|
|
||||||||
|
Plant Physiology 138:1259-1267 (2005) © 2005 American Society of Plant Biologists The alc-GR System. A Modified alc Gene Switch Designed for Use in Plant Tissue Culture1,[w]Department of Cell and Developmental Biology, John Innes Centre, Norwich NR4 7UH, United Kingdom (G.R.R., O.K., M.I., P.L., J.H.D.); School of Biological Sciences, University of Liverpool, Liverpool L69 7ZB, United Kingdom (G.A.G., M.X.C., A.B.T.); Department of Regulation of Biological Signals, Graduate School of Bioagricultural Sciences, Nagoya University, Nagoya, Japan (M.I.); Laboratoire de Biologie Cellulaire, Institut J.P. Bourgin, Institut National de la Recherche Agronomique, 78026 Versailles Cedex, France (P.L.); and Wheat Improvement Centre, Syngenta, Norwich NR4 7UH, United Kingdom (D.J.L.)
The ALCR/alcA (alc) two-component, ethanol-inducible gene expression system provides stringent control of transgene expression in genetically modified plants. ALCR is an ethanol-activated transcription factor that can drive expression from the ALCR-responsive promoter (alcA). However, the alc system has been shown to have constitutive expression when used in plant callus or cell suspension cultures, possibly resulting from endogenous inducer produced in response to lowered oxygen availability. To widen the use of the alc system in plant cell culture conditions, the receptor domain of the rat glucocorticoid receptor (GR) was translationally fused to the C terminus of ALCR to produce ALCR-GR, which forms the basis of a glucocorticoid-inducible system (alc-GR). The alc-GR switch system was tested in tobacco (Nicotiana tabacum) Bright Yellow-2 suspension cells using a constitutively expressed ALCR-GR with four alternative alcA promoter-driven reporter genes: -glucuronidase, endoplasmic reticulum-targeted green fluorescent protein, haemagglutinin, and green fluorescent protein-tagged Arabidopsis (Arabidopsis thaliana) Arath;CDKA;1 cyclin-dependent kinase. Gene expression was shown to be stringently dependent on the synthetic glucocorticoid dexamethasone and, in cell suspensions, no longer required ethanol for induction. Thus, the alc-GR system allows tight control of alcA-driven genes in cell culture and complements the conventional ethanol switch used in whole plants.
The alc system is a two-component chemically inducible gene expression system, originally developed as a gene switch in Aspergillus nidulans (Waring et al., 1989
Plant-conditional gene expression systems (for review, see Gatz, 1997
We have previously used the alc system for the conditional restoration of gene function to the unusual floral organs (ufo) loss-of-function Arabidopsis mutant at different developmental stages (Laufs et al., 2003
Although the alc system has found widespread utility as a safe and effective expression system in whole plants, there are concerns about its efficacy under plant cell culture conditions. As will be demonstrated here, cell cultures often have significant, and sometimes high, levels of transgene expression in the absence of exogenous inducer. Although the reason for this is unclear, it is likely that plant cell culture conditions result in oxygen limitation leading to the production of inductive compounds. This limits the use of the alc system since it is often advantageous to test the effects of transgene expression in cell cultures. Furthermore, in those species in which transformation is reliant upon callus, transformation may be limited if expression of the transgene has deleterious effects during subculture or regeneration. To restore the requirement for an exogenously added chemical inducer, the rat glucocorticoid receptor (GR) domain has been fused to the ALCR transcription factor; conferring steroid-inducible control over alc-mediated gene expression. In animals, proteins containing a GR domain are sequestered outside of the nucleus with heat shock proteins and are released from these complexes upon binding of a steroid ligand (Picard, 1994
