|
|
||||||||
|
First published online May 27, 2005; 10.1104/pp.104.058032 Plant Physiology 138:1083-1096 (2005) © 2005 American Society of Plant Biologists The Arabidopsis Transcription Factor MYB12 Is a Flavonol-Specific Regulator of Phenylpropanoid Biosynthesis1Max-Planck-Institute for Plant Breeding Research, D50829 Cologne, Germany
Comprehensive functional data on plant R2R3-MYB transcription factors is still scarce compared to the manifold of their occurrence. Here, we identified the Arabidopsis (Arabidopsis thaliana) R2R3-MYB transcription factor MYB12 as a flavonol-specific activator of flavonoid biosynthesis. Transient expression in Arabidopsis protoplasts revealed a high degree of functional similarity between MYB12 and the structurally closely related factor P from maize (Zea mays). Both displayed similar target gene specificity, and both activated target gene promoters only in the presence of a functional MYB recognition element. The genes encoding the flavonoid biosynthesis enzymes chalcone synthase, chalcone flavanone isomerase, flavanone 3-hydroxylase, and flavonol synthase were identified as target genes. Hence, our observations further add to the general notion of a close relationship between structure and function of R2R3-MYB factors. High-performance liquid chromatography analyses of myb12 mutant plants and MYB12 overexpression plants demonstrate a tight linkage between the expression level of functional MYB12 and the flavonol content of young seedlings. Quantitative real time reverse transcription-PCR using these mutant plants showed MYB12 to be a transcriptional regulator of CHALCONE SYNTHASE and FLAVONOL SYNTHASE in planta, the gene products of which are indispensable for the biosynthesis of flavonols.
Members of the MYB transcription factor superfamily are characterized by the presence of an amino acid motif structurally and functionally related to the DNA-binding domain of the product of the retroviral oncogene v-MYB and its animal cellular counterpart c-MYB. MYB proteins have been identified in a large number of eukaryotic organisms ranging from fungi (Stober-Grässer et al., 1992
Up to now, no or only few functional data are available for the overwhelming majority of plant MYB genes. The functional data available indicate that MYB transcription factors are involved in a wide array of cellular processes. These include development (e.g. AtMYB0/GL1 [Oppenheimer et al., 1991
The well-established flavonoid biosynthetic pathway (Fig. 1) serves as a useful model for studying metabolic regulation. More than 8,000 different flavonoids have been identified in vascular plants (Pietta, 2000
Many R2R3-MYB proteins share an extended degree of sequence similarity, especially within the highly conserved MYB domain. However, it remains unclear if in general this apparent structural redundancy also accounts for functional similarity. For example, the structurally closely related proteins ZmC1/Pl (Cone et al., 1993
Because of the strong amino acid sequence similarity of the Arabidopsis R2R3-MYB factor MYB12 to the maize MYB protein ZmP (84% identity within the MYB domain, 67% overall similarity) that controls phlobaphene synthesis in floral organs (Styles and Ceska, 1977
Cotransfection Analyses Reveal MYB12 and ZmP As Flavonol-Specific Activators of Flavonoid Biosynthesis in the At7 Cell Culture System
To investigate if the structural similarity of MYB12 and ZmP equivalents functional similarity of the two factors, a transient expression system using protoplasts of cultured At7 cells was utilized. In this system, the cotransfection of effector and reporter plasmid constructs (Fig. 2) allows the quantification of promoter activity as well as the determination of the transactivation potential of a transcription factor by measuring uidA (
Figure 3A summarizes transfection experiments carried out to compare the transactivation capacities of MYB12 and ZmP within the flavonoid biosynthetic pathway (see Fig. 1). The promoters of the flavonoid biosynthesis genes CHS, CHI (chalcone flavanone isomerase), F3H (flavanone 3-hydroxylase), FLS, F3'H (flavonoid 3'-hydroxylase), and DFR were tested as potential targets for MYB12 and ZmP. MYB12 strongly activated the promoters of CHS, F3H, FLS, and, to some lesser extent, the CHI promoter. A similar activation pattern is displayed by ZmP, although the overall relative induction of promoter activity is generally lower than for MYB12; notably, FLS induction reached only 18% of that observed for MYB12. Neither MYB12 nor ZmP were able to activate the F3'H or DFR promoters to a significant extent. A combination of two factors from maize, the R2R3-MYB factor ZmC1 and the BHLH factor ZmSn, served as positive control for the functionality of the DFR promoter construct that was strongly activated by the combination of ZmC1/ZmSn. The factor ZmSn, when used in a control experiment as a single effector, showed marginal activation potential for the DFR promoter but no activation of the other promoters (Fig. 3A). MYB12 and ZmP did, in contrast to ZmC1, activate the target promoters independently of the presence of the BHLH factor ZmSn. In summary, the transactivation properties of MYB12 and ZmP in the transient expression system were almost identical with the exception of quantitative differences in the responsiveness of the FLS promoter to these two R2R3-MYB factors.
MYB12 Requires a Functional MYB Recognition Element for Transactivation To identify functional cis-acting elements required for MYB12 action, we assayed CHS promoter variants containing block mutations in the MRE, ACE, or the RRE (Fig. 3B). A functional MRE was shown to be required for activation by MYB12. Again, ZmP behaves similarly to MYB12, while the RRE was not necessary. By using ZmC1 and ZmSn in a control experiment, the functionality of the RRE was confirmed. Mutation of the ACE of the LRUAtCHS did not interfere with action of the R2R3-MYB factors tested.
