Plant Physiol. Drug Metab Dispos
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

First published online June 3, 2005; 10.1104/pp.105.059246

Plant Physiology 138:1481-1490 (2005)
© 2005 American Society of Plant Biologists

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
138/3/1481    most recent
pp.105.059246v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (4)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Block, A.
Right arrow Articles by Klee, H. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Block, A.
Right arrow Articles by Klee, H. J.
Agricola
Right arrow Articles by Block, A.
Right arrow Articles by Klee, H. J.
PLANTS INTERACTING WITH OTHER ORGANISMS

Systemic Acquired Tolerance to Virulent Bacterial Pathogens in Tomato1

Anna Block, Eric Schmelz, Phillip J. O'Donnell2, Jeffrey B. Jones and Harry J. Klee*

Horticultural Sciences Department (A.B., P.J.O., H.J.K.) and Plant Pathology Department (J.B.J.), University of Florida, Gainesville, Florida 32611; and United States Department of Agriculture Agricultural Research Service, Center for Medical Agricultural and Veterinary Entomology, Gainesville, Florida 32608 (E.S.)


   ABSTRACT
TOP
 ABSTRACT
RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 
Recent studies on the interactions between plants and pathogenic microorganisms indicate that the processes of disease symptom development and pathogen growth can be uncoupled. Thus, in many instances, the symptoms associated with disease represent an active host response to the presence of a pathogen. These host responses are frequently mediated by phytohormones. For example, ethylene and salicylic acid (SA) mediate symptom development but do not influence bacterial growth in the interaction between tomato (Lycopersicon esculentum) and virulent Xanthomonas campestris pv vesicatoria (Xcv). It is not apparent why extensive tissue death is integral to a defense response if it does not have the effect of limiting pathogen proliferation. One possible function for this hormone-mediated response is to induce a systemic defense response. We therefore assessed the systemic responses of tomato to Xcv. SA- and ethylene-deficient transgenic lines were used to investigate the roles of these phytohormones in systemic signaling. Virulent and avirulent Xcv did induce a systemic response as evidenced by expression of defense-associated pathogenesis-related genes in an ethylene- and SA-dependent manner. This systemic response reduced cell death but not bacterial growth during subsequent challenge with virulent Xcv. This systemic acquired tolerance (SAT) consists of reduced tissue damage in response to secondary challenge with a virulent pathogen with no effect upon pathogen growth. SAT was associated with a rapid ethylene and pathogenesis-related gene induction upon challenge. SAT was also induced by infection with Pseudomonas syringae pv tomato. These data show that SAT resembles systemic acquired resistance without inhibition of pathogen growth.

Multiple phytohormones are critical components of both local and systemic responses of a plant to pathogen invasion (Kunkel and Brooks, 2002Go). For instance, ethylene is necessary for resistance to certain fungal pathogens (Knoester et al., 1998Go, 1999Go) while salicylic acid (SA) is necessary for both resistance to some avirulent pathogens and generation of systemic acquired resistance (SAR; Gaffney et al., 1993Go). Mutants and transgenic plants compromised in phytohormone synthesis or perception have been important tools to demonstrate roles for ethylene, SA, and jasmonates in disease symptom development. For example, the ethylene-insensitive ein2 mutant of Arabidopsis (Arabidopsis thaliana) has decreased symptom development in response to several virulent bacterial pathogens (Bent et al., 1992Go). Similarly, ethylene- and SA-deficient tomato (Lycopersicon esculentum) lines have decreased symptom development in response to virulent Xanthomonas campestris pv vesicatoria (Xcv; Lund et al., 1998Go; O'Donnell et al., 2001Go). Thus, reduced symptoms without reduced pathogen growth, termed tolerance, indicates that phytohormone-mediated defenses can be uncoupled from pathogen growth.

Disease development in tomato infected with virulent Xcv can be defined as occurring in two stages: a primary phase and a secondary phase. Primary disease development consists of localized lesion formation and is unaltered in the tolerant lines. Secondary disease development requires the cooperative action of ethylene and SA and is reduced in tolerant lines. Secondary disease development includes the formation of chlorosis and necrosis that spread from primary lesions (O'Donnell et al., 2003Go).

