Plant Physiol. PAM Fluorometers & Gas Exchange
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


First published online June 24, 2005; 10.1104/pp.105.063909

Plant Physiology 138:1396-1408 (2005)
© 2005 American Society of Plant Biologists

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
138/3/1396    most recent
pp.105.063909v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Alexander, D. L.
Right arrow Articles by Langdale, J. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Alexander, D. L.
Right arrow Articles by Langdale, J. A.
Agricola
Right arrow Articles by Alexander, D. L.
Right arrow Articles by Langdale, J. A.
DEVELOPMENT AND HORMONE ACTION

CORKSCREW1 Defines a Novel Mechanism of Domain Specification in the Maize Shoot1

Debbie L. Alexander2, E. Anne Mellor and Jane A. Langdale*

Department of Plant Sciences, University of Oxford, Oxford OX1 3RB, United Kingdom


    ABSTRACT
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 
In higher plants, determinate leaf primordia arise in regular patterns on the flanks of the indeterminate shoot apical meristem (SAM). The acquisition of leaf form is then a gradual process, involving the specification and growth of distinct domains within the three leaf axes. The recessive corkscrew1 (cks1) mutation of maize (Zea mays) disrupts both leaf initiation patterns in the SAM and domain specification within the mediolateral and proximodistal leaf axes. Specifically, cks1 mutant leaves exhibit multiple midribs and leaf sheath tissue differentiates in the blade domain. Such perturbations are a common feature of maize mutants that ectopically accumulate KNOTTED1-like homeobox (KNOX) proteins in leaf tissue. Consistent with this observation, at least two knox genes are ectopically expressed in cks1 mutant leaves. However, ectopic KNOX proteins cannot be detected. We therefore propose that CKS1 primarily functions within the SAM to establish boundaries between meristematic and leaf zones. Loss of gene function disrupts boundary formation, impacts phyllotactic patterns, and leads to aspects of indeterminate growth within leaf primordia. Because these perturbations arise independently of ectopic KNOX activity, the cks1 mutation defines a novel component of the developmental machinery that facilitates leaf-versus-shoot development in maize.


In higher plants, leaves arise as lateral organs from the vegetative shoot apical meristem (SAM). Patterns of leaf initiation lead to recognizable shoot architectures, with leaves usually separated by angles of 90°, 137.5°, or 180° (for review, see Steeves and Sussex, 1989Go). Despite regular patterns of initiation, leaves exhibit considerable variation in final shape. These variations result from different arrangements of cell types within distinct leaf domains (for review, see Leyser and Day, 2002Go; Tsiantis and Hay, 2003Go). During early development, domains are specified in three leaf axes: the proximodistal, mediolateral, and adaxial-abaxial. In the proximodistal axis, domains can be strikingly different or relatively uniform. For example, in compound leaves of pea (Pisum sativum), the most proximal domain is recognizable as stipules and the most distal domain as tendrils (Marx, 1987Go). In contrast, the proximal sheath and distal blade in grass leaves are identified more easily by the separating boundary of ligule than by distinct features of the sheath or blade (Freeling, 1992Go). In the mediolateral axis, the midrib defines the longitudinal center of the leaf (Esau, 1965Go). Between the midrib and leaf margins, vein spacing and differentiation patterns further subdivide the leaf. The adaxial-abaxial axis is defined by distinct epidermal cell characteristics on the upper and lower surface and by the asymmetric differentiation of vascular tissue. Phloem differentiates on the abaxial side of the leaf and xylem differentiates on the adaxial side.

Our understanding of leaf developmental processes comes primarily from studies in Arabidopsis (Arabidopsis thaliana), Antirrhinum (Antirrhinum majus), and maize (Zea mays). In all three species, leaf initiation is correlated with the down-regulation of knotted1-like homeobox (knox) genes on the flanks of the SAM (Vollbrecht et al., 1991Go; Smith et al., 1992Go; Jackson et al., 1994Go; Lincoln et al., 1994Go; Long et al., 1996Go). If knox gene expression is not suppressed in leaf primordia, domains within the leaf are mis-specified. In Arabidopsis and other core eudicots, ectopic knox expression leads to phenotypic perturbations in the leaf that range from lobing to ectopic meristem formation (Sinha et al., 1993Go; Lincoln et al., 1994Go; Hareven et al., 1996Go; Parnis et al., 1997Go; Ori et al., 1999Go; Avivi et al., 2000Go; Rosin et al., 2003Go). These perturbations have been variously interpreted; however, at the most basic level, ectopic knox expression in eudicots appears to delay or prevent the switch from indeterminate to determinate growth that is normally associated with the meristem-to-leaf transition. In contrast, ectopic knox expression in monocot leaves leads to specific perturbations in the proximodistal axis such that sheath, auricle, and ligule tissue are displaced into the blade domain (Smith et al., 1992Go; Matsuoka et al., 1993Go; Jackson et al., 1994Go; Schneeberger et al., 1995Go; Foster et al., 1999Go; Muehlebauer et al., 1999Go). Extra shoots have been observed in rice (Oryza sativa) plants that overexpress the knox gene osh15 (Nagasaki et al., 2001Go), but, in most cases, ectopic knox expression does not lead to ectopic meristem formation on monocot leaf blades. This observation suggests that the monocot leaf represents a distinct developmental context from that found in eudicot leaves.

Although ectopic knox gene expression in the leaf conditions different phenotypes in different species, domain specification within the leaf is always perturbed. As such, the mechanisms that suppress knox gene action define fundamentally important processes. Efforts to elucidate these mechanisms have focused on identifying recessive mutations that phenocopy the effects of ectopic knox gene expression in the leaf. Two classes of mutant have been identified, those that exhibit ectopic knox gene expression in the leaf and those that do not. The first class is defined by phantastica (phan) in Antirrhinum, Nicotiana sylvestris, and pea, by rough sheath2 (rs2) and semaphore1 (sem1) in maize, and by asymmetric leaves1 and 2 (as1 and as2), blade on petiole1 (bop1), filamentous flower (fil), and yabby3 (yab3) in Arabidopsis (Schneeberger et al., 1998Go; Waites et al., 1998Go; Timmermans et al., 1999Go; Tsiantis et al., 1999bGo; Byrne et al., 2000Go; Semiarti et al., 2001Go; Iwakawa et al., 2002Go; Kumaran et al., 2002Go; Scanlon et al., 2002Go; Ha et al., 2003Go; Lin et al., 2003Go; Xu et al., 2003Go; McHale and Koning, 2004Go). All of these mutants exhibit ectopic knox gene expression in the leaf, although the phenotypic consequences of that expression differ. The orthologous AS1, rs2, PHAN (ARP) genes (Tsiantis, 2001Go) encode Myb transcription factors, FIL and YAB3 encode YABBY transcription factors, and AS2 encodes a putative transcription factor that has been shown to heterodimerize with AS1. As such, ARP, AS2, and YABBY proteins define transcriptional components of the knox repression pathway. Notably, both monocot and lycophyte ARP genes complement the Arabidopsis as1 mutation, suggesting that ARP-mediated knox repression is conserved across diverse land plants (Theodoris et al., 2003Go; Harrison et al., 2005Go).