The isolation of a myb12::En-1 line (designated AT123, Columbia [Col-0] background) from the En/Spm mutagenized AMAZE2 population allowed the in planta analysis of MYB12 function and the validation of the activity of MYB12 in regulating flavonoid biosynthesis. Figure 4A depicts the genomic structure of the wild-type MYB12 gene and of the myb12::En-1 allele. The presence of approximately 12 En-1 elements in this line (data not shown) rendered it genetically unstable, impeding functional analyses. Repeated backcrossing to wild-type plants (accession Col-0) led to the isolation of an En-1-free, homozygous myb12-ko line carrying the myb12-1f footprint allele that is derived from myb12::En-1 by excision of the En-1 transposon. The myb12-1f allele has a single base pair deleted at the original insertion site (Fig. 4B), which causes a frameshift that results in a premature termination of translation. The myb12-1f-encoded protein lacks 111 C-terminal amino acids of the wild-type MYB12 protein. The myb12-ko line was complemented with a 4.5-kb genomic fragment containing the MYB12 coding region under the control of the native MYB12 promoter. The resulting transgenic line was designated MYB12-COMP. In addition to the loss-of-function myb12-ko line, a homozygous 35S-MYB12 ectopic overexpression line (MYB12-OX) was constructed. The plants of both the myb12-ko and the MYB12-OX line showed no obvious phenotypic changes when compared to wild type under greenhouse conditions.
The myb12-1f Derived Protein Is Not Functional in Cotransfection Assays To address the question if the myb12-1f allele is still functional in activating the MYB12 target promoters identified above, we used the myb12-1f allele to generate an effector plasmid for cotransfection analyses. Figure 5 summarizes the results of the corresponding cotransfection experiments, illustrating that neither of the tested promoters showed any response to the myb12-1f protein. Thus, the truncated protein seems to be devoid of any activation potential indicating that the myb12-1f allele is not functional.
MYB12-OX and myb12-ko Plants Display a Flavonol Accumulation Phenotype Plants of the myb12-ko and MYB12-OX lines were analyzed for their flavonol contents by HPLC. Pilot experiments showed that young myb12-ko seedlings contained reduced amounts of flavonoids, while seedlings as well as leaves of MYB12-OX plants displayed an increased flavonoid content. For the following analyses, we concentrated on a series of 2- to 6-d-old developing seedlings grown under continuous white light that were sampled at 1-d intervals. In wild-type seedlings, five different quercetin and three different kaempferol derivatives were detected that originate from different glycosylation patterns of the aglycone (Fig. 6A). Under the growth conditions used, all plants contained higher amounts of total quercetin than total kaempferol. For Col-0 wild-type seedlings, the average ratio between quercetins and kaempferols was about 1.5. At all time points both the quercetin and the kaempferol content of myb12-ko seedlings was clearly reduced compared to the wild-type reference. For MYB12-OX seedlings, the opposite effect was observed; quercetin and kaempferol content were significantly increased (Fig. 6B). To check whether the biochemical alterations also extend to anthocyanidins, the anthocyanidin content of 6-d-old seedlings of wild-type, myb12-ko, and MYB12-OX seedlings was determined. No significant differences in anthocyanin content were detected (Fig. 6C), indicating that MYB12 does not control anthocyanin accumulation. Taken together, a clear and specific correlation between MYB12 activity and the flavonol content in developing seedlings was observed.
MYB12-COMP Plants Show Normal Flavonol Accumulation Successful complementation of the myb12-ko line was demonstrated by HPLC analysis of 6-d-old MYB12-COMP seedlings. As shown in Figure 6D, relative quercetin and kaempferol amounts in MYB12-COMP and wild-type plants were very similar. Both quercetin and kaempferol levels in the MYB12-COMP line reached about 90% of wild-type levels.
To analyze the effect of MYB12 on the expression of flavonol biosynthesis genes in planta, quantitative real time reverse transcription (RT)-PCR analyses were carried out using double labeled fluorogenic hybridization probes (TaqMan probes). The PCR efficiencies of all TaqMan systems, i.e. primer and probe combinations, proved to be identical within the boundaries of the error of measurement; efficiency values reached 100% (Fig. 7A). Figure 7B depicts the results of the quantitative RT-PCR analyses. The MYB12 expression level in wild-type seedlings showed only little variation over the course of the kinetic, reaching a maximum at day four or five. The values for myb12-ko seedlings were virtually identical, which is explained by the fact that the chosen TaqMan probe for MYB12 was not able to differentiate between transcripts from the MYB12 wild type and the myb12-1f allele. MYB12 was strongly (over) expressed in MYB12-OX seedlings with relative expression levels ranging from 50- to 80-fold above that of 2-d-old wild-type seedlings. The biosynthesis genes of the flavonoid pathway can be grouped into four categories in terms of their responsiveness to MYB12; the expression of the members of the first category, CHS and FLS, showed a clear correlation to the MYB12 expression level. In myb12-ko seedlings, the expression of both genes was reduced, while overexpression of MYB12 resulted in increased expression of both genes. CHI and F3H constitute the second category. No effect of the lack of MYB12 activity (myb12-1f plants) was observed for CHI and F3H. However, the expression level of both genes was in general increased in response to elevated MYB12 expression. The effect was more pronounced for CHI (5- to 17-fold increase) than for F3H (2- to 5-fold increase). The third category solely consists of the F3'H gene whose expression was more or less unaffected by changes in MYB12 expression. The differences in F3'H expression were always less than 2-fold and not consistent in the myb12-ko and MYB12-OX plants, although a slight trend of increased expression is observed in some of the MYB12-OX samples. The single member of the fourth category is the DFR gene whose expression under the experimental conditions chosen was extremely low in all samples analyzed. In general, the expression values of DFR relative to the CHS calibrator were below 0.05 (data not shown). Taken together, the data from quantitative real time RT-PCR analyses showed that only the two genes of the first category, CHS and FLS, were fully MYB12 responsive. No myb12-1f effect was detected on the other flavonoid genes analyzed (CHI, DFR, F3H, and F3'H). However, CHI and F3H displayed elevated expression levels in response to increased MYB12 expression.