Our interest is in determining why plants would produce ethylene and SA in response to pathogens when their action does not limit pathogen growth. If pathogen growth is not inhibited by the extensive necrosis associated with secondary disease development, what purpose does this ethylene- and SA-mediated response serve? One possible function of extensive tissue death is induction of systemic responses. Based on results in other organisms, tomato may require ethylene or SA for SAR. SAR is the sensitization of systemic defense responses initiated by infection with certain pathogens, leading to resistance to subsequent pathogen infections (Ryals et al., 1996Go). Many factors influence the induction of SAR, including host cell death associated with an incompatible or compatible interaction (Hunt and Ryals, 1996Go). SAR results in the development of a broad-spectrum, systemic resistance. However, it is not effective against, or induced by, all pathogens. For example, infection of Arabidopsis with Botrytis cinerea fails to induce SAR and inoculation with Pseudomonas syringae does not affect subsequent B. cinerea challenge (Govrin and Levine, 2002Go). Thus, while SAR can be induced in tomato by pathogens such as tobacco necrosis virus and Phytophthoria infestans, there is neither systemic SA accumulation upon inoculation nor SA accumulation upon subsequent challenge by these pathogens (Enkerli et al., 1993Go; Jeun et al., 2000Go). In Arabidopsis, the evidence supports a model in which ethylene and jasmonates coordinately mediate one defense response while SA mediates a distinct and antagonistic response (McDowell and Dangl, 2000Go). Our work demonstrating cooperative interactions between jasmonates, ethylene, and SA in the susceptible response of tomato to Xcv indicates that the functions of these hormones may be species specific (O'Donnell et al., 2003Go).

Here, we investigate if Xcv is capable of inducing a systemic response in tomato as well as possible roles of SA and ethylene in systemic signal generation. We demonstrate that inoculation with either virulent or avirulent Xcv leads to an SA- and ethylene-dependent induction of defense genes and sensitizes the plant to subsequent pathogen challenge. However, instead of inducing SAR, Xcv generates tolerance to subsequent challenge with virulent Xcv. We term this response systemic acquired tolerance (SAT) and define it as prior pathogen exposure reducing host tissue damage in response to virulent pathogen infection without impacting pathogen growth. We further demonstrate that SAT is not unique to Xcv and can also be induced by P. syringae pv tomato.


   RESULTS
TOP
 ABSTRACT
 RESULTS
DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 

Virulent and Avirulent Xcv Induce SAT in Tomato

To investigate systemic responses to Xcv, wild-type tomato plants at the three-leaf stage were mock inoculated, inoculated with virulent Xcv strain 93-1 or avirulent Xcv strain 87-7 (Bonas et al., 1993Go) on their lowest two leaves. The 87-7 strain contains the avirulence gene avrBs3-2 and is avirulent on all tomato varieties. The inoculations were then permitted to run their full course of approximately 14 d, at which point those leaves inoculated with virulent Xcv were fully necrotic and those inoculated with avirulent Xcv had developed lesions associated with the hypersensitive response (Fig. 1A).



View larger version (54K):
[in this window]
[in a new window]
  		Figure 1. Symptom development of Xcv-infected tomato. Disease symptoms at 16 dpi of wild-type tomato plants (A) inoculated with avirulent and virulent Xcv and (B) following challenge with virulent Xcv. These pictures are representative of at least two independent biological experiments.

 
To determine if this inoculation with Xcv affected responses to subsequent pathogen exposure, a challenge was performed with virulent Xcv on uninoculated systemic leaves. Prior inoculations with either virulent or avirulent Xcv, but not mock inoculations, reduced the necrosis resulting from the challenge (Fig. 1B). The primary symptoms such as lesion formation were unaffected and secondary symptom development such as chlorosis and some confluent necrosis were still apparent. The major difference between challenged and unchallenged plants was reduced necrosis in plants with prior Xcv inoculation. As the response consists of two independent interactions between two biological entities, a high degree of variation is to be expected. With this in mind the level of necrosis was determined in large population groups by measuring ion leakage in leaf five at 16 d after challenge (Fig. 2). Percent ion leakage, an indicator of cell death, was 2-fold higher upon challenge in plants previously mock inoculated than those with prior Xcv inoculations. Prior virulent or avirulent Xcv inoculations led to similar reductions in ion leakage upon challenge with virulent Xcv.



View larger version (13K):
[in this window]
[in a new window]
  		Figure 2. Cell death of tomato 16 d after challenge with virulent Xcv. Cell death was measured in the form of percent ion leakage in plants treated with a mock challenge or challenged with virulent Xcv. The plants were exposed to a mock inoculation or inoculation with virulent (vir) or avirulent (avr) Xcv prior to treatment. These data are representative of two independent biological experiments. Bars equal SE, n = 30.