The second class of recessive mutants that phenocopy or enhance the effects of ectopic knox expression perturb a different component of the knox pathway. serrate (se) and pickle (pkl) mutants in Arabidopsis, handlebars (hb) in Antirrhinum, and the extended auricle1 (eta1) mutant in maize do not condition ectopic knox gene expression in the leaf (Ogas et al., 1999Go; Ori et al., 2000Go; Prigge and Wagner, 2001Go; Waites and Hudson, 2001Go; Osmont et al., 2003Go). However, all four mutations enhance the phenotype of mutations that do condition ectopic knox expression. SE and PKL encode proteins that are proposed to be involved in the epigenetic regulation of gene expression and it has therefore been suggested that mutations in these genes lead to the global derepression of knox gene targets (Ogas et al., 1999Go; Ori et al., 2000Go; Prigge and Wagner, 2001Go; Tsiantis, 2001Go).

Clearly, leaf initiation and domain specification are dependent on appropriate regulation of knox gene expression in many plant species. However, the way in which the knox pathway influences, or is influenced by, the physiological context in which it operates is less clear. Interactions with gibberellic acid (GA), cytokinin, and auxin pathways have all been investigated. In both tobacco (Nicotiana tabacum) and Arabidopsis, KNOX proteins have been shown to repress the expression of genes encoding GA20 oxidase, an enzyme in the GA biosynthetic pathway (Sakamoto et al., 2001Go; Hay et al., 2002Go). Therefore, KNOX repression on the flank of the SAM permits GA biosynthesis and facilitates determinate leaf growth.

The nature of KNOX interactions with the cytokinin and auxin pathways is less clear. For example, ectopic knox expression in the leaf and overexpression of cytokinin biosynthetic genes (Estruch et al., 1991Go) result in similar mutant phenotypes, suggesting a positive interaction between the two pathways. However, knox gene expression is induced in Arabidopsis plants overexpressing cytokinin biosynthetic genes and cytokinin levels are increased in rice and tobacco plants overexpressing knox genes (Kusabe et al., 1998Go; Ori et al., 1999Go). These observations suggest that a complex feedback mechanism may operate to modulate the two pathways. A similarly complex situation is seen with auxin interactions. Ectopic knox expression in rs2 and sem1 maize mutants is accompanied by a decrease in polar auxin transport (PAT; Tsiantis et al., 1999aGo; Scanlon et al., 2002Go). This suggests either that KNOX activity inhibits PAT or that a decrease in PAT leads to ectopic KNOX activity. Unfortunately, two studies using pharmacological inhibitors to inhibit PAT yielded conflicting results. In the first case, no ectopic KNOX activity was observed, suggesting that KNOX acts upstream of PAT (Tsiantis et al., 1999aGo), but, in the other, perturbed PAT led to ectopic KNOX activity (Scanlon, 2003Go). These data most likely infer a feedback mechanism as seen with cytokinin.

To further our understanding of domain specification in the maize shoot, we have characterized the recessive corkscrew1 (cks1) mutant. Superficially, cks1 mutants resemble rs2 and sem1 mutants; mutant plants are dwarfed and exhibit twisted leaves with displaced ligules. As in rs2 and sem1 mutants, knox gene transcripts accumulate ectopically in cks1 mutant leaves. However, ectopic accumulation of KNOX proteins cannot be detected. As such, CKS1 defines a KNOX-independent pathway that influences leaf and shoot development in maize.


    RESULTS
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 

Phytomer Dimensions Are Reduced in cks1 Mutant Plants

The recessive cks1 mutation was identified in an Spm mutagenesis screen for plants with perturbed shoot development. As the cks1 mutant phenotype was superficially similar to those reported for rs2 and sem1, allelism tests were carried out. All of the F1 progeny were wild type, indicating that cks1 defines a distinct locus from sem1 and rs2.

As shown in Figure 1A, cks1 mutant plants exhibit a number of shoot defects, the most prominent of which are reduced internodes and aberrant leaf development. Leaves are generally twisted, smaller than wild type, have displaced ligules, and exhibit perturbed vascular patterning. Mutant phenotypes vary in severity from those that are extremely dwarfed and do not reach maturity to those that are less dwarfed and go on to flower normally. This variation in expressivity decreases slightly after introgression into different genetic backgrounds (data not shown). Root architecture and cellular differentiation patterns are normal in cks1 mutants (data not shown), suggesting that CKS1 has no direct role in root development. However, root length is generally reduced in proportion to the severity of the shoot phenotype (Fig. 1A), suggesting an indirect effect of perturbations to shoot development. In a similar manner, the cks1 mutation does not directly affect reproductive development, but the reduced internodes and twisted leaves can stunt ear growth to the extent that ears fail to mature. Notably, the cks1 mutation affects the development of all shoot phytomers, including the five that are initiated in the seed. Thus, in a wild-type plant, cks1 gene function is required during both embryonic and postembryonic development.



View larger version (51K):
[in this window]
[in a new window]
 
Figure 1. Morphology of cks1 plants. A, Wild-type (left) and four cks1 mutants showing extent of phenotypic variation in 2-week-old seedlings. Scale bar = 2 cm. B, Internode length in wild-type (black) and cks1 (gray) mutants. Measurements were averaged over at least 20 wild-type and mutant plants and SE bars are shown. C, Internode and epidermal cell lengths averaged from internode 9 of 10 wild-type and mutant plants. Wild-type measurements are represented as 100%. Thus, the wild-type bar represents both internode and epidermal cell length. Mutant measurements are expressed as a percentage of wild-type length. SEs were calculated around the percentage of wild-type length, where A = average wild-type internode length, B = average mutant internode length, SE (A) = standard error of A, and SE (B) = standard error of B. Overall SE = 100 x [{{surd}(A2SE(B)2 + B2SE(A)2)}/A2].

 
The most obvious feature of cks1 mutants is reduced plant height as compared to wild-type siblings. To determine whether this dwarfing is due to a reduction in the length of each internode, a reduction in the length of specific internodes, or to a deletion of internodes, average internode lengths in wild-type and cks1 mutant plants were compared. Figure 1B demonstrates that, in both wild-type and cks1 mutant plants, internode length increases to a maximum around nodes 9 to 11, and then decreases in later phytomers. Thus, the cks1 mutation does not affect overall internode programming, but, at each node, mutant internodes are shorter than wild type.

To determine whether internode length is reduced as a consequence of reduced cell number or reduced cell expansion, epidermal cell size was measured at internode 9 of wild-type and cks1 mutant plants. Figure 1C shows that epidermal cell lengths are shorter in cks1 mutants than in wild type. However, the observed difference does not account for the total reduction in internode size (compare percent reduction of cell length versus internode length in Fig. 1C). Therefore, a reduction in both cell length and cell number must account for internode shortening in cks1 mutant plants.

To determine the extent to which perturbations to internode growth reflect perturbations to the entire phytomer, leaf dimensions and epidermal cell sizes within the leaf were measured in wild-type and cks1 mutants (data not shown). As with internodes, the cks1 mutation conditions a reduction in all measured phytomer dimensions (length and width of blade and sheath). Within the phytomer, internode and sheath dimensions are more strongly perturbed than blade dimensions. Again, the reduction in leaf dimensions correlated with a decrease in both epidermal cell length and cell number (data not shown).