MYB12 and ZmP Share Fundamental Functional Characteristics
Cotransfection analyses revealed substantial functional similarities between the plant R2R3-MYB transcription factors AtMYB12 and ZmP. MYB12 acts via a MRE (Feldbrügge et al., 1997
Recent studies of the protein-protein interaction specificities of the R2R3-MYB protein family revealed specific conserved amino acid signatures to be the structural basis for interaction of R2R3-MYB and R/B-like BHLH proteins (Grotewold et al., 2000
In contrast to MYB12 and ZmP, ZmC1 showed a different behavior. As described before, ZmC1 regulates together with a R/B-like BHLH partner (e.g. ZmSn) anthocyanin biosynthesis in maize kernels (Mol et al., 1996
The FLS gene, which encodes the enzyme flavonol synthase that catalyzes the committing step toward flavonols, is not responsive to ZmC1 plus ZmSn but is, as mentioned above, fully responsive to MYB12. This result again supports the notion of differential control of flavonol and anthocyanin biosynthesis by pathway-specific transcription factors also in Arabidopsis. The principle mode of regulation of anthocyanin and tannin accumulation via the combinatorial action of R2R3-MYB and a BHLH-type transcription factor is a conserved feature in both species (Baudry et al., 2004
The myb12-1f allele is not functional in transient expression assays, which may indicate that an activation domain is located in the C-terminal part of MYB12. Sequence analysis of the C-terminal domain of MYB12 revealed no substantial sequence similarities to previously described activation domains. However, the modular structure of MYB12 is similar to that of other R2R3-MYB factors, with the MYB DNA binding domain positioned at the N terminus and the C-terminal part of the protein harboring the transactivation domain. This includes AtMYB75 for which the transactivation domain was mapped to the 58 C-terminal residues of the protein (Zimmermann et al., 2004
Seedlings of both the myb12-ko and the MYB12-OX line show an abnormal flavonol content. Flavonol accumulation is strongly reduced in myb12-ko seedlings (on average about 2-fold for quercetins and 3.5-fold for kaempferols; Fig. 6, A and B), which express a nonfunctional MYB12 protein variant (myb12-1f), and strongly increased in seedlings and plants when MYB12 is overexpressed (approximately 4-fold for quercetins and 3-fold for kaempferols; Fig. 6, A and B). Complementation of the myb12-ko line with a 4.5-kb genomic fragment containing the MYB12 wild-type allele restores wild-type flavonol levels, confirming that the myb12-1f mutation is responsible for the observed phenotype (Fig. 6D). However, even without the presence of functional MYB12 protein, the synthesis of flavonols was not eliminated entirely. This fits the results of the quantitative RT-PCR analyses in which some residual expression of the flavonoid biosynthesis genes was always detected in the seedlings analyzed. Clearly, the flavonoid biosynthesis genes are also the targets of other transcription factors, including other R2R3-MYB proteins. MYB12 belongs to subgroup 7 of the R2R3-MYB family, and other members of this subgroup are MYB11 and MYB111 (Stracke et al., 2001
While most of the biosynthetic enzymes of the flavonoid pathway are encoded by single copy genes, there are five additional genes closely related to FLS present in Arabidopsis, two of which are seemingly not expressed (Winkel-Shirley, 2001 The myb12-ko plants also display reduced flavonol content in other parts of the plant, and AtGenExpress as well as our own data show that MYB12 expression is not restricted to seedlings. These data suggest a role for MYB12 in the regulation of flavonol biosynthesis also in organs of adult plants, but with a less dominant activity compared to that observed in seedlings.
The in planta effects of MYB12 on the level of gene expression were investigated using quantitative RT-PCR. The primary MYB12 targets were CHS and FLS. This is demonstrated by the clear reduction of the mRNA levels of both genes in myb12-ko seedlings (summarized in Fig. 8). CHS and FLS represent important branching points within flavonoid biosynthesis. CHS catalyzes the committing step toward flavonoids, the formation of 4,2',4',6'-tetrahydroxychalcone, and FLS the committing step toward flavonols by using dihydroflavonols as substrate (Fig. 1). Dihydroflavonols are also the substrate for DFR, which catalyzes the formation of leucoanthocyanidins. The leucoanthocyanidins are the first intermediates of the (pro-) anthocyanidin-specific branch of flavonoid biosynthesis. MYB12 directs the flux of flavonoid intermediates specifically toward the production of flavonols by activating FLS but not DFR.