 
The reduction of symptom development due to previous pathogen exposure is consistent with SAR generation. Bacterial growth measurements confirmed that UC82B is resistant to avirulent Xcv but not virulent Xcv, as growth of avirulent Xcv was 10-fold lower than that of virulent Xcv (Fig. 3A). This difference is due to a gene-for-gene interaction (Bonas et al., 1993Go) and is consistent with levels of growth reported previously (Ciardi et al., 2000Go). However, when bacterial populations in challenge infections were determined, there was no difference in growth caused by prior inoculation with either virulent or avirulent Xcv when compared to plants with prior mock inoculations (Fig. 3B). This result leads to the conclusion that both virulent and avirulent Xcv induced SAT rather than SAR, as they reduced symptom development but not bacterial growth during subsequent challenge with virulent Xcv. Note that there is an inherent age-dependent resistance in tomato with the first leaves supporting higher bacterial growth than later ones.



View larger version (18K):
[in this window]
[in a new window]
  		Figure 3. Bacterial growth during inoculation and challenge of tomato with Xcv. A, The growth of virulent (vir) and avirulent (avr) Xcv was measured during primary infections. B, A systemic challenge with virulent Xcv was then performed on these plants as well as mock-inoculated controls and the bacterial growth was measured. These data are representative of two independent biological experiments. Bars equal SE, n = 5.

 

Prior Inoculation with Xcv Leads to Early Production of Ethylene upon Challenge with Virulent Xcv

Ethylene and SA are involved in the development of systemic responses, including SAR and induced systemic resistance in Arabidopsis (Lawton et al., 1995Go; Knoester et al., 1999Go). In order to examine potential roles for these hormones in the systemic response of tomato to Xcv, levels of ethylene and SA were measured during inoculation and challenge with Xcv. Inoculation with virulent Xcv led to ethylene accumulation in local tissues at 5 d post infection (dpi), while avirulent Xcv caused a greater accumulation of ethylene at 2 dpi (Fig. 4A). Virulent Xcv induced SA accumulation at 10 dpi, while avirulent Xcv induced SA accumulation at 4 dpi, peaking at 10 dpi (Fig. 4B). The accumulation of ethylene and SA was later and at reduced magnitude in response to virulent Xcv than avirulent Xcv. No systemic accumulation of ethylene was observed in response to Xcv inoculations and at 16 dpi no systemic accumulation of SA was observed in plants inoculated with Xcv (data not shown).



View larger version (17K):
[in this window]
[in a new window]
  		Figure 4. Local ethylene and SA accumulation following inoculation and challenge of tomato with Xcv. Tomato plants were mock inoculated or inoculated with virulent (vir) or avirulent (avr) Xcv and (A) ethylene and (B) SA accumulation following inoculation were measured. Fourteen days later, a challenge with virulent Xcv was performed on uninfected leaves and (C) ethylene and (D) SA accumulation following challenge was measured. These data are representative of two independent biological experiments. Bars equal SE, n = 4.

 
Accumulation of ethylene and SA were also measured following challenge with virulent Xcv. Results indicated that ethylene accumulated earlier and to a greater extent upon challenge during SAT than in equivalent plants that were previously mock inoculated (Fig. 4, C and D). The ethylene accumulation in response to a challenge with virulent Xcv, following prior mock inoculation, reached its maximum at 10 dpi. However, plants with prior Xcv inoculations accumulated additional ethylene around 5 dpi when challenged (Fig. 4C). Although at a reduced magnitude, this accumulation resembles a response to avirulent Xcv. Challenge with virulent Xcv caused ethylene accumulation at 8 to 10 dpi in all plants, the magnitude of which was dependent on the prior inoculation. Plants with prior avirulent Xcv inoculation accumulated the most ethylene when challenged. This ethylene accumulation was lower in plants with prior virulent Xcv inoculations and lowest in the mock-inoculated controls. It can be concluded that challenged leaves from plants previously infected with either avirulent or virulent Xcv synthesized ethylene earlier and to a greater magnitude than those previously mock inoculated.