In this article, we describe the leaky expression of alc in tomato (Lycopersicon esculentum L. var. Ailsa Craig Mill.) cell cultures derived from a characterized transgenic line and the specification of a Dex-inducible alc system (alc-GR system) for use in the tobacco Bright Yellow (BY)-2 cell culture (Nagata et al., 1992
The alc Gene Expression System Is Constitutively Active in Plant Cell Cultures
To test the efficacy of the alc system to regulate transgene expression, callus and cell suspension cultures were derived from previously characterized transgenic tomato plants (Garoosi, 1998
Expression from the alc system in the absence of exogenously supplied inducer is not restricted to tomato. Tobacco BY-2 cells were transformed with 35S::ALCR/alcA::GUS using the pSRN/AGS plasmid (Roslan et al., 2001
To confer inducible transgene expression to the alc system in BY-2 cells, a translational fusion was constructed that placed the rat GR domain gene fragment (GR) at the 3'-end of the ALCR gene. The ALCR-GR gene fusion was placed under the control of a 35S promoter in the pGreen 0129 plasmid (Fig. 2a; Hellens et al., 2000
The ALCR-GR Transactivator-Mediated Gene Switch Is Dex But Not Ethanol Dependent in BY-2 Cells and Responds to Dex in a Dose-Dependent Manner To test how the addition of the GR domain to the ALCR protein had altered its response to induction, ALCR-GR control over alcA::erGFP expression was assayed following treatment of BY-2 cells with different combinations of Dex and/or solvents, in particular ethanol. We visually assayed the expression of endoplasmic reticulum-targeted green fluorescent protein (erGFP), in an H2.4 ALCR-GR background line sequentially transformed with alcA::erGFP, by fluorescence microscopy, 24 h after treatment with 1 µM Dex dissolved in ethanol or dimethyl sulfoxide (DMSO). Both solvents were applied at a final concentration of 0.1% (v/v). The solvents were also applied independently to determine whether they alone could induce expression via ALCR-GR. erGFP expression was induced by Dex dissolved in ethanol and by Dex dissolved in DMSO (Fig. 3a). Dex was essential for the activation of the alc-GR system as neither solvent alone was able to induce reporter gene expression.
To assess if ALCR-GR-regulated gene expression was dependent on the amount of Dex applied, the levels of alcA-driven GUS or Arath;CDKA;1-haemagglutinin (HA) were measured following treatment of cells with various concentrations of the inducer. GUS enzyme activity was assayed using a fluorometric assay following a 24-h induction with Dex (Fig. 3b). Generally, GUS activity was highest in a range of 0.1 to 10 µM Dex, with a slightly lower activity at 0.005 µM Dex. All three GUS reporter lines displayed a significantly lower GUS activity with 0.001 µM Dex. Two of the three GUS reporter lines displayed no background GUS activity on treatment with DMSO alone; however, line H4 32.8 displayed low GUS activity in the absence of Dex. The Dex dose-dependent Arath;CDKA;1-HA expression profile was assayed by western blot using whole-cell extracts (Fig. 3c). Arath;CDKA;1-HA expression produces a protein that is 6 kD larger than the endogenous tobacco CDKA protein: both proteins are recognized by the monoclonal antibody raised against the cyclin-dependent kinase (CDK) PSTAIR motif. The alcA::Arath;CDKA;1-HA in an H2 background displayed a similar Dex dose-dependent Arath;CDKA;1-HA expression profile as the GUS lines. Western blots of the Dex dose-dependent erGFP expression also displayed the same induction profile (Fig. 3d).
The dynamics of Dex induction of the ALC-GR system in tobacco BY-2 cells were defined by western blotting and fluorescence microscopy analyses of tagged Arath;CDKA;1. Following induction with 0.1 µM Dex, the accumulation of Arath;CDKA;1-HA, driven by the alc-GR system, was monitored by western blot using the PSTAIR antibody on whole-cell extracts. The Arath;CDKA;1-HA protein was detectable 1 h after induction, exceeded the level of endogenous CDKA proteins after 2 h, and maintained this high level for at least 12 h (Fig. 4a).