Upon overexpression of MYB12 in plants, additional genes, namely CHI and F3H, fall under MYB12 control. This target gene selectivity could potentially be a result of the strong 35S promoter that may cause an accumulation of high levels of MYB12, which may activate promoters that are not controlled at lower factor levels. Such effects have been reported previously for c-Myb (Andersson et al., 1999
Obviously, the next question is "What regulates the regulator?" So far, the RT-PCR experiments that show very similar expression levels of MYB12 transcripts in wild-type and myb12-ko seedlings (Fig. 7B) exclude an auto regulatory action of MYB12 on its own promoter. Also, our results do not support the view of MYB12 as a developmental regulator of flavonoid biosynthesis. MYB12 exerts mainly quantitative effects on target gene expression; no clear-cut effects on the timing of gene expression have been observed. The observation that MYB12 directly acts on the promoters of the flavonoid biosynthesis genes places MYB12 at the downstream end of the signaling chain that causes flavonol-specific gene activation. Now, we need to address the question whether MYB12 is involved in any of the many stress signaling pathways (Li et al., 1993
Taken together, we have identified MYB12 as a flavonol-specific activator of flavonoid biosynthesis in developing seedlings. The interaction of MYB12 with a specific cis-acting promoter element, the MRE, provides the functional basis for transcriptional activation of a set of MYB12-responsive genes. We also show that MYB12 function does not depend on BHLH coactivators. An extended functional similarity between MYB12 and its maize homolog ZmP was observed, again indicating that structurally similar MYB transcription factors exhibit similar functions across different species. The biochemical data show a direct correlation between the expression level of functional MYB12 and the amount of flavonols in young seedlings. Changes in MYB12 activity do not effect anthocyanin formation, an observation that is in concordance with DFR not being responsive to MYB12. Finally, our results could be applied to the targeted manipulation of flavonoid metabolism toward the increased production of flavonols in plants. The expression of a single transgene, namely the MYB12 open reading frame (ORF) under a tissue- or even cell-specific promoter, should allow us to engineer plants with modified flavonol content in the addressed cells or tissue.
Standard Molecular Biology Techniques
Standard molecular biology techniques were applied according to Sambrook et al. (1989)
The Arabidopsis (Arabidopsis thaliana) cell line At7 was described previously (Trezzini et al., 1993
The isolation of insertion mutants from the En/Spm mutagenized AMAZE2 population (Wisman et al., 1998
The construct used for plant transformation was based on the binary vector pGPTV-TATA, a derivative of pGPTV (Becker et al., 1992
A 4.5-kb genomic fragment containing the MYB12 gene was amplified using the primers FM189 (GTGTGTGGTTGGTAAGCTTTAAATTAGCTAGTG; introduction of a HinDIII restriction site) and FM 190 (TTCCGAAAGAGCTCCATATAATAGATGCTTC; introduction of a SacI restriction site). The fragment was subcloned into the pCR 2.1. TOPO vector (Invitrogen) and checked for the correct sequence. After restriction digestion with EcoRI and SacI, the genomic fragment was cloned into a derivative of pPAM (GenBank accession no. AY027531). myb12-ko plants were transformed by infiltration (Bechtold et al., 1993
Total RNA was isolated using the RNeasy Mini kit from Qiagen (Hilden, Germany). RNA was treated with DNaseI (Qiagen) according to the manufacturer's specifications and precipitated with LiCl. RNA concentrations were determined using the RiboGreen RNA quantitation kit (Molecular Probes, Leiden, The Netherlands) following the manufacturer's specifications. cDNA synthesis was carried out following a protocol from Invitrogen with some minor modifications. A typical reaction mix (20 µL) consisted of 7 µL total RNA (maximum 5 µg), 0.5 µL of 0.5 µg/µL oligo(dT)(1218), 0.5 µL random hexamers (50 ng/µL), 4 µL SuperScript II 5x reaction buffer, 4 µL MgCl2 (25 mM), 1 µL dNTPs (10 mM each), 2 µL dithiothreitol (0.1 mM), and 1 µL SuperScript II reverse transcriptase (50 U/µL)]. The reaction mix was incubated at room temperature for 10 min and subsequently for 30 to 45 min at 42°C, followed by an incubation at 70°C for 10 min, after which the samples were cooled on ice or kept at 20°C for later use.
Quantitative real time RT-PCR using double labeled fluorogenic hybridization probes (TaqMan probes, see below) was performed utilizing an ABI PRISM 7700 Sequence Detection System (Applied Biosystems). The reaction volume of PCR samples was 25 µL. In all cases, Platinum Quantitative PCR Supermix-UDG (Invitrogen) was used for amplification following the supplier's instructions. Quantification of 18S rRNA for normalization of cDNA concentrations was performed using the TaqMan Ribosomal RNA Control Reagent (Applied Biosystems) according to manufacturer's instructions. Reaction mixes included the following components: 12.5 µL Platinum Quantitative PCR Supermix-UDG, 1.25 µL TaqMan Ribosomal Control Reagent, 0.5 µL ROX (carboxy-X-rhodamine) passive reference dye (Invitrogen), 5.75 µL water, and 5 µL cDNA template. Cycling conditions were: 2 min 50°C, 2 min 95°C followed by 30 cycles of denaturation for 15 s at 95°C and annealing/extension for 1 min at 60°C. In total, the threshold cycle numbers for the 18S rRNA target [Ct(18S)] were determined six times in two independent PCR runs per cDNA sample, one performed before the quantitation of the target genes and one performed afterward to check for variations in sample quality. The average Ct(18S) value including the SD Ct(18S) was calculated. The Ct values for the different target genes were determined using the PCR profile described above, but 40 instead of 30 two-step amplification cycles were carried out. The PCR reaction mixes comprised Platinum Quantitative PCR Supermix-UDG (12.5 µL), forward primer (variable, final concentration 0.9 µM), reverse primer (variable, final concentration 0.9 µM), TaqMan probe (variable, final concentration 0.2 µM), ROX passive reference dye (0.5 µL), water, and cDNA template (5 µL) to give a final volume of 25 µL. Target gene Ct values were determined as triplicates in two biological replicates, respectively. The Ct mean value including the SD Ct(target) was calculated. Subsequently
For all primer and probe systems, standard curves were generated using serial dilutions of DNA known to contain the respective target gene sequences. Ct values were measured as described above and plotted against the natural logarithm of DNA concentration. Regression analysis provided a linear function from which the PCR efficiency could be calculated using the term E = e1/m 1, where E is the PCR efficiency, e Euler's number, and m the slope of the regression function.