Ligules Are Displaced in cks1 Mutant Leaves

In wild-type leaves, the proximal sheath domain and the distal blade domain are demarcated by the ligule (Fig. 2A). As shown in Figure 2B, ligules are displaced in cks1 mutant leaves. Ligule displacement can result from either perturbed ligule differentiation or from perturbed sheath blade boundary specification. To determine which of these processes is disrupted by the cks1 mutation, vascular patterns underlying the ligular region were examined. In wild-type leaves, minor veins originating in the leaf blade anastomose at the ligule so that only a single vein separates each lateral vein in the sheath (Fig. 2C). Figure 2D shows that, in cks1 mutant leaves, minor veins anastomose correctly, even if the ligule is displaced. This spatial synchronization of vascular patterning and ligule formation suggests that the cks1 mutation affects sheath blade boundary formation rather than ligule differentiation per se. To confirm this suggestion, the cks1 mutation was crossed into a line containing a Sn allele that directs anthocyanin production in the sheath and auricle regions of the leaf. In cks1;Sn double mutants, regions of anthocyanin pigmentation were observed extending into blade tissue, indicating that sheath tissue had been displaced distally (Fig. 2B). Thus, the cks1 mutation perturbs domain specification in the proximodistal axis.



View larger version (98K):
[in this window]
[in a new window]
 
Figure 2. Ligular displacement in cks1 leaves. A, Sn leaf showing pigmentation in sheath and auricle. Blade (b), sheath (s), and auricle (a) are indicated. B, cks1;Sn leaf showing pigmentation in sheath, auricle, and blade. C, Cleared first leaf from wild-type plant. D, Cleared first leaf from cks1 plant. Scale bar = 2.5 cm (A and B) and 2.5 mm (C and D). Black arrows point to the edge of the ligule on each leaf, white arrow to anthocyanin pigmentation in the blade, green arrows to lateral veins, and yellow arrows to minor veins.

 

Midrib Specification Is Perturbed in cks1 Mutants

cks1 mutant leaves exhibit vascular patterning defects. Most obviously, two midribs are observed in juvenile leaves, neither of which is positioned at the longitudinal center of the leaf (Fig. 3B). A similar phenotype has been reported for rs2-R mutant leaves, but, in the case of rs2-R, varying numbers of midribs are observed and one is always present in the normal position (Fig. 3C). To investigate the origin of the multiple midribs, vein numbers were counted in the first leaf sheath. When extra midribs were assumed to be lateral veins, rs2-R leaves with multiple midribs had the same number of lateral veins as leaves without extra midribs (Fig. 3D). In contrast, cks1 leaves with double midribs exhibited supernumerary lateral veins between the two midribs. This observation suggested that both midribs are true midribs in cks1 mutant leaves, whereas extra midribs in rs2-R mutant leaves are mis-specified lateral veins. To confirm this suggestion, we examined vein patterning at the leaf tip. At the tip of leaf one, the wild-type midrib acts as a focal point where all lateral veins terminate (Fig. 3E). Therefore, if more than one true midrib is present, lateral veins should terminate at more than one focal point. Notably, in cks1 leaves with two midribs, both midribs act as focal points for lateral vein termination (Fig. 3F). In contrast, lateral veins in rs2-R leaves with multiple midribs all terminate at a single point, focused on the centrally placed midrib (Fig. 3G). Therefore, it is likely that the rs2-R mutation prevents appropriate differentiation of lateral veins, whereas the cks1 mutation leads to the establishment of multiple true midribs. Thus, as well as perturbing domain specification in the proximodistal axis, the cks1 mutation perturbs midrib specification in the mediolateral axis.



View larger version (94K):
[in this window]
[in a new window]
 
Figure 3. Multiple midribs in cks1 and rs2 mutant leaves. A to C, Cleared first leaf from wild-type (A), cks1 (B), and rs2-R (C) mutants. Arrows point to midribs. Scale bar = 1 mm. D, Table showing average number of lateral veins in cks1 and rs2-R mutant leaf sheaths. Lateral veins were counted from five individuals with multiple midribs (MM) for each genotype, averaged, and rounded up to a whole number. cks1 and rs2-R leaves with a single midrib were used as controls. E to G, Tips of wild-type (E), cks1 (F), and rs2-R (G) leaves shown in A to C. Arrows indicate points at which lateral veins anastomose. Scale bar = 2 mm.

 

Phyllotaxy Is Perturbed in cks1 Mutants

In addition to perturbations within the leaf, cks1 mutants exhibit aberrant leaf initiation patterns at the shoot apex. Figure 4, A and B, illustrates the distichous phyllotaxy that is characteristic of normal maize shoots. Leaves arise at 180° intervals, with a single leaf at each node. In apices of severe cks1 mutants, however, phyllotaxy is perturbed such that leaves are initiated at closer intervals than normal (Fig. 4, C and D). In light of this observation, it is possible that the multiple midribs observed in cks1 mutant leaves arise following fusion of two adjacent leaf primordia. This suggestion is supported by the fact that cks1 mutant leaves often split to form two leaves that are narrower than normal, but which each have a defined midrib and margins (Fig. 4E). Therefore, mis-specification of domains in the mediolateral axis of cks1 leaves may occur as a consequence of events at the shoot apex rather than in the leaf itself.



View larger version (124K):
[in this window]
[in a new window]
 
Figure 4. Aberrant phyllotaxy in cks1 shoots. A to D, Transverse sections of wild-type and cks1 mutant apices, 21 d after planting. Wild-type (A) and cks1 (C) apices stained with fastgreen FCF are schematized (B and D, respectively) to show meristem (m) and plastochron 2 to 7 leaf positions. Scale bar = 120 µm. E, cks1 split-leaf phenotype. Arrows point to midribs. F, cks1 plant showing decussate phyllotaxy. Four leaf pairs are numbered from the base of the plant to illustrate the phyllotactic pattern. G, cks1 twin-shoot phenotype. H, Bifurcating cks1 apex stained with anti-KN1 antibody. Arrow points to region where shoots will separate. Scale bar = 200 µm. I, Meristem organization in a split-shoot cks1 mutant. Arrows point to distinct shoots. Leaves are initiated in a distichous pattern. Scale bar = 280 µm.

 
Very occasionally, phyllotaxy is perturbed to the extent that cks1 mutant shoots switch from distichous to decussate phyllotaxy (Fig. 4F) or vice versa. Notably, reversion from decussate to distichous phyllotaxy is associated with a twin-shoot phenotype (Fig. 4G). Plants initiate a number of leaves in a decussate pattern and then the shoot splits to produce two smaller shoots. Each of the new shoots behaves independently and produces leaves in a normal distichous pattern. Remarkably, this branching event is mediated by bifurcation of the main shoot apex rather than by outgrowth of an axillary meristem (Fig. 4, H and I). Bifurcating angiosperm SAMs are normally only seen following loss of meristem integrity, for example, following damage to the central zone or due to an imbalance between the number of cells in the peripheral and central zones (Pilkington, 1929Go; Reinhardt et al., 2003aGo). This observation therefore suggests that mechanisms maintaining the integrity of the SAM may be compromised in cks1 mutants.


knox Genes Are Expressed in cks1 Mutant Leaves

Perturbations to the proximodistal leaf axis and altered leaf initiation patterns have previously been correlated with the ectopic expression of knox genes. To determine whether knox genes are ectopically expressed in cks1 mutants, RNA was isolated from immature leaf primordia. Reverse transcription (RT)-PCR with gene-specific primers revealed that liguleless3 (lg3), rs1, kn1, and gnarley1 (gn1) transcripts accumulate ectopically in cks1 mutant leaves (Fig. 5). The relative difference in transcript levels between cks1 and wild type, as judged by patterns of amplification after different numbers of PCR cycles, is similar to that seen between rs2-R and wild type (Fig. 5). The amplification of gn1 and kn1 transcripts was less consistent than amplification of lg3 and rs1. Because of this inconsistency, at least three biological and experimental replicates were conducted. In addition, further experiments were carried out using isolated ligule tissue or leaf tissue from young shoots (data not shown). The data presented are representative of those obtained in all experiments. Namely, rs1 and lg3 transcripts are consistently detected in cks1 leaves; however, transcripts can also be detected in wild-type samples after >35 amplification cycles. A similar situation is seen with kn1, but 45 amplification cycles are required before transcript is detected in cks1 samples. gn1 transcripts are inconsistently detected in cks1 samples, but never in wild type, even after 65 amplification cycles. These data suggest that rs1 and lg3 transcript levels are higher in cks1 than in wild-type leaves and that in certain spatial or temporal conditions the same is true for kn1 and gn1. Notably, however, rs2 transcripts accumulate in both wild-type and cks1 leaves (Fig. 5), indicating that the cks1 mutation does not perturb the regulation of rs2 gene expression.