Plants with prior mock or virulent Xcv inoculations accumulated similar amounts of SA in response to challenge with virulent Xcv. However, reduced SA accumulation was observed in plants with a prior avirulent Xcv inoculation. These plants also produced an early SA peak (Fig. 4D) that resembled the response to avirulent Xcv although reduced in magnitude. Subsequent accumulation of SA was delayed and resembled that caused by virulent Xcv although at reduced magnitude. That there is no significant difference in SA accumulation between the prior mock and the prior virulent Xcv inoculation in the challenged leaves seems to rule out a role in SAT for SA synthesized in the systemic leaves.


Pathogenesis-Related Gene Expression Demonstrates the Necessity of Ethylene and SA in Systemic Signal Generation

As ethylene- or SA-deficient plants develop less secondary disease symptoms in response to virulent Xcv than plants displaying SAT, a direct approach to determining any roles for these phytohormones in SAT is difficult. Therefore, pathogenesis-related (PR) gene expression was used as a marker for defense responses in ethylene- and SA-deficient plants. Induction of PR genes is often used as an indicator of early defense responses. They show both local and systemic induction during SAR (Ward et al., 1991). To determine if ethylene and SA are involved in systemic signal transduction, two transgenic lines were used. Loss of ethylene was achieved with transgenic plants expressing 1-aminocyclopropane-1-carboxylic acid deaminase (ACD). These plants do not accumulate the ethylene precursor 1-aminocyclopropane-1-carboxylic acid and thus underproduce ethylene. The ACD line was compared to its isogenic parent UC82B. The role of SA was determined using transgenic tomato plants expressing the bacterial salicylate hydroxylase, nahG, which does not accumulate SA. The NahG line was compared to its isogenic parent MoneyMaker (MM).

PR1a and PR1b were induced in local and systemic tissues of tomato during infection with virulent Xcv (Fig. 5). PR1a expression was lower than PR1b. The local expression of both genes was induced in all lines in response to virulent Xcv. The level of local PR1a induction varied between different cultivars, with an earlier and greater induction in MM than UC82B. The local expression of PR1b was also higher in MM than UC82B, although the timing of induction was the same. When compared to their isogenic parents, infected ACD and NahG plants had reduced local expression of both genes. However, this reduction did not affect pathogen growth (O'Donnell et al., 2001Go).



View larger version (25K):
[in this window]
[in a new window]
  		Figure 5. Local and systemic PR gene induction in ethylene- and SA-deficient tomato lines in response to inoculation with virulent Xcv. Ethylene-deficient ACD, SA-deficient NahG, and their isogenic parents were inoculated with virulent Xcv. PR1a and PR1b expression levels were determined by real-time RT-PCR in local and systemic tissues. These data are representative of two independent biological experiments. Bars equal SE, n = 4.

 
Virulent Xcv induced systemic expression of both genes in MM and UC82B. In MM systemic induction of PR1a and PR1b occurred at the same time, whereas in UC82B the expression of PR1b was later than PR1a. ACD and NahG showed no systemic induction of PR gene expression in response to virulent Xcv. Disease symptoms in ACD and NahG are comparable to their isogenic parents up to 8 dpi (O'Donnell et al., 2001Go). As there is no widespread necrosis before 8 dpi, the lack of systemic PR gene expression must be related to loss of ethylene or SA accumulation rather than to the loss of widespread necrosis in these lines. The lack of systemic PR gene induction indicates that ethylene- and SA-deficient lines may be compromised in their systemic signal transduction. However, the tolerant phenotype of these lines makes direct investigation difficult.


Greater PR Gene Expression Was Induced by Avirulent Than Virulent Xcv

The accumulation of ethylene and SA is more rapid in response to avirulent than virulent Xcv, yet the resulting systemic response to these two pathogens is the same. To determine if the early defense responses follow this trend, induction of PR gene expression by avirulent and virulent Xcv inoculations was assayed. Avirulent Xcv induced higher and earlier local expression of PR genes than virulent Xcv (Fig. 6). The timing of systemic PR1b induction was similar in response to each pathogen, but systemic PR1a induction was faster in response to avirulent Xcv. Faster and stronger local PR gene response to avirulent than virulent Xcv may be an indication of increased defense responses that limit pathogen growth.



View larger version (17K):
[in this window]
[in a new window]
  		Figure 6. Local and systemic PR gene expression during inoculations with virulent or avirulent Xcv. Wild-type (UC82B) plants were mock inoculated or inoculated with virulent (vir) or avirulent (avr) Xcv and the local and systemic expression of PR1a and PR1b was determined by real-time RT-PCR. These data are representative of two independent biological experiments. Bars equal SE, n = 4.