All hybridization probes listed below were purchased from Eurogentec (Seraing, Belgium). Probes were labeled with the 5'- dye FAM (6-carboxyfluorescein) and the 3'-dye TAMRA (6-carboxytetramethylrhodamine; quencher). Only HPLC purified primers were used. Target gene: MYB12 (At2g47460), forward primer 5'-AACCAAGGGAATCTCGACTGTCT-3', reverse primer 5'-CCCAATCGATAAACTCATCCGT-3', probe 5'-ACGACCACCAAGTTAACGATGCGTCG-3'; target gene: CHS (At5g13930), forward primer 5'-CGCATCACCAACAGTGAACAC-3', reverse primer 5'-TCCTCCGTCAGATGCATGTG-3', probe 5'-CGACTTGTCGCACATGCGCTTGAA-3'; target gene: CHI (At3g55120), forward primer 5'-CCGGTTCATCGATCCTCTTC-3', reverse primer 5'-ATCCCGGTTTCAGGGATACTATC-3', probe 5'-CCTACCGGCTCTCTTACGGTTGCGTT-3'; target gene: F3H (At3g51240), forward primer 5'-CAGATCGTTGAGGCTTGTGAGA-3', reverse primer 5'-GACGAGTCATATCCGCCACTAAGT-3', probe 5'-TCCAAGTGGTCGATCACGGCGTC-3'; target gene: FLS (At5g08640), forward primer 5'-CCGTCGTCGATCTAAGCGAT-3', reverse primer 5'-CGTCGGAATCCCGTGGT-3', probe 5'-ACCGCGCGCCTCACGCTT-3'; target gene: F3'H (At5g07990), forward primer 5'-GCTCTCGCCGGAGTATTCAA-3', reverse primer 5'-CCAGCGACGCCTTGTAAATC-3', probe 5'-TCGGAGACTTCGTGCCGTCCACTTGA-3'; target gene: DFR (At5g42800), forward primer 5'-CTCCTATCACTCGGAACGAGGCGCATTAC-3', reverse primer 5'-TGGTCGGTCCATTCATCACA-3', probe 5'-AGCGTTGCATAAGTCGTCCAA-3'.
A total of 100 to 200 mg of seedlings were placed in a 1.5-mL reaction tube, and 300 µL of 80% methanol and about 12 zirconium beads (diameter 1 mm; Roth, Karlsruhe, Germany) were added. Samples were homogenized at maximum speed for at least 1 min using a Mini BeadBeater-8 (BioSpec Products, Bartlesville, OK). Homogenized samples were centrifuged for a minimum of 15 min at 14,000 rpm in a standard table centrifuge at 4°C. The supernatants were vacuum dried in a SpeedVac (Thermo Savant, Holbrook, NY). Afterward, the dried pellets were dissolved in 100 µL of 80% methanol containing 0.02% (w/v) naringenin (Roth)/100 mg starting material. Naringenin was used as an internal standard for the relative quantification of flavonoid compounds. Pilot experiments showed that no endogenous naringenin was detectable in the seedlings analyzed at any time point (data not shown), making it a suitable calibrator for relative quantification.
Samples were analyzed using a 522 HPLC system equipped with a DAD detector 540 (Bio-Tek Kontron, Winooski, VT). Reversed phase chromatography was carried out using a Macherey & Nagel (Dueren, Germany) Nucleosil 120-5 C18 250/2 column. HPLC parameters were as follows: column temperature 30°C; solvent A = 0.1% trifluoroacetic acid in water, solvent B = 98% acetonitrile with 0.1% trifluoroacetic acid; solvent gradient, 0 min = 0% B, 3 min = 6% B, 12 min = 18% B, 25 min = 25% B, 35 min = 100% B, 40 min = 100% B. The flow rate was 0.35 mL/min. Peaks were classified as corresponding to kaempferol or quercetin derivatives by UV spectral analysis. The precise chemical nature of the detected substances, i.e. the glycosylation pattern of the flavonol aglyca, has not been elucidated. The areas of the flavonol peaks were normalized to the peak area of the internal standard naringenin resulting in relative flavonol amounts. Error bars indicate the SD of the average of relative flavonol amounts determined as triplicates in two independent biological replicates.