View larger version (103K):
[in this window]
[in a new window]
 
Figure 5. Ectopic knox gene expression in cks1 and rs2-R mutant leaves. Gene-specific RT-PCR products amplified from shoot apex (i.e. meristem plus young leaf primordia; lanes 1and 2) and immature leaf primordia (lanes 3 and 4) of cks1 wild-type siblings, cks1 immature leaf primordia (lanes 5–7), shoot apex (lanes 8 and 9), and immature leaf primordia (lanes 10 and 11) of rs2-R wild-type siblings and rs2-R immature leaf primordia (lanes 12–14). In each case, the number of amplification cycles is indicated as a subscript to the gene name. Each sample represents pooled tissue from five individual plants.

 

KNOX Protein Cannot Be Detected in cks1 Mutant Leaves

Because RS2 acts to suppress knox gene expression in the leaf, overlapping accumulation of rs2 and knox transcripts in the leaf is counterintuitive, unless CKS and RS2 act in distinct spatial or temporal domains to suppress KNOX activity. To investigate this suggestion, we examined KNOX protein accumulation patterns in mutant apices using anti-KNOX antibodies. As ectopic expression of rs1 was most consistently detected in RT-PCR experiments (Fig. 5), we first used an antibody that specifically detects RS1 as opposed to other KNOX proteins. Figure 6, A to F, shows the accumulation patterns of RS1 protein in wild-type, cks1, and rs2-R mutant apices. In wild-type apices (Fig. 6, A and D), RS1 accumulates in the SAM, in the axillary meristems, and at the very base of developing leaf primordia. In rs2-R mutants, RS1 also accumulates within the leaves (Fig. 6, C and F). Surprisingly, RS1 accumulation patterns in cks1 mutant apices are very similar to wild type. As the anti-RS1 antibody specifically recognizes RS1 protein, we repeated the experiment using antibodies raised against KN1 (Fig. 6, G–I). Identical results were obtained in that KNOX protein accumulation patterns were similar in wild-type and cks1 mutant apices (Fig. 6, H and I; data not shown). KNOX accumulation patterns were also examined in ligules, but, again, no protein could be detected in cks1 mutant tissue (Fig. 6, J–O). Anti-RS1, but not anti-KN1, antibody detected protein in rs2-R ligules (Fig. 6, L and O). These experiments were repeated with over 50 biological replicates and on no occasion was ectopic protein accumulation observed. It is formally possible that ectopic LG3 or GN1 proteins accumulate, but are not detected by, the anti-RS1 and anti-KN1 antibodies used. However, we believe that this is unlikely. gn1 and rs1 are duplicate genes and therefore GN1 and RS1 proteins cannot be distinguished by the anti-RS1 antibody. Furthermore, cks1 mutant ligules do not resemble those of dominant Lg3 mutants (data not shown) and thus LG3 is unlikely to accumulate ectopically. Therefore, there are three possible explanations for the results obtained. First, ectopic knox gene transcripts are translated, but the protein is turned over too rapidly to be detected. Second, protein accumulates in a very narrow spatial or temporal domain that we have been unable to detect. Third, ectopic knox transcripts are not translated. Regardless of which possibility is correct, these results demonstrate that the phenotypic perturbations seen in cks1 mutant leaves occur independently of noteworthy ectopic KNOX activity.



View larger version (110K):
[in this window]
[in a new window]
 
Figure 6. Immunolocalization of KNOX proteins in cks1 and rs2-R apices. A to F, RS1 protein in longitudinal (A–C) and transverse (D–F) sections of wild-type (A, D), cks1 (B, E), and rs2-R (C, F) shoot apices. White arrows indicate axillary meristems; black arrows indicate RS1 protein accumulation in the leaf. G to I, KN1 protein in transverse sections of wild-type (G), cks1 (H), and rs2-R (I) shoot apices. Black arrows indicate KN1 protein accumulation in the leaf. RS1 (J–L) and KN1 (M–O) proteins in ligules of wild type (J, M), cks1 (K, N), and rs2-R (L, O). Blue arrows point to ligules. Leaf plastochron numbers are shown in all transverse sections. Scale bars, A to C = 135 µm; D = 260 µm; E = 170 µm; F = 260 µm; G = 150 µm; H = 160 µm; I = 270 µm; J = 365 µm; K = 156 µm; L = 374 µm; M = 935 µm; n = 750 µm; O = 400 µm.

 

Hormone Homeostasis in cks1 Mutants

cks1 mutants are significantly shorter than wild-type siblings. Because defective GA biosynthesis causes dwarfing in all plant species examined (for review, see (Olszewski et al., 2002Go), cks1 mutants were treated with GA3 to assess whether plant height could be restored. The response of cks1 seedlings was compared with that of d3-100 mutants. d3 encodes a cytochrome P450 thought to convert GA12 to GA53, an early step in the GA biosynthetic pathway (Winkler and Helentjaris, 1995Go). Whereas control d3-100 plants more than doubled in height following GA3 treatment, cks1 mutants did not respond (Fig. 7A). Thus, the cks1 mutation does not perturb GA biosynthesis. It is also unlikely that global defects in GA signaling and/or response result from the cks1 mutation because mutant plants do not display the more characteristic features of maize GA mutants, such as increased tillering and the formation of perfect flowers on the ear. Furthermore, cks1 mesocotyls elongate when plants are grown in the dark, whereas d3-100 mesocotyls do not (Fig. 7, B and C). However, perturbed GA signaling within the leaf would be consistent with some of the phenotypic perturbations observed. For example, although all other epidermal cells differentiate appropriately, very few macrohairs are present on the surface of adult cks1 leaves (data not shown) and GA promotes macrohair initiation (Moose et al., 2004Go). Thus, GA signaling may be perturbed in certain spatial and/or temporal domains as a consequence of the cks1 mutation.