Arath;CDKA;1-GFP, a GFP-tagged Arabidopsis CDK driven by the alc-GR system, was visually monitored by fluorescent microscopy, again following treatment with 0.1 µM Dex. The Arath;CDKA;1-GFP fluorescence was weakly fluorescent 4 h after induction and was strongest from 12 h onwards after induction (Fig. 4b). It is known that GFP takes up to 4 h to fold properly before it becomes active (Heim et al., 1994
Given the increasing use of the alc system (Ait-ali et al., 2003
The alc gene switch has great potential for research and commercial application in part due to the nature of the inducer, ethanol, which is cheap and relatively nontoxic to plants and the environment. Ethanol is also highly penetrating and can induce gene expression deep within tissues such as meristems and even developing seeds (G.R. Roberts, L. Sakvarelidze, P. Laufs, and J.H. Doonan, unpublished data). However, plants can produce ethanol and acetaldehyde (the physiological inducer of the alc switch) during ethanolic fermentation, triggered by oxygen deficiency (see Drew, 1997 To address this, callus and cell suspension cultures were produced from transgenic plants already shown to contain a single T-DNA, which segregated normally, and that showed inducible regulation by alc but with negligible basal activity in the absence of exogenous inducer. This eliminated the possibility of constitutive expression in the cell cultures arising from the position of T-DNA integration, and further avoided the possibility of constitutive expression due to a series of different, or multiple, integration events within the selected transformed callus/cell line. Significant basal expression from alc was observed in callus cells, and high activity for both the alc-directed reporter gene activity and ADH were detected without exogenous inducer. The levels of activity in the cell suspension cultures were consistent with the artificial environment used to induce severe hypoxia in seedlings. Attempts to increase oxygen availability to such cells through the use of baffled flasks lowered but did not eliminate the leaky activity. This strongly suggested that ethanolic fermentation is activated in cell suspension cultures.
Since tobacco BY-2 cells are used widely, these were selected to test a modified alc system to ensure tight regulation of the transgene. Tests of the unmodified alc system showed expression in these cells in the absence of exogenous inducer, as in the tomato lines. We conferred chemical-inducible control over the alc system, in culture, by creating a translational fusion between the ALCR transcription factor and the GR domain of the GR to create the alc-GR Dex-inducible switch. A detailed characterization of the alc-GR switch in BY-2 cells demonstrated that this system mediates both tightly regulated and rapidly induced gene expression. The alc-GR system was activated by Dex whether dissolved in ethanol or DMSO, and it was tightly regulated as neither addition of ethanol or DMSO mediated gene expression in the absence of Dex. The switch was dose dependent with respect to Dex in a similar manner to other reports of glucocorticoid-inducible expression in BY-2 cells (Nara et al., 2000
A modified alc switch (alc-GR) has been developed and characterized for use in cell culture that complements and extends the existing alc switch as used in whole plant systems. Although this has not yet been tested in whole plants, the modified switch should be resistant to endogenous activation by flooding and other stress conditions. Furthermore, constructs containing genes driven by the alcA promoter can now be conditionally expressed in plants by induction with ethanol (via ALCR) and in cell culture by induction with Dex (via ALCR-GR). The alc-GR system restores conditional control over gene expression for the alc system, enhancing the general utility of the alc gene switch.
Plasmid Construction
DNA manipulations and cloning were carried out using standard procedures (Sambrook et al., 1989
The alcA::GUS-35S terminator cassette was introduced into the pGreen0029 vector (Hellens et al., 2000 The alcA::Arath;CDKA;1-HA cassette was introduced into pGreen0029. For this the EcoRI restriction site was added to a triple HA tag by PCR using primer set GCGGTAAATCTAGCAGTGCCTCAT and TAGCGAATTCACTGAGCAGCGTAATCTGGAA and pUC-HA as a template (gift from Dr. Laci Bogre), and PstI/NotI restriction sites were added to CDKA;1 by PCR using the primer set AAACTGCAGATGGATCAGTACGAGAAAGTTGAG (CDKA;1-PstI) and AAAGCGGCCGCCAGGCATGCCTCCAAGATCCTTG (CDKA;1-NotI) and pRS97 as template (gift from Dr. Robert Sablowski). The HA PCR product was digested with NotI/EcoRI and the Arath;CDKA;1 PCR product was digested with PstI/NotI, and both fragments were introduced into pL4 (gift from Syngenta, Norwich, UK), generating pGR40. A HindIII partially digested cassette from pGR40, containing alcA::Arath;CDKA;1-HA-35S terminator, was inserted into pGreen0029, generating pGR42 (Supplemental Fig. 1).