 
Prior avirulent and virulent Xcv inoculations produced similar inductions of ethylene and reductions in symptom development during challenge. The two prior Xcv inoculations induced similar PR gene expression upon challenge. Both caused an early peak of PR gene expression at 1 dpi upon challenge that was absent in plants with prior mock inoculation (Fig. 7). These results led to the hypothesis that inoculation with Xcv sensitized systemic defenses and caused their faster induction upon challenge, leading to tolerance. Sensitization or priming to the presence of pathogens is also observed in the generation of SAR (Conrath et al., 2002Go), therefore SAT may use similar mechanisms to SAR.



View larger version (23K):
[in this window]
[in a new window]
  		Figure 7. Induction of PR genes during challenge with virulent Xcv in the presence or absence of SAT. Wild-type plants were mock inoculated or inoculated with virulent (vir) or avirulent (avr) Xcv. Fourteen days later, a challenge was performed with virulent Xcv. The expression of PR1a and PR1b was determined with real-time RT-PCR following challenge. These data are representative of two independent biological experiments. Bars equal SE, n = 4.

 

SAT Is Induced by Both Xcv and P. syringae pv tomato DC3000

We have demonstrated that infection with either virulent or avirulent Xcv leads to the production of tolerance to subsequent infections with virulent Xcv. It may be that SAT is due to an inability of tomato to induce resistance to virulent Xcv. To test this hypothesis, tomato plants were treated with the SAR inducer Actigard at 10 and 4 d prior to challenge with virulent Xcv. Ion leakage and bacterial population measurement following challenge with virulent Xcv (Fig. 8, A and C) demonstrated that treatment with Actigard reduced Xcv growth and tissue damage following challenge. These data demonstrate that tomato can be induced to mount systemic resistance to Xcv. However, under normal circumstances SAT is the default response to Xcv.



View larger version (11K):
[in this window]
[in a new window]
  		Figure 8. SAT induction by Xcv and Pst. Wild-type plants were mock inoculated, treated with the SAR inducer Actigard, or inoculated with virulent Xcv or Pst. Fourteen days later, a challenge was performed with virulent Xcv or Pst. Populations of (A) Xcv and (B) Pst were determined at 5 d after challenge. Bars equal SE, n = 5. Percent ion leakage was determined 16 d after challenge in plants challenged with (C) Xcv or (D) Pst. Bars equal SE, n = 30. Each experiment was repeated at least twice.

 
To assess if SAT is a specific response to Xcv, we tested the ability of virulent Xcv to induce tolerance to subsequent challenge with the virulent bacterial pathogen P. syringae pv tomato DC3000 (Pst). We first confirmed that tomato was capable of inducing resistance to Pst. This was accomplished by treatment with Actigard at 10 and 4 d prior to challenge. Ion leakage and bacterial growth were measured following challenge with Pst (Fig. 8, B and D). Both tissue damage and bacterial growth were reduced compared to mock-treated controls, demonstrating that tomato can induce resistance to Pst. Ion leakage and bacterial growth were then measured following challenge with Pst in plants with prior exposure to virulent Xcv (Fig. 8, B and D). These data show that there is no significant difference in tissue damage or bacterial growth following challenge with Pst between plants with prior mock inoculations and prior inoculation with virulent Xcv. Therefore, virulent Xcv does not induce tolerance to Pst.

We then examined if Pst can itself induce SAT. Mock-inoculated and Pst-inoculated plants were challenged with either virulent Xcv or Pst. Ion leakage and bacterial populations following challenge were determined (Fig. 8). Prior exposure to Pst reduced tissue damage but not bacterial growth following both Pst and virulent Xcv challenge. Therefore, Pst can induce SAT both to itself and to virulent Xcv, indicating that this response is not specific to Xcv.


   DISCUSSION
TOP
 ABSTRACT
 RESULTS
 DISCUSSION
MATERIALS AND METHODS
 LITERATURE CITED
 
In this paper, the systemic responses of tomato to both virulent and avirulent Xcv were studied. Inoculation with avirulent or virulent Xcv led to local and systemic PR gene induction. Systemic PR gene induction by virulent Xcv was ethylene and SA dependent. The systemic signal, as well as inducing PR gene expression, altered the response to challenge with virulent Xcv. This altered defense response is tolerance and not resistance. SAT is manifested by rapid PR gene expression and ethylene induction in response to subsequent challenge, leading to suppressed symptom development. SAT is not specific to Xcv since it was also induced by the virulent bacterial pathogen Pst.