View larger version (33K):
[in this window]
[in a new window]
 
Figure 7. Analysis of hormone homeostasis in cks1 mutants. A, Graph representing the height of cks1 and d3-100 seedlings as compared to their respective wild-type siblings, with and without treatment with 5 mM GA3. Plants were grown for 2 weeks and then watered for a further week with either water or GA3. After this time, the height of six plants of each genotype was measured. Bars = SEs. B, Graph representing mesocotyl length in light- and dark-grown cks1 and d3-100 seedlings, as compared to their respective wild-type siblings. Six plants of each genotype were grown for 3 weeks in either the light or the dark. Bars = SEs. C, Photograph of representative plants from experiment in B. 1, Light-grown d3-100; 2, light-grown wild type (d3-100); 3, dark-grown wild type (d3-100); 4, dark-grown d3-100; 5, dark-grown wild type (cks1); 6, dark-grown cks1; 7, light-grown wild type (cks1); 8, light-grown cks1. D, Severe curled mesocotyl phenotype in 3-week-old cks1 seedling. E, Graph representing auxin transport in wild-type and cks1 mutant siblings. Eight mesocotyls of each genotype were incubated in tritiated indole acetic acid, four in an inverted orientation, and four in the correct orientation. Counts present in the upper 2 mm of each segment determined whether auxin had been transported in a basipetal (inverted) or acropetal (correct) direction. Bars = SEs.

 
A consistent feature of severe cks1 mutants is that the mesocotyl curls and exhibits a disorganized, often agravitropic growth habit (Fig. 7D). Since the role of the maize mesocotyl is to propel the shoot out of the soil, mesocotyls must respond to environmental signals such as gravity and light to orient the direction of shoot growth. cks1 mesocotyls are not structurally defective (data not shown), suggesting that the curling phenotype is caused by a failure to perceive or respond to these environmental signals. Notably, PAT is essential for gravitropic movement of both roots and shoots of Arabidopsis (Bennett et al., 1996Go; Luschnig et al., 1998Go; Marchant et al., 1999Go; Harper et al., 2000Go). Furthermore, defective PAT is associated with reduced cell elongation and division (Fig. 1C), perturbed vascular development (Fig. 3), and delayed root growth (Fig. 7C), all features of cks1 mutants. To assess whether PAT is disrupted in cks1 mutants, transport rates were determined in wild-type and mutant mesocotyls. Figure 7E demonstrates that basipetal auxin transport occurs normally in cks1 mutant mesocotyls. Therefore, if auxin homeostasis is perturbed in cks1 mutants, it is as a consequence of localized PAT defects or of impaired synthesis or sensitivity.


    DISCUSSION
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 
Recessive cks1 mutants phenocopy some of the characteristics displayed by gain-of-function Knox mutants. In particular, domain specification is perturbed in the proximodistal and mediolateral axes of the leaf. That is, the sheath blade boundary is shifted distally (Fig. 2) and the midrib is duplicated (Fig. 3). Prior to this study, recessive mutations that presented this phenotype were split into two classes. The first class comprises mutations in genes such as rs2 that act at a transcriptional level to repress knox gene activity in the leaf (Schneeberger et al., 1998Go; Timmermans et al., 1999Go; Tsiantis et al., 1999bGo; Byrne et al., 2000Go). Mutant phenotypes are therefore correlated with the accumulation of KNOX proteins in leaf tissue. Superficially, cks1 mutants fall into this group. However, our data show that, although knox transcripts accumulate in cks1 mutant leaves (Fig. 5), KNOX protein does not (Fig. 6). The second class results from mutations in genes that are involved in chromatin remodeling and/or post-transcriptional gene silencing. These mutants do not themselves exhibit ectopic knox gene expression in the leaf but enhance the phenotype of mutants that do (Ogas et al., 1999Go; Ori et al., 2000Go; Prigge and Wagner, 2001Go; Waites and Hudson, 2001Go; Osmont et al., 2003Go). As the cks1 mutation leads to ectopic knox gene expression (albeit in the absence of corresponding protein accumulation), but does not enhance the phenotype of rs2-R mutants (data not shown), it is unlikely that CKS1 has a similar epigenetic function. Therefore, we propose that the cks1 mutation defines a novel class of mutants that perturb domain specification in the leaf.

The cks1 mutant phenotype is pleiotropic and varies in expressivity; however, all mutants are severely dwarfed (Fig. 1). In field conditions, mutants are rarely more than 15 cm tall when wild-type siblings are at least 1.5 m and flowering. In comparison, rs2-R mutants reach approximately 60 cm at flowering (data not shown). Defects in GA, brassinosteroid (BR), and auxin signaling all lead to reduced internode elongation in a number of plant species (for review, see Clouse and Sasse, 1998Go; Friml and Palme, 2002Go; Olszewski et al., 2002Go). Notably, externally applied GA3 does not restore height to cks1 mutants (Fig. 7A), suggesting that GA biosynthesis is not perturbed by the mutation. Furthermore, internode elongation is equivalent in dark- and light-grown d3-100 mutants, whereas internode elongation is significantly greater in dark-grown cks1 mutants as compared to light-grown mutant siblings (Fig. 7B). Thus, GA is required for internode elongation during etiolation in maize and the cks1 mutation does not significantly impair this process. The GA pathway is therefore unlikely to be a primary target of CKS1 function. Similarly, because the cks1 mutant phenotype is much more pleiotropic than that exhibited by BR-deficient maize plants (Tao et al., 2004Go), the BR pathway is also an unlikely target. In the case of auxin, we have shown that PAT is not impaired in cks1 mutant mesocotyls (Fig. 7E). Therefore, although perturbed auxin homeostasis may emerge as the cause of dwarfing in cks1 mutants, any such perturbations are genetically separable from those measured here.

The phyllotactic defects observed in cks1 mutants (Fig. 4, A–D and F) suggest that CKS1 functions within the SAM to regulate patterns of leaf initiation. Notably, cks1 mutants exhibit very similar phyllotactic defects to maize abphyl1 (abph1) mutants (Jackson and Hake, 1999Go). The abph1 gene encodes a cytokinin-inducible response regulator homolog that is proposed to negatively regulate cytokinin-induced expansion of the shoot meristem (Giulini et al., 2004Go). As localized auxin maxima are required for leaf initiation (Reinhardt et al., 2000Go, 2003bGo), ABPH1 may establish the spatial domain within which auxin is transported and hence regulate the position of auxin maxima. It is therefore conceivable that CKS1 acts in the ABPH1 pathway either to mediate cytokinin control over meristem size or to facilitate appropriate auxin responses at leaf initiation sites.

If CKS1 functions to regulate leaf initiation patterns in the SAM (either directly or indirectly), it is not immediately apparent why loss of function would perturb domain specification within the developing leaf. However, disrupted phyllotaxy could facilitate fusion of leaf primordia and hence midrib duplication (Figs. 3 and 4E). Furthermore, if loss of cks1 function prevented the accurate demarcation of zones in the meristem such that the boundary between meristem and leaf primordia was indistinct, leaves could acquire aspects of indeterminate growth. This would result in perturbed blade-sheath boundary specification and reduced GA signaling within the leaf (and hence reduced macrohair formation). Within the cks1 meristem, blurred boundaries between primordia and the peripheral zone would also compromise the balance of cells between the peripheral zone and the central zone. Such perturbations have previously been shown to result in meristem bifurcation (Reinhardt et al., 2003aGo) as seen in cks1 mutants (Fig. 4, H and I). In combination, these observations suggest that CKS1 is required for boundary specification within the maize SAM.