Extraction of anthocyanins of 6-d-old Arabidopsis seedlings was performed following the protocols of Rabino and Mancinelli (1986)
Protoplast isolation, transfection experiments, and illumination conditions for transient expression were described previously (Hartmann et al., 1998
All effector and reporter constructs used, except p35S-MYB12, p35S-myb12-1f, pF3'H, and pDFR, have been described before (Hartmann et al., 1998
We thank Ute Tartler for excellent technical assistance. We are grateful to Chiara Tonelli for providing the cDNAs encoding ZmC1 and ZmSn, and Erich Grotewold for providing the cDNA encoding ZmP. We also thank Ralf Stracke for many inspiring discussions during the writing of this paper and the anonymous reviewers of the first version of the manuscript for constructive criticisms. We are grateful to Klaus Hahlbrock for continuous support throughout the project. Received December 11, 2004; returned for revision February 24, 2005; accepted March 10, 2005.
1 This work was supported by the Max-Planck-Society, and in part by EC-BIOTECH (grant no. BIO4CT950129 to B.W.) and by the Deutsche Forschungsgemeinschaft.
2 Present address: Bielefeld University, Department of Biology, Genome Research, D33594 Bielefeld, Germany.
3 Present address: Gene Bridges GmbH, D69120 Heidelberg, Germany. Article, publication date, and citation information can be found at www.plantphysiol.org/cgi/doi/10.1104/pp.104.058032. * Corresponding author; e-mail bernd.weisshaar{at}uni-bielefeld.de; fax 495211066423.
Andersson KB, Berge T, Matre V, Gabrielsen OS (1999) Sequence selectivity of c-Myb in vivo. Resolution of a DNA target specificity paradox. J Biol Chem 274: 2198621994
Armstrong GA, Weisshaar B, Hahlbrock K (1992) Homodimeric and heterodimeric leucine zipper proteins and nuclear factors from parsley recognize diverse promoter elements with ACGT cores. Plant Cell 4: 525537 Baudry A, Heim MA, Dubreucq B, Caboche M, Weisshaar B, Lepiniec L (2004) TT2, TT8, and TTG1 synergistically specify the expression of BANYULS and proanthocyanidin biosynthesis in Arabidopsis thaliana. Plant J 39: 366380[CrossRef][Web of Science][Medline] Bechtold N, Ellis J, Pelletier G (1993) In planta Agrobacterium mediated gene transfer by infiltration of adult Arabidopsis thaliana plants. C R Acad Sci Paris Life Sci 316: 11941199 Becker D, Kemper E, Schell J, Masterson R (1992) New plant binary vectors with selectable markers located proximal to the left T-DNA border. Plant Mol Biol 20: 11951197[CrossRef][Web of Science][Medline]
Bender J, Fink GR (1998) A Myb homologue, ATR1, activates tryptophan gene expression in Arabidopsis. Proc Natl Acad Sci USA 95: 56555660
Borevitz JO, Xia YJ, Blount J, Dixon RA, Lamb C (2000) Activation tagging identifies a conserved MYB regulator of phenylpropanoid biosynthesis. Plant Cell 12: 23832393 Chopra S, Athma P, Peterson T (1996) Alleles of the maize P gene with distinct tissue specificities encode Myb-homologous proteins with C-terminal replacements. Plant Cell 8: 11491158[Abstract] Christie PJ, Alfenito MR, Walbot V (1994) Impact of low-temperature stress on general phenylpropanoid and anthocyanin pathways: enhancement of transcript abundance and anthocyanin pigmentation in maize seedlings. Planta 194: 541549[CrossRef][Web of Science] Cone KC, Cocciolone SM, Burr FA, Burr B (1993) Maize anthocyanin regulatory gene pl is a duplicate of c1 that functions in the plant. Plant Cell 5: 17951805[Abstract] Daniel X, Lacomme C, Morel J-B, Roby D (1999) A novel myb oncogene homologue in Arabidopsis thaliana related to hypersensitive cell death. Plant J 20: 5766[Medline] Dixon RA, Paiva NL (1995) Stress-induced phenylpropanoid metabolism. Plant Cell 7: 10851097[CrossRef][Web of Science][Medline] Esch JJ, Oppenheimer DG, Marks MD (1994) Characterization of a weak allele of the GL1 gene of Arabidopsis thaliana. Plant Mol Biol 24: 203207[CrossRef][Web of Science][Medline] Feldbrügge M, Sprenger M, Hahlbrock K, Weisshaar B (1997) PcMYB1, a novel plant protein containing a DNA-binding domain with one MYB repeat, interacts in vivo with a light-regulatory promoter unit. Plant J 11: 10791093[CrossRef][Web of Science][Medline] Gonda TJ, Gough NM, Dunn AR, de Blaquiere J (1985) Nucleotide sequence of cDNA clones of the murine myb proto-oncogene. EMBO J 4: 20032008[Web of Science][Medline] Grotewold E, Drummond BJ, Bowen B, Peterson T (1994) The myb-homologous P gene controls phlobaphene pigmentation in maize floral organs by directly activating a flavonoid biosynthetic gene subset. Cell 76: 543553[CrossRef][Web of Science][Medline]