The alcA:: Arath;CDKA;1-GFP cassette was introduced into pGreen0029. For this, NotI/EcoRI restriction sites were added to a GFP tag by PCR using primer set CAGGGCGGCCGCGGGAGTAAAGGAGAAGAA and CTCGAATTCTTTATTTGTATAGTTCATCCATCGCA and pMCB5 as a template (Fernandez-Abalos et al., 1998
The LeGUS20 transgenic tomato (Lycopersicon esculentum L. var. Ailsa Craig Mill.) line, transformed with pSRN::pAGS::kanR, has been described previously (Garoosi, 1998
A rapidly growing suspension culture of tobacco BY-2 cells (Nicotiana tabacum cv BY-2) was maintained by weekly dilution (1:100) of culture into fresh medium (Nagata et al., 1992
Following cocultivation of BY-2 with pGR-35S::alcR-GR harboring A. tumefaciens, stable transformants of BY-2 were selected on petri plates containing 0.4% Phytagel in fresh culture medium, supplemented with carbenicillin (500 µg/mL) and hygromycin (41.6 µg/mL). The resultant ALCR-GR transformants were sequentially transformed with pGR32, pGR33, pGR14, or pGR42, and secondary transformants were selected for on media containing plates supplemented with kanamycin (200 µg/mL; An, 1987
To induce the unmodified alc system, the appropriate concentration of ethanol (v/v) was added to the growth medium. Induction of the alc-GR system was achieved using Dex (Sigma-Aldrich, St. Louis), dissolved in either ethanol or DMSO. For selecting alc-GR lines with high inducible expression, portions of calli/clones were induced overnight in microfuge tubes or 96-well microtitre plates with 500 µL of fresh media containing Dex/DMSO or DMSO and assayed for gene expression as appropriate. Cultures were induced by addition of dilutions of Dex/DMSO or DMSO as described in the results.
RNA was isolated using magnetic Oligo dT Dynabeads (Dynal, Bromborough, UK). Approximately 50 mg of cell pellet frozen in liquid nitrogen were ground in 100 µL of Lysis/Binding buffer (Dynal), centrifuged 1 min at 13,000 rpm in a benchtop centrifuge, then 50 µL of supernatant was added to 20 µL of Dynabeads prepared accordingly to manufacturer's instructions, incubated with gentle agitation for 5 min at room temperature to allow annealing of mRNA to the Oligo dT on the Dynabeads. Dynabeads were separated and washed accordingly to manufacturer's instructions, then resuspended in 20 µL of reaction mixture for RT (Omniscript, Qiagen USA, Valencia, CA) and incubated for 1 h at 37°C. PCR reactions were performed in a reaction volume of 25 µL (Taq Master Mix, Qiagen) with 4 µL of the cDNA reaction mixture containing suspended magnetic beads. GAPDH amplification was used as loading control. The oligonucleotide primer pairs had the following sequences: alcR-forward CTCTAAATCCTTCGCAACCAGC and alcR-reverse GGACGTTTTGGAGAGCATCG for amplification of fragment 400 bp; and GAPDH -forward GGTTTGGCATTGTGGAGGGTC and GAPDH-reverse CCCTCCGATTCCTCCTTGATTGC for amplification of fragment 304 bp. After 15 to 20 rounds of amplification, with primer annealing temperature of 55°C, 10-µL samples of the PCR reaction mixture were separated on a 1% (w/v) agarose gel.
Liquid nitrogen-frozen BY-2 cell pellets were homogenized in microfuge tubes in extraction buffer (50 mM Tris-HCl, 5 mM EDTA, 5 mM NaF, 0.1% [v/v] Triton X-100, pH 7.5), at a volume of 1 µL/mg of cells; before quantification (Bradford, 1976
BY-2 cells were suspended in GUS-staining buffer (Jefferson et al., 1987
For GUS, protein was extracted from liquid nitrogen frozen plant cells/tissue in microfuge tubes by homogenization in GUS extraction buffer (50 mM NaH2PO4, 10 mM EDTA, 0.1% [v/v] Triton X-100, 1.0 g L1 Sarcosyl). The GUS activity was determined with a fluorometric assay using 4-methylumbelliferyl
The GFP fluorescence of Arath;CDKA;1-GFP and erGFP-expressing BY-2 cells was visualized using a Nikon E600 microscope with excitation with 465 to 495 nm and emission filter 515 to 555 nm.
We thank Wolfgang Schuch for initiating this project, and Andrew Hutchins, Grant Calder, and Max Bush for providing technical assistance and advice, and for critically reading the manuscript. In addition, we thank Jan Traas, Lieve Laurens, Hilde Nelissen, and Emma Pilling for critical reading. Received January 12, 2005; returned for revision April 6, 2005; accepted April 6, 2005.