An intriguing aspect of the cks1 phenotype is that knox transcripts accumulate in mutant leaves, but KNOX proteins cannot be detected (Figs. 5 and 6). This observation provides further evidence that the exclusion of KNOX activity from leaf primordia is regulated at multiple levels and indicates that the blurring of the meristem/leaf boundary in cks mutant apices deregulates transcriptional, but not translational, control. Despite the absence of ectopic KNOX activity, however, cks1 mutants phenocopy dominant Knox mutants. This suggests either that recessive cks and dominant Knox mutations disrupt independent pathways that coincidentally lead to similar phenotypic effects or that both mutations impact the same downstream pathways. Preliminary experiments suggest that combinations of cks1 and gain-of-function Knox mutations give rise to additive double-mutant phenotypes (data not shown). We therefore propose that shared downstream pathways are more likely. Further characterization of the cks1 mutant and cloning of the cks1 gene should provide insight into the complex interrelationships involved in maize shoot development.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 

Maize Stocks and Growth Conditions

The cks1 mutant was isolated in a transposon mutagenesis experiment that used Spm as the mutagen. In maize (Zea mays) M2 populations, plants segregated 3:1 wild type to mutant, indicating that the cks1 mutant is recessive. The rs2-R allele was obtained from M. Freeling (University of California, Berkeley, CA) after introgression into the inbred line B73. Plants carrying the Sn allele were a gift from M. Moreno (Yale University, New Haven, CT) and sem1 mutant lines were a gift from M. Scanlon (University of Georgia, Athens, GA). Complementation tests between cks1 and sem1, and between cks1 and rs2-R, were performed by intercrossing heterozygotes and screening the F1 progeny for mutant plants. All F1 individuals were wild type. To confirm the complementation results and to generate double mutants, F1 individuals were self-pollinated. Both single and double mutants segregated as expected in the resulting F2 progeny. Sn;cks1 double mutants were obtained in a similar manner. Recessive d3-100 mutants were isolated in a Spm mutagenesis experiment. Alleleism with d3 was shown by intercrossing heterozygous d3-100 plants with a heterozygous d3 stock obtained from the Maize Genetics Stock Centre. One-fourth of the progeny were dwarfed, demonstrating allelism. Plants were grown either in the field at Ithaca, New York, or in a greenhouse at 28°C with a 16-h-high-light (400 µE m–2 s–1)/8-h-dark cycle.


Phenotypic Analysis

cks1 mutant plants chosen for phenotypic analysis were randomly sampled from 10 segregating F3 families. Unless otherwise stated, photographs were taken of plants that represented the most common phenotype observed. Internode and leaf measurements were taken from at least 20 wild-type and cks1 mutant plants. Internode length was measured from node to node. Blade and sheath lengths were measured along the midrib from the ligule to the tip/base of the leaf. Widths were measured at the midpoint of each length.

To measure epidermal cell lengths, nail varnish impressions were taken from internode 9 and the adaxial surface of leaf three from 10 wild-type and cks1 plants. Impressions were taken from halfway along the internode and from a point midway between the midrib and margin halfway along the leaf blade or sheath. Impressions were placed on a microscope slide, covered with a coverslip, and viewed at 400x magnification under a Leica (Wetzlar, Germany) DMRB light microscope. Each impression was photographed using a Nikon (Tokyo) Coolpix 990 digital camera. The images were calibrated and National Institutes of Health (NIH) image software (Bethesda, MD) was used to measure the dimensions of 30 cells per impression.

To visualize leaf vasculature, leaves were cleared by boiling in 85% ethanol for 10 min followed by incubation in lactic acid for 3 h at 70°C. Cleared leaves were stained with Safranin-O (0.5% in 50% ethanol) for 5 min. Stained leaves were examined and photographed under a dissecting microscope (Nikon SMZ800).


knox Gene Transcript Analysis

Wild-type, cks1, and rs2-R mutant plants were grown for 3 weeks, and then RNA was prepared from either shoot apices or from the base of immature leaf primordia (P2–P7). For each RNA extraction, tissue samples were pooled from five individual plants. RT-PCR analyses were performed as described previously (Schneeberger et al., 1998Go). Gene-specific gn1 primers, GN120, GCGAGCTTTATTTTCAGGCCCC, and RS1B2, ACTCCATGGCCTCGTCGATCGG, were a generous gift from S. Hake (U.S. Department of Agriculture, Albany, CA).


Immunohistochemistry

Immunolocalizations were carried out as previously described (Schneeberger et al., 1998Go). Two batches of anti-KN1 antibody were used. The first was a gift from S. Hake (U.S. Department of Agriculture). The second was raised in rabbits against the previously reported KN1 fusion protein pBVKN1 (Smith et al., 1992Go). Antiserum was fractionated with protein A Sepharose and then affinity purified against the fusion protein after immobilization of the protein on cyanogen bromide-activated Sepharose (Harlow and Lane, 1988Go). Anti-RS1 antibody was a gift from M. Scanlon (University of Georgia).


PAT Assays

PAT assays were carried out as previously described (Tsiantis et al., 1999aGo) with the following modifications. Assays were performed on 1.3-cm mesocotyl segments of 2-week-old, dark-grown cks1 and wild-type siblings using 60 µL of 0.5x Murashige and Skoog medium containing 12.5 µCi of tritiated indole acetic acid [3H] (American Radiolabeled Chemicals, St. Louis). Segments were incubated for 7 h and then the upper 2 mm of tissue were removed. The diameter of the excised tissue was measured and the tissue volume calculated. Samples were counted in a multipurpose scintillation counter (LS6500; Beckman Instruments, Fullerton, CA).

Upon request, all novel materials described in this publication will be made available in a timely manner for noncommercial research purposes, subject to the requisite permission from any third-party owners of all or parts of the material. Obtaining any permissions will be the responsibility of the requester.


    ACKNOWLEDGMENTS
 
We thank other members of the Langdale lab and Miltos Tsiantis for numerous helpful discussions throughout the course of this work. We are grateful to Tom Brutnell (Boyce Thompson Institute, Ithaca, NY) for facilitating fieldwork, Sarah Hake and Mike Scanlon for providing antibodies, Daphne Stork for technical support, and John Baker for photography. The comments of Miltos Tsiantis and Angela Hay were much appreciated during the preparation of this manuscript.

Received April 13, 2005; returned for revision April 13, 2005; accepted April 22, 2005.


    FOOTNOTES
 
1 This work was supported by grants from the Biotechnology and Biological Sciences Research Council (BBSRC) and the Gatsby Charitable Foundation (to J.A.L.), by a Sainsbury Ph.D. studentship (to D.L.A.), and by a BBSRC Ph.D. studentship (to E.A.M.). Back

2 Present address: Carnegie Institution of Washington, Department of Plant Biology, 260 Panama Street, Stanford, CA 94305. Back

Article, publication date, and citation information can be found at www.plantphysiol.org/cgi/doi/10.1104/pp.105.063909.

* Corresponding author; e-mail jane.langdale{at}plants.ox.ac.uk; fax 44–1865–275147.