The ability of a plant to send a systemic signal in response to a biological stimulus is well established. This communication allows systemic tissues to act in concert to the many stimuli they perceive. Systemic signals have been characterized in terms of responses to pathogens, symbionts, and wounding. The phytohormones SA, ethylene, jasmonates, and systemin are all involved in generating systemic defense-related signals (Pearce et al., 1991Go; Gaffney et al., 1993Go; Pieterse et al., 1998Go). SA is a key player in the development of SAR in many species (Ryals et al., 1996Go) and NahG plants are unable to mount SAR to bacterial, viral, or fungal pathogens (Gaffney et al., 1993Go; Friedrich et al., 1995Go; Lawton et al., 1995Go). The role of SA in systemic responses of tomato appears to differ somewhat from that in other plant species. For example, the induction of SAR against P. infestans showed neither systemic SA accumulation upon inoculation nor SA accumulation upon challenge, both of which are common in other plant species (Jeun et al., 2000Go). We have previously observed local SA accumulation in tomato in response to virulent Xcv, but only at 8 d following infection (O'Donnell et al., 2001Go), well after the systemic PR gene induction reported here.

In tomato, ethylene and SA accumulate in response to virulent and avirulent Xcv, although neither phytohormone is involved in limiting bacterial growth. Ethylene deficiency in tomato causes tolerance to virulent Xcv. It also reduces cell death and lesion size in response to infection with avirulent Xcv. SA deficiency in tomato also leads to tolerance to virulent Xcv. However, it increases cell death and lesion size in response to infection with avirulent Xcv (Lund et al., 1998Go; Ciardi et al., 2001Go; O'Donnell et al., 2001Go, 2003Go). As reported in Ciardi et al. (2000)Go, avirulent Xcv induces a rapid and stronger expression of PR genes than virulent Xcv. Here, we show the same effect systemically.

The systemic signal generated by infection with avirulent but not virulent Xcv inoculation suppressed SA accumulation in response to challenge (Fig. 4D). This SA suppression apparently has no major impact on SAT. Despite the differences in SA accumulation following challenge, systemic PR gene expression was reduced in both ethylene and SA-deficient plants, suggesting that these phytohormones are important for generation of systemic signals in response to Xcv. The patterns of PR gene induction and ethylene emissions indicated an earlier and stronger response during challenge in plants displaying SAT. Prior Xcv exposure apparently primes systemic defenses, as measured by PR gene expression. The priming of PR genes and ethylene by prior Xcv exposure suggests that SAT could be a partial SAR that sensitizes systemic defenses sufficiently to repress symptom development but not pathogen growth. Systemic induction of defense responses that do not lead to SAR have been observed in the interaction of Arabidopsis and the necrotizing fungal pathogen B. cinerea (Govrin and Levine, 2002Go). Our experiments with Xcv, Actigard, and Pst demonstrate the flexibility of systemic responses to pathogen attack. For example, treatment with Actigard leads to resistance to Xcv and Pst, whereas prior inoculation with Pst leads to tolerance. Prior inoculation with Xcv leads to tolerance to Xcv yet has no visible impact on Pst challenge. This plasticity of the systemic response appears to depend on both inducer and challenge. Tolerant plants demonstrate that bacterial growth and symptom development can be uncoupled. Alternately, it may be argued that distinctions between susceptibility, tolerance, and resistance are artificial and that all of these outcomes are part of a continuum of plant defense responses. Similar signaling events could coordinate both SAT and SAR. This would imply that SAT and SAR share common signals including those that repress symptom development, but additional or stronger signals may be responsible for repression of pathogen growth in SAR.