Grotewold E, Sainz MB, Tagliani L, Hernandez JM, Bowen B, Chandler VL (2000) Identification of the residues in the Myb domain of maize C1 that specify the interaction with the bHLH cofactor R. Proc Natl Acad Sci USA 97: 1357913584 Harborne JB, Williams CA (2000) Advances in flavonoid research since 1992. Phytochemistry 55: 481504[CrossRef][Web of Science][Medline] Hartmann U, Sagasser M, Mehrtens F, Stracke R, Weisshaar B (2005) Differential combinatorial interactions of ACE-, MRE- and RRE-binding transcription factors control light-responsive and tissue-specific activation of phenylpropanoid biosynthesis genes. Plant Mol Biol 57: 155171[CrossRef][Web of Science][Medline] Hartmann U, Valentine WJ, Christie JM, Hays J, Jenkins GI, Weisshaar B (1998) Identification of UV/blue light-response elements in the Arabidopsis thaliana chalcone synthase promoter using a homologous protoplast transient expression system. Plant Mol Biol 36: 741754[CrossRef][Web of Science][Medline]
Hernandez JM, Heine GF, Irani NG, Feller A, Kim MG, Matulnik T, Chandler VL, Grotewold E (2004) Different mechanisms participate in the R-dependent activity of the R2R3 MYB transcription factor C1. J Biol Chem 279: 4820548213 Higginson T, Li SF, Parish RW (2003) AtMYB103 regulates tapetum and trichome development in Arabidopsis thaliana. Plant J 35: 177192[CrossRef][Web of Science][Medline]
Hirayama T, Shinozaki K (1996) A cdc5+ homolog of a higher plant, Arabidopsis thaliana. Proc Natl Acad Sci USA 93: 1337113376
Jia L, Clegg MT, Jiang T (2004) Evolutionary dynamics of the DNA-binding domains in putative R2R3-MYB genes identified from rice subspecies indica and japonica genomes. Plant Physiol 134: 575585 Jiang C, Gu X, Peterson T (2004) Identification of conserved gene structures and carboxy-terminal motifs in the Myb gene family of Arabidopsis and Oryza sativa L. ssp. indica. Genome Biol 5: R46[CrossRef][Medline] Jin H, Cominelli E, Bailey P, Parr A, Mehrtens F, Jones J, Tonelli C, Weisshaar B, Martin C (2000) Transcriptional repression by AtMYB4 controls production of UV-protecting sunscreens in Arabidopsis. EMBO J 19: 61506161[CrossRef][Web of Science][Medline] Jin H, Martin C (1999) Multifunctionality and diversity within the plant MYB -gene family. Plant Mol Biol 41: 577585[CrossRef][Web of Science][Medline] Koncz C, Schell J (1986) The promoter of TL-DNA gene 5 controls the tissue-specific expression of chimaeric genes carried by a novel type of Agrobacterium binary vector. Mol Gen Genet 204: 383396[CrossRef][Web of Science] Kranz H, Scholz K, Weisshaar B (2000) c-MYB oncogene-like genes encoding three MYB repeats occur in all major plant lineages. Plant J 21: 231235[CrossRef][Web of Science][Medline]
Kubasek WL, Shirley BW, McKillop A, Goodman HM, Briggs W, Ausubel FM (1992) Regulation of flavonoid biosynthetic genes in germinating Arabidopsis seedlings. Plant Cell 4: 12291236 Lee MM, Schiefelbein J (1999) WEREWOLF, a MYB-related protein in Arabidopsis, is a position-dependent regulator of epidermal cell patterning. Cell 24: 473483 Lee MM, Schiefelbein J (2001) Developmentally distinct MYB genes encode functionally equivalent proteins in Arabidopsis. Development 128: 15391546[Abstract] Li J, Ou-Lee T-M, Raba R, Amundson RG, Last RL (1993) Arabidopsis flavonoid mutants are hypersensitive to UV-B irradiation. Plant Cell 5: 171179[Abstract] Martin C, Paz-Ares J (1997) MYB transcription factors in plants. Trends Genet 13: 6773[CrossRef][Web of Science][Medline]
Meissner RC, Jin H, Cominelli E, Denekamp M, Fuertes A, Greco R, Kranz HD, Penfield S, Petroni K, Urzainqui A, et al (1999) Function search in a large transcription factor gene family in Arabidopsis: assessing the potential of reverse genetics to identify insertional mutations in R2R3 MYB genes. Plant Cell 11: 18271840 Mol J, Grotewold E, Koes R (1998) How genes paint flowers and seeds. Trends Plant Sci 3: 212217[CrossRef][Web of Science] Mol J, Jenkins GI, Schäfer E, Weiss D (1996) Signal perception, transduction, and gene expression involved in anthocyanin biosynthesis. Crit Rev Plant Sci 15: 525557
Nesi N, Jond C, Debeaujon I, Caboche M, Lepiniec L (2001) The Arabidopsis TT2 gene encodes an R2R3 MYB domain protein that acts as a key determinant for proanthocyanidin accumulation in developing seed. Plant Cell 13: 20992114
Nomura N, Takahashi M, Matsui M, Ishii S, Date T, Sasamoto S, Ishizaki R (1988) Isolation of human cDNA clones of myb-related genes, A-myb and B-myb. Nucleic Acids Res 16: 1107511089 Ohi R, McCollum D, Hirani B, Haese GJD, Zhang X, Burke JD, Turner K, Gould KL (1994) The Schizosaccharomyces pombe cdc5+ gene encodes an essential protein with homology to c-Myb. EMBO J 13: 471483[Web of Science][Medline] Oppenheimer DG, Herman PL, Sivakumaran S, Esch J, Marks MD (1991) A myb gene required for leaf trichome differentiation in Arabidopsis is expressed in stipules. Cell 67: 483493[CrossRef][Web of Science][Medline]