    LITERATURE CITED
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 
Avivi Y, Lev-Yadun S, Morozova N, Libs L, Williams L, Zhao J, Varghese G, Grafi G (2000) Clausa, a tomato mutant with a wide range of phenotypic perturbations, displays a cell type-dependent expression of the homeobox gene LeT6/TKn2. Plant Physiol 124: 541–552[Abstract/Free Full Text]

Bennett MJ, Marchant A, Green HG, May ST, Ward SP, Millner PA, Walker AR, Schulz B, Feldmann KA (1996) Arabidopsis AUX1 gene: a permease-like regulator of root gravitropism. Science 273: 948–950[Abstract]

Byrne ME, Barley R, Curtis M, Arroyo JM, Dunham M, Hudson A, Martienssen RA (2000) ASYMMETRIC LEAVES1 mediates leaf patterning and stem cell function in Arabidopsis. Nature 408: 967–971[CrossRef][Medline]

Clouse SD, Sasse JM (1998) BRASSINOSTEROIDS: essential regulators of plant growth and development. Annu Rev Plant Physiol Plant Mol Biol 49: 427–451[CrossRef][ISI][Medline]

Esau K (1965) Plant Anatomy, Ed 2. John Wiley and Sons, New York

Estruch JJ, Prinsen E, van Onckelen H, Schell J, Spena A (1991) Viviparous leaves produced by somatic activation of an inactive cytokinin-synthesizing gene. Science 254: 1364–1367[Abstract/Free Full Text]

Foster T, Yamaguchi J, Wong BC, Veit B, Hake S (1999) Gnarley1 is a dominant mutation in the knox4 homeobox gene affecting cell shape and identity. Plant Cell 11: 1239–1252[Abstract/Free Full Text]

Freeling M (1992) A conceptual framework for maize leaf development. Dev Biol 153: 44–58[CrossRef][ISI][Medline]

Friml J, Palme K (2002) Polar auxin transport—old questions and new concepts? Plant Mol Biol 49: 273–284[CrossRef][ISI][Medline]

Giulini A, Wang J, Jackson D (2004) Control of phyllotaxy by the cytokinin-inducible response regulator homologue ABPHYL1. Nature 430: 1031–1034[CrossRef][Medline]

Ha CM, Kim GT, Kim BC, Jun JH, Soh MS, Ueno Y, Machida Y, Tsukaya H, Nam HG (2003) The BLADE-ON-PETIOLE 1 gene controls leaf pattern formation through the modulation of meristematic activity in Arabidopsis. Development 130: 161–172[Abstract/Free Full Text]

Hareven D, Gutfinger T, Parnis A, Eshed Y, Lifschitz E (1996) The making of a compound leaf: genetic manipulation of leaf architecture in tomato. Cell 84: 735–744[CrossRef][ISI][Medline]

Harlow E, Lane D (1988) Antibodies: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY

Harper RM, Stowe-Evans EL, Luesse DR, Muto H, Tatematsu K, Watahiki MK, Yamamoto K, Liscum E (2000) The NPH4 locus encodes the auxin response factor ARF7, a conditional regulator of differential growth in aerial Arabidopsis tissue. Plant Cell 12: 757–770[Abstract/Free Full Text]

Harrison CJ, Corley SB, Moylan EC, Alexander DL, Scotland RW, Langdale JA (2005) Independent recruitment of a conserved developmental mechanism during leaf evolution. Nature 434: 509–514[CrossRef][Medline]

Hay A, Kaur H, Phillips A, Hedden P, Hake S, Tsiantis M (2002) The gibberellin pathway mediates KNOTTED1-type homeobox function in plants with different body plans. Curr Biol 12: 1557–1565[CrossRef][ISI][Medline]

Iwakawa H, Ueno Y, Semiarti E, Onouchi H, Kojima S, Tsukaya H, Hasebe M, Soma T, Ikezaki M, Machida C, et al (2002) The ASYMMETRIC LEAVES2 gene of Arabidopsis thaliana, required for formation of a symmetric flat leaf lamina, encodes a member of a novel family of proteins characterized by cysteine repeats and a leucine zipper. Plant Cell Physiol 43: 467–478[Abstract/Free Full Text]

Jackson D, Hake S (1999) Control of phyllotaxy in maize by the abphyl1 gene. Development 126: 315–323[Abstract]

Jackson D, Veit B, Hake S (1994) Expression of maize Knotted1 related homeobox genes in the shoot apical meristem predicts patterns of morphogenesis in the vegetative shoot. Development 120: 404–413

Kumaran MK, Bowman JL, Sundaresan V (2002) YABBY polarity genes mediate the repression of KNOX homeobox genes in Arabidopsis. Plant Cell 14: 2761–2770[Abstract/Free Full Text]

Kusaba S, Kano-Murakami Y, Matsuoka M, Tamaoki M, Sakamoto T, Yamaguchi I, Fukumoto M (1998) Alteration of hormone levels in transgenic tobacco plants overexpressing the rice homeobox gene OSH1. Plant Physiol 116: 471–476[Abstract/Free Full Text]

Leyser HMO, Day S (2002) Mechanisms in Plant Development. Blackwell Science, Ltd., Oxford

Lin WC, Shuai B, Springer PS (2003) The Arabidopsis LATERAL ORGAN BOUNDARIES-domain gene ASYMMETRIC LEAVES2 functions in the repression of KNOX gene expression and in adaxial-abaxial patterning. Plant Cell 15: 2241–2252[Abstract/Free Full Text]

Lincoln C, Long J, Yamaguchi J, Serikawa K, Hake S (1994) A knotted1-like homeobox gene in Arabidopsis is expressed in the vegetative meristem and dramatically alters leaf morphology when overexpressed in transgenic plants. Plant Cell 6: 1859–1876[Abstract/Free Full Text]

Long JA, Moan EI, Medford JI, Barton MK (1996) A member of the knotted class of homeodomain proteins encoded by the STM gene of Arabidopsis. Nature 379: 66–69[CrossRef][Medline]

Luschnig C, Gaxiola RA, Grisafi P, Fink GR (1998) EIR1, a root-specific protein involved in auxin transport, is required for gravitropism in Arabidopsis thaliana. Genes Dev 12: 2175–2187[Abstract/Free Full Text]

Marchant A, Kargul J, May ST, Muller P, Delbarre A, Perrot-Rechenmann C, Bennett M (1999) AUX1 regulates root gravitropism in Arabidopsis by facilitating auxin uptake within root apical tissues. EMBO J 18: 2066–2073[CrossRef][ISI][Medline]

Marx GA (1987) A suite of mutants that modify pattern formation in pea leaves. Plant Mol Biol Rep 5: 311–335[CrossRef]

Matsuoka M, Ichikawa H, Saito A, Tada Y, Fujimura T, Kano-Murakami Y (1993) Expression of a rice homeobox gene causes altered morphology of transgenic plants. Plant Cell 5: 1039–1048[Abstract/Free Full Text]

McHale NA, Koning RE (2004) PHANTASTICA regulates development of the adaxial mesophyll in Nicotiana leaves. Plant Cell 16: 1251–1262[Abstract/Free Full Text]

Moose SP, Lauter N, Carlson SR (2004) The maize macrohairless1 locus specifically promotes leaf blade macrohair initiation and responds to factors regulating leaf identity. Genetics 166: 1451–1461[Abstract/Free Full Text]

Muehlebauer GJ, Fowler JE, Girard L, Tyers R, Harper L, Freeling M (1999) Ectopic expression of the maize homeobox gene liguleless3 alters cell fates in the leaf. Plant Physiol 119: 651–662[Abstract/Free Full Text]

Nagasaki H, Sakamoto T, Sato Y, Matsuoka M (2001) Functional analysis of the conserved domains of a rice knox homeodomain protein, osh15. Plant Cell 13: 2085–2098[Abstract/Free Full Text]

Ogas J, Kaufmann S, Henderson J, Somerville C (1999) PICKLE is a CHD3 chromatin-remodeling factor that regulates the transition from embryonic to vegetative development in Arabidopsis. Proc Natl Acad Sci USA 96: 13839–13844[Abstract/Free Full Text]

