proteasomes: a key role for thimet oligopeptidase and other metallopeptidases. J Biol Chem 279: 46723–46732 Seifert U, Maranon C, Shmueli A, Desoutter JF, Wesoloski L, Janek K, Henklein P, Diescher S, Andrieu M, de la Salle H, et al (2003) An essential role for tripeptidyl peptidase in the generation of an MHC class I epitope. Nat Immunol 4: 375–379[CrossRef][Medline] Shimotsuura I, Yoshida N, Ogata F, Ito A (1992) Evidence for and properties of a tripeptidyl peptidase in soybean (Glycine max Merr.) extract. Plant Sci 87: 1–7[CrossRef] Siezen R, Leunissen J (1997) Subtilases: the superfamily of subtilisin-like serine proteases. Protein Sci 6: 501–523[Abstract]
Smalle J, Kurepa J, Yang P, Babiychuk E, Kushnir S, Durski A, Vierstra R (2002) Cytokinin growth responses in Arabidopsis involve the 26S proteasome subunit RPN12. Plant Cell 14: 17–32
Smalle J, Kurepa J, Yang P, Emborg TJ, Babyichuk E, Kushnir S, Vierstra RD (2003) The pleiotropic role of the 26S proteasome subunit RPN10 in Arabidopsis thaliana growth and development supports a substrate-specific function in abscisic acid signaling. Plant Cell 15: 965–980 Smalle J, Vierstra R (2004) The ubiquitin 26S proteasome proteolytic pathway. Annu Rev Plant Biol 55: 555–590[CrossRef][Medline]
Tamura T, Tamura N, Cejka Z, Hegerl R, Lottspeich F, Baumeister W (1996) Tricorn protease: the core of a modular proteolytic system. Science 274: 1385–1389 Thompson A, Vierstra R (2005) Autophagic recycling: lessons from yeast help define the process in plants. Curr Opin Plant Biol 8: 165–173[CrossRef][ISI][Medline] Tomkinson B (1999) Tripeptidyl peptidases: enzymes that count. Trends Biochem Sci 24: 355–359[CrossRef][ISI][Medline] Tomkinson B (2000) Association and dissociation of the tripeptidyl-peptidase II complex as a way of regulating the enzyme activity. Arch Biochem Biophys 376: 275–280[CrossRef][Medline] Tomkinson B, Laoi B, Wellington K (2002) The insert within the catalytic domain of tripeptidyl-peptidase II is important for the formation of the active complex. Eur J Biochem 269: 1438–1443[Medline] Vierstra R (1996) Proteolysis in plants: mechanisms and functions. Plant Mol Biol 32: 275–302[CrossRef][ISI][Medline] Voges D, Zwickl P, Baumeister W (1999) The 26S proteasome: a molecular machine designed for controlled proteolysis. Annu Rev Biochem 68: 1015–1068[CrossRef][ISI][Medline] Wenzel T, Eckerskorn C, Lottspeich F, Baumeister W (1994) Existence of a molecular ruler in proteasomes suggested by analysis of degradation products. FEBS Lett 349: 205–209[CrossRef][ISI][Medline]
Xie Y, Varshavsky A (2001) RPN4 is a ligand, substrate, and transcriptional regulator of the 26S proteasome: a negative feedback circuit. Proc Natl Acad Sci USA 98: 3056–3061
Yan N, Doelling JH, Falbel TG, Durski AM, Vierstra RD (2000) The ubiquitin-specific protease family from Arabidopsis. AtUBP1 and 2 are required for the resistance to the amino acid analog canavanine. Plant Physiol 124: 1828–1843
Yang P, Fu H, Walker J, Papa C, Smalle J, Ju Y-M, Vierstra R (2004) Purification of the Arabidopsis 26S proteasome: biochemical and molecular analyses revealed the presence of multiple isoforms. J Biol Chem 279: 6401–6413 This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
TOP
ABSTRACT
RESULTS
) and without (
) the addition of 50 µM butabindide. Elution profile of total protein (A280) is included. C, SDS-PAGE of the column fractions surrounding the peak of TPPII peptidase activity. The positions of the 153- and 142-kD forms of TPPII are shown. The SDS-PAGE migration and elution position of the heat shock protein-60 chaperonin and the 20S CP of the 26S proteasome are indicated in B and C.
85 residues from the C-terminal end. However, given the absence of any peptides from both species matching the first 105 residues, we could not rule out the possibility that the N-terminal end was also affected. The unusually long N-terminal extension predicted for Arabidopsis TPPII also raised the possibility that the internal Met at position 69 and not the predicted Met-1 is the first amino acid. To resolve these ambiguities, we determined the N-terminal sequence of both the 153- and 142-kD forms by Edman degradation. (MS/MS analysis of tryptic fragments failed to find any acetylated amino acids, suggesting that neither species contains a block N terminus.) The N-terminal sequence of the 142-kD species was determined to be Leu-Asn-Glu-Ser, indicating that this protein started at Leu-107 (
-lactone (lactacystin), (+)-(2S,3S)-3-[[(S)-3-methyl-1-[(3-methylbutyl) carbamoyl]butyl]carbamoyl]-2-oxiranecarboxylic acid (E-64c), leupeptin, and Na2EDTA were used in the inhibitor studies. 