1 This work was supported by a Biotechnology and Biological Sciences Research Council Industrial Case (Syngenta-sponsored) studentship and Marie Curie predoctoral fellowship (to G.R.R.), and a studentship from the Government of Iran (G.A.G.).
2 Present address: Department of Agricultural Biotechnology, Imam Khomeini International University, P.O. Box 288, Qazvin, Iran.
3 Present address: Rothamsted Research, Rothamsted, Harpenden, Hertfordshire AL5 2JQ, UK.
[w] The online version of this article contains Web-only data. www.plantphysiol.org/cgi/doi/10.1104/pp.105.059659. * Corresponding author; e-mail john.doonan{at}bbsrc.ac.uk; fax 441603450045.
Ait-ali T, Rands C, Harberd NP (2003) Flexible control of plant architecture and yield via switchable expression of Arabidopsis gai. Plant Biotechnol J 1: 337343[CrossRef][Medline] An G (1987) Binary Ti vectors for plant transformation and promoter analysis. Methods Enzymol 153: 292303 Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72: 248254[CrossRef][Web of Science][Medline] Caddick MX, Greenland AJ, Jepson I, Krause KP, Qu N, Riddell KV, Salter MG, Schuch W, Sonnewald U, Tomsett AB (1998) An ethanol inducible gene switch for plants used to manipulate carbon metabolism. Nat Biotechnol 16: 177180[CrossRef][Web of Science][Medline] Chen S, Hofius D, Sonnewald U, Bornke F (2003) Temporal and spatial control of gene silencing in transgenic plants by inducible expression of double-stranded RNA. Plant J 36: 731740[CrossRef][Web of Science][Medline] Deveaux Y, Peaucelle A, Roberts GR, Coen E, Simon R, Mizukami Y, Traas J, Murray JAH, Doonan JH, Laufs P (2003) The ethanol switch: a tool for tissue-specific gene induction during plant development. Plant J 36: 918930[CrossRef][Web of Science][Medline] Drew MC (1997) Oxygen deficiency and root metabolism: injury and acclimation under hypoxia and anoxia. Annu Rev Plant Physiol Plant Mol Biol 48: 223250[CrossRef][Web of Science][Medline] Fernandez-Abalos JM, Fox H, Pitt C, Wells B, Doonan JH (1998) Plant-adapted green fluorescent protein is a versatile vital reporter for gene expression, protein localization and mitosis in the filamentous fungus, Aspergillus nidulans. Mol Microbiol 27: 121130[CrossRef][Web of Science][Medline] Fukao T, Bailey-Serres J (2004) Plant responses to hypoxia: Is survival a balancing act? Trends Plant Sci 9: 449456[CrossRef][Web of Science][Medline] Garoosi GA (1998) A chemical gene switch for use in transgenic plants. PhD thesis. University of Liverpool, Liverpool, UK Gatz C (1997) Chemical control of gene expression. Annu Rev Plant Physiol Plant Mol Biol 48: 89108[CrossRef][Web of Science] Guerineau F, Mullineaux PM (1993) Plant transformation and expression vectors. In RD Croy, ed, Plant Molecular Biology Labfax. BIOS Scientific Publishers, Oxford, pp 121148
Heim R, Prasher DC, Tsien RY (1994) Wavelength mutations and posttranslational autoxidation of green fluorescent protein. Proc Natl Acad Sci USA 91: 1250112504 Hellens RP, Edwards EA, Leyland NR, Bean S, Mullineaux PM (2000) pGreen: a versatile and flexible binary Ti vector for Agrobacterium-mediated plant transformation. Plant Mol Biol 42: 819832[CrossRef][Web of Science][Medline] Ingram GC, Goodrich J, Wilkinson MD, Simon R, Haughn GW, Coen ES (1995) Parallels between UNUSUAL FLORAL ORGANS and FIMBRIATA, genes controlling flower development in Arabidopsis and Antirrhinum. Plant Cell 7: 15011510[Abstract] James E, Lee JM (2001) The production of foreign proteins from genetically modified plant cells. Adv Biochem Eng Biotechnol 72: 127156[Medline] Jefferson RA, Kavanagh TA, Bevan MW (1987) GUS fusions: beta-glucuronidase as a sensitive and versatile gene fusion marker in higher plants. EMBO J 6: 39013907[Web of Science][Medline] Junker BH, Chu C, Sonnewald U, Willmitzer L, Fernie AR (2003) In plants the alc gene expression system responds more rapidly following induction with acetaldehyde than with ethanol. FEBS Lett 535: 136140[CrossRef][Web of Science][Medline]