Olszewski N, Sun TP, Gubler F (2002) Gibberellin signaling: biosynthesis, catabolism, and response pathways. Plant Cell 14: S61–S80[Free Full Text]

Ori N, Eshed Y, Chuck G, Bowman JL, Hake S (2000) Mechanisms that control knox gene expression in the Arabidopsis shoot. Development 127: 5523–5532[Abstract]

Ori N, Juarez MT, Jackson D, Yamaguchi J, Banowetz GM, Hake S (1999) Leaf senescence is delayed in tobacco plants expressing the maize homeobox gene knotted1 under the control of a senescence activated promoter. Plant Cell 11: 1073–1080[Abstract/Free Full Text]

Osmont KS, Jesaitis LA, Freeling M (2003) The extended auricle1 (eta1) gene is essential for the genetic network controlling postinitiation maize leaf development. Genetics 165: 1507–1519[Abstract/Free Full Text]

Parnis A, Cohen O, Gutfinger T, Haraven D, Zamir D, Lifschitz E (1997) The dominant developmental mutants of tomato, Mouse-ear and Curl are associated with distinct modes of abnormal transcriptional regulation of a Knotted gene. Plant Cell 9: 2143–2158[Abstract]

Pilkington M (1929) The regeneration of the stem apex. New Phytol 28: 37–53[CrossRef]

Prigge MJ, Wagner DR (2001) The Arabidopsis SERRATE gene encodes a zinc-finger protein required for normal shoot development. Plant Cell 13: 1263–1280[Abstract/Free Full Text]

Reinhardt D, Frenz M, Mandel T, Kuhlemeier C (2003a) Microsurgical and laser ablation analysis of interactions between the zones and layers of the tomato shoot apical meristem. Development 130: 4073–4083[Abstract/Free Full Text]

Reinhardt D, Mandel T, Kuhlemeier C (2000) Auxin regulates the initiation and radial position of plant lateral organs. Plant Cell 12: 507–518[Abstract/Free Full Text]

Reinhardt D, Pesce ER, Stieger P, Mandel T, Baltensperger K, Bennett M, Traas J, Friml J, Kuhlemeier C (2003b) Regulation of phyllotaxis by polar auxin transport. Nature 426: 255–260[CrossRef][Medline]

Rosin FM, Hart JK, Horner HT, Davies PJ, Hannapel DJ (2003) Overexpression of a knotted-like homeobox gene of potato alters vegetative development by decreasing gibberellin accumulation. Plant Physiol 132: 106–117[Abstract/Free Full Text]

Sakamoto T, Kamiya N, Ueguchi-Tanaka M, Iwahori S, Matsuoka M (2001) KNOX homeodomain protein directly suppresses the expression of a gibberellin biosynthetic gene in the tobacco shoot apical meristem. Genes Dev 15: 581–590[Abstract/Free Full Text]

Scanlon MJ (2003) The polar auxin transport inhibitor N-1-naphthylphthalamic acid disrupts leaf initiation, KNOX protein regulation, and formation of leaf margins in maize. Plant Physiol 133: 597–605[Abstract/Free Full Text]

Scanlon MJ, Henderson DC, Bernstein B (2002) SEMAPHORE1 functions during the regulation of ancestrally duplicated knox genes and polar auxin transport in maize. Development 129: 2663–2673[Abstract/Free Full Text]

Schneeberger R, Tsiantis M, Freeling M, Langdale JA (1998) The rough sheath2 gene negatively regulates homeobox gene expression during maize leaf development. Development 125: 2857–2865[Abstract]

Schneeberger RG, Becraft PW, Hake S, Freeling M (1995) Ectopic expression of the knox homeobox gene rough sheath1 alters cell fate in maize leaf. Genes Dev 9: 2292–2304[Abstract/Free Full Text]

Semiarti E, Ueno Y, Tsukaya H, Iwakawa H, Machida C, Machida Y (2001) The ASYMMETRIC LEAVES2 gene of Arabidopsis thaliana regulates formation of a symmetric lamina, establishment of venation and repression of meristem-related homeobox genes in leaves. Development 128: 1771–1783[Abstract]

Sinha NR, Williams RE, Hake S (1993) Overexpression of the maize homeobox gene, Knotted-1, causes a switch from determinate to indeterminate cell fates. Genes Dev 7: 787–795[Abstract/Free Full Text]

Smith LG, Greene B, Veit B, Hake S (1992) A dominant mutation in the maize homeobox gene, Knotted-1, causes its ectopic expression in leaf cells with altered fates. Development 116: 21–30[Abstract]

Steeves TA, Sussex IM (1989) Patterns in Plant Development. Cambridge University Press, Cambridge, UK

Tao Y, Zheng J, Xu Z, Zhang X, Zhang K, Wang G (2004) Functional analysis of ZmDWF1, a maize homolog of the Arabidopsis brassinosteroids biosynthetic DWF1/DIM gene. Plant Sci 167: 743–751

Theodoris G, Inada N, Freeling M (2003) Conservation and molecular dissection of ROUGH SHEATH2 and ASYMMETRIC LEAVES1 function in leaf development. Proc Natl Acad Sci USA 100: 6837–6842[Abstract/Free Full Text]

Timmermans MCP, Hudson A, Becraft PW, Nelson T (1999) ROUGH SHEATH2: a myb protein that represses knox homeobox genes in maize lateral organ primordia. Science 284: 151–153[Abstract/Free Full Text]

Tsiantis M (2001) Control of shoot cell fate: beyond homeoboxes. Plant Cell 13: 733–738[Free Full Text]

Tsiantis M, Brown MI, Skibinski G, Langdale JA (1999a) Disruption of auxin transport is associated with aberrant leaf development in maize. Plant Physiol 121: 1163–1168[Abstract/Free Full Text]

Tsiantis M, Hay A (2003) Comparative plant development: the time of the leaf? Nat Rev Genet 4: 169–180[ISI][Medline]

Tsiantis M, Schneeberger R, Golz JF, Freeling M, Langdale JA (1999b) The maize rough sheath2 gene and leaf development programs in monocot and dicot plants. Science 284: 154–156[Abstract/Free Full Text]

Vollbrecht E, Veit B, Sinha N, Hake S (1991) The developmental gene Knotted-1 is a member of a maize homeobox gene family. Nature 350: 241–243[CrossRef][Medline]

Waites R, Hudson A (2001) The Handlebars gene is required with Phantastica for dorsoventral asymmetry of organs and for stem cell activity in Antirrhinum. Development 128: 1923–1931[Abstract/Free Full Text]

Waites R, Selvadurai HRN, Oliver IR, Hudson A (1998) The PHANTASTICA gene encodes a myb transcription factor involved in growth and dorosventrality of lateral organs in Antirrhinum. Cell 93: 779–789[CrossRef][ISI][Medline]

Winkler RG, Helentjaris T (1995) The maize dwarf3 gene encodes a cytochrome P450-mediated early step in gibberellin biosynthesis. Plant Cell 7: 1307–1317[Abstract]

Xu L, Xu Y, Dong A, Sun Y, Pi L, Huang H (2003) Novel as1 and as2 defects in leaf adaxial-abaxial polarity reveal the requirement for ASYMMETRIC LEAVES1 and 2 and ERECTA functions in specifying leaf adaxial identity. Development 130: 4097–4107[Abstract/Free Full Text]