Penfield S, Meissner RC, Shoue DA, Carpita NC, Bevan MW (2001) MYB61 is required for mucilage deposition and extrusion in the Arabidopsis seed coat. Plant Cell 13: 27772791 Pietta PG (2000) Flavonoids as antioxidants. J Nat Prod 67: 10351042 Procissi A, Dolfini S, Ronchi A, Tonelli C (1997) Light-dependent spatial and temporal expression of pigment regulatory genes in developing maize seeds. Plant Cell 9: 15471557[Abstract] Quattrocchio F, Wing JF, Leppen HTC, Mol JNM, Koes RE (1993) Regulatory genes controlling anthocyanin pigmentation are functionally conserved among plant species and have distinct sets of target genes. Plant Cell 5: 14971512[Abstract] Quattrocchio F, Wing JF, van der Woude K, Mol JNM, Koes R (1998) Analysis of bHLH and MYB domain proteins: species specific regulatory differences are caused by divergent evolution of target anthocyanin genes. Plant J 13: 475488[CrossRef][Web of Science][Medline]
Rabino I, Mancinelli AL (1986) Light, temperature, and anthocyanin production. Plant Physiol 81: 922924
Rabinowicz P, Braun E, Wolfe A, Bowen B, Grotewold E (1999) Maize R2R3 Myb genes: Sequence analysis reveals amplification in the higher plants. Genetics 153: 427444
Riechmann JL, Heard J, Martin G, Reuber L, Jiang CZ, Keddie J, Adam L, Pineda O, Ratcliffe OJ, Samaha RR, et al (2000) Arabidopsis transcription factors: genome-wide comparative analysis among eukaryotes. Science 290: 21052110 Ryan KG, Swinney EE, Markham KR, Winefield C (2002) Flavonoid gene expression and UV photoprotection in transgenic and mutant petunia leaves. Phytochemistry 59: 2332[CrossRef][Web of Science][Medline] Ryan KG, Swinney EE, Winefield C, Markham KR (2001) Flavonoids and UV photoprotection in Arabidopsis mutants. Z Naturforsch C 56: 745754 Sambrook J, Fritsch EF, Maniatis T (1989) Molecular Cloning: A Laboratory Manual, Ed 2. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY Schwinn K, Davies K, Alm V, Mackay V, Martin C (2001) Regulation of anthocyanin biosynthesis in antirrhinum. Acta Hortic 560: 201206 Shikazono N, Tanaka A, Yokota Y, Watanabe H, Tano S (1998) Nucleotide sequence of the GLABROUS1 gene of Arabidopsis thaliana ecotype Columbia. DNA Seq 9: 177181[Medline]
Slamon DJ, Boone TC, Murdock DC, Keith DE, Press MF, Larson RA, Souza LM (1986) Studies of the human c-myb gene and its product in human acute leukemias. Science 233: 347351 Sprenger-Haussels M, Weisshaar B (2000) Transactivation properties of parsley proline rich bZIP transcription factors. Plant J 22: 18[CrossRef][Web of Science][Medline] Stober-Grässer U, Brydolf B, Bin X, Grässer F, Firtel RA, Lipsick JS (1992) The Myb DNA-binding domain is highly conserved in Dictyostelium discoideum. Oncogene 7: 589596[Web of Science][Medline] Stracke R, Werber M, Weisshaar B (2001) The R2R3-MYB gene family in Arabidopsis thaliana. Curr Opin Plant Biol 4: 447456[CrossRef][Web of Science][Medline] Styles ED, Ceska O (1977) The genetic control of flavonoid synthesis in maize. Can J Genet Cytol 19: 289302
Tice-Baldwin K, Fink GR, Arndt KT (1989) BAS1 has a Myb motif and activates HIS4 transcription only in combination with BAS2. Science 246: 931935 Trezzini GF, Horrichs A, Somssich IE (1993) Isolation of putative defense-related genes from Arabidopsis thaliana and expression in fungal elicitor-treated cells. Plant Mol Biol 21: 385389[CrossRef][Web of Science][Medline] Urao T, Yamaguchi-Shinozaki K, Urao S, Shinozaki K (1993) An Arabidopsis myb homolog is induced by dehydration stress and its gene product binds to the conserved MYB recognition sequence. Plant Cell 5: 15291539[Abstract] Weisshaar B, Jenkins GI (1998) Phenylpropanoid biosynthesis and its regulation. Curr Opin Plant Biol 1: 251257[CrossRef][Web of Science][Medline]
Winkel-Shirley B (2001) Flavonoid biosynthesis. A colorful model for genetics, biochemistry, cell biology, and biotechnology. Plant Physiol 126: 485493 Wisman E, Cardon GH, Fransz P, Saedler H (1998) The behaviour of the autonomous maize transposable element En/Spm in Arabidopsis thaliana allows efficient mutagenesis. Plant Mol Biol 37: 989999[CrossRef][Web of Science][Medline] Zimmermann IM, Heim MA, Weisshaar B, Uhrig JF (2004) Comprehensive identification of Arabidopsis thaliana MYB transcription factors interacting with R/B-like BHLH proteins. Plant J 40: 2234[CrossRef][Web of Science][Medline] This article has been cited by other articles:
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ASPB Publications | PLANT PHYSIOLOGY® | THE PLANT CELL | |
|---|---|---|---|