Laufs P, Coen E, Kronenberger J, Traas J, Doonan J (2003) Separable roles of UFO during floral development revealed by conditional restoration of gene function. Development 130: 785796 Lee I, Wolfe DS, Nilsson O, Weigel D (1997) A LEAFY co-regulator encoded by UNUSUAL FLORAL ORGANS. Curr Biol 7: 95104[CrossRef][Web of Science][Medline] Maizel A, Weigel D (2004) Temporally and spatially controlled induction of gene expression in Arabidopsis thaliana. Plant J 38: 164171[CrossRef][Web of Science][Medline] Murashige T, Skoog F (1962) A revised medium for rapid growth and bioassay with tobacco tissue cultures. Science 245: 371378 Nagata T, Nemoto Y, Hasezawa S (1992) Tobacco BY-2 cell line as the "Hela" cell in the cell biology of higher plants. Int Rev Cytol 132: 130[Web of Science] Nara Y, Kurata H, Seki M, Taira K (2000) Glucocorticoid-induced expression of a foreign gene by the GVG system in transformed tobacco BY-2 cells. Biochem Eng J 6: 185191[Medline] Padidam M (2003) Chemically regulated gene expression in plants. Curr Opin Plant Biol 6: 169177[CrossRef][Web of Science][Medline] Patil RS, Davey MR, Power JB (1994) Highly efficient plant regeneration from mesophyll protoplasts of Indian field cultivars of tomato (Lycopersicon esculentum). Plant Cell Tissue Organ Cult 36: 255258[CrossRef] Picard D (1994) Regulation of protein function through expression of chimaeric proteins. Curr Opin Biotechnol 5: 511515[CrossRef][Medline] Roslan HA, Salter MG, Wood CD, White MR, Croft KP, Robson F, Coupland G, Doonan J, Laufs P, Tomsett AB, et al (2001) Characterization of the ethanol-inducible alc gene-expression system in Arabidopsis thaliana. Plant J 28: 225235[CrossRef][Web of Science][Medline]
Rumpho ME, Kennedy RA (1981) Anaerobic mechanism in germinating seeds of Echinochloa crus-galli (barnyard grass): metabolic and enzyme studies. Plant Physiol 68: 165168 Sablowski RW, Meyerowitz EM (1998) A homolog of NO APICAL MERISTEM is an immediate target of the floral homeotic genes APETALA3/PISTILLATA. Cell 92: 93103[CrossRef][Web of Science][Medline] Salter MG, Paine JA, Riddell KV, Jepson I, Greenland AJ, Caddick MX, Tomsett AB (1998) Characterisation of the ethanol-inducible alc gene expression system for transgenic plants. Plant J 16: 127132[CrossRef][Web of Science] Sambrook J, Fritsch EF, Maniatis T (1989) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY Sonnewald U, Brauer M, von Schaewen A, Stitt M, Willmitzer L (1991) Transgenic tobacco plants expressing yeast-derived invertase in either the cytosol, vacuole or apoplast: a powerful tool for studying sucrose metabolism and sink/source interactions. Plant J 1: 95106[CrossRef][Web of Science][Medline]
Sweetman JP, Chu C, Qu N, Greenland AJ, Sonnewald U, Jepson I (2002) Ethanol vapor is an efficient inducer of the alc gene expression system in model and crop plant species. Plant Physiol 129: 943948 Wang R, Zhou X, Wang X (2003) Chemically regulated expression systems and their applications in transgenic plants. Transgenic Res 12: 529540[CrossRef][Web of Science][Medline] Waring RB, May GS, Morris NR (1989) Characterization of an inducible expression system in Aspergillus nidulans using alcA and tubulin-coding genes. Gene 79: 119130[CrossRef][Web of Science][Medline] Zuo J, Chua NH (2000) Chemical-inducible systems for regulated expression of plant genes. Curr Opin Biotechnol 11: 146151[CrossRef][Web of Science][Medline] This article has been cited by other articles:
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ASPB Publications | PLANT PHYSIOLOGY® | THE PLANT CELL | |
|---|---|---|---|