Evidence for low level of defense responses causing tolerance is provided by tobacco plants (Nicotiana tabacum) that overexpress PR1a and exhibit enhanced tolerance to Peronospora tabacina (Alexander et al., 1993Go) as well as catalase-deficient tobacco with low-level activation of defense responses by H2O2 that have enhanced pathogen tolerance (Chamnongpol et al., 1998Go). These experiments suggest that low-level defense responses can repress symptom development without affecting bacterial growth. It may be that the systemic defense responses initiated by a particular pathogen are sufficient to cause either resistance or tolerance to a different pathogen depending on its ability to circumvent the induced defenses. In some cases, for instance inoculation with Xcv followed by challenge with Pst, the challenging pathogen can bypass the induced defense responses leading to full susceptibility. It can be concluded that systemic defense responses, and perhaps resistance itself, are more complex than previously suspected.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
LITERATURE CITED
 

Plant Materials and Treatments

Tomato (Lycopersicon esculentum) cultivars MM and UC82B are the parental lines for NahG (Oldroyd and Staskawicz, 1998Go) and ACD (Klee et al., 1991Go), respectively. Wild type refers to UC82B in all experiments except those associated with Figure 5. Plant growth and treatments were performed under ambient temperature and lighting in a greenhouse. To avoid confusion, we use the terms "inoculation" for the first treatment of a tomato plant and "challenge" for the subsequent treatment on distal leaves. Plants were inoculated by submersion of the leaves for 15 s in a bacterial suspension of 1 x 107 colony forming units (cfu) mL–1 of Xcv strain 93-1 (virulent) or 87-7 (avirulent) containing 10 mM MgCl2 and 0.02% (v/v) Silwet L-77. Mock inoculations were performed by dipping plants in buffered Silwet. For analysis of the systemic response to infection, primary inoculations were performed on 3-week-old plants by dipping the first and second leaves in infection media. Challenges were then performed 14 d later by dipping leaves 5 and 6 in the infection media containing 1 x 107 cfu mL–1 of virulent Xcv. For PR gene analysis, the first and second leaves of 6-week-old plants were inoculated, and tissue from the local inoculation (first and second leaves) and the systemic response (fifth and sixth leaves) were removed at the indicated time points and flash frozen in liquid nitrogen. Pst inoculations were performed with 1 x 107 cfu mL–1 Pst DC3000. Actigard (0.03 gL–1) treatments were sprayed on the first and second leaves of tomato plants at 10 and 4 d prior to challenge. Each experiment was repeated at least twice.


Bacterial Culture

Xcv and Pst cultures were grown as previously described by O'Donnell et al. (2001)Go. Leaf colony counts were determined on two independent biological repeats as previously described by Lund et al. (1998)Go. Briefly, five 1-cm2 leaf discs were sampled from each line at each time point indicated. The discs were ground in 10 mM MgCl2, and serial dilutions were incubated at room temperature (Pst) or at 30°C (Xcv) for 2 d on solid media. The average cfu per square centimeter (cfu cm–2) for each sample was determined by counting individual colonies (n = 5).


Ion Leakage

Amount of cell death was estimated by measuring percentage of ion leakage on two independent biological repeats. For challenge inoculations at 16 dpi the fourth leaf of each plant was placed in 6-mL deionized water and a vacuum of 20 psi applied for 5 min. The samples were then shaken at room temperature for 1 h. Three milliliters of the water was then removed and its conductivity was measured. The samples were then placed in a boiling water bath for an hour and the conductance of the remaining 3 mL of water measured. Percent ion leakage was determined by conductivity of first 3 mL divided by conductivity of second 3 mL multiplied by 100. n = 30 for challenge inoculations with a pathogen and n = 10 for mock challenges. Each experiment was repeated at least twice.


Ethylene Measurements

Ethylene measurements were performed on a minimum of two independent biological replicates with n = 4. Ethylene production was determined by sampling the headspace above a single leaf enclosed in 5-cm3 tubes for 1 h as described by Lund et al. (1998)Go. Ethylene concentration in a 1-mL sample was determined by gas chromatography (model 5890; Hewlett-Packard, Palo Alto, CA).


SA Measurements

SA was extracted from tomato tissue and derivatized using trimethylsilyl-diazomethane. The volatile SA methyl ester was collected from the complex matrix using vapor phase extraction and quantified by isobutene chemical ionization gas-chromatography/mass spectrometry as described in Schmelz et al. (2004)Go. Each experiment was repeated at least twice; n = 4.


Real-Time RT-PCR

PR1a (M69247) and PR1b (M69248) mRNA levels were quantified by real-time quantitative RT-PCR using Taqman one-step RT-PCR reagents (Applied Biosystems, Foster City, CA) and an Applied Biosystems GeneAmp 5700 sequence detection system. Each determination was performed using 250 ng of DNase-1 treated total RNA isolated using RNeasy Plant mini kit (Qiagen, Valencia, CA) in a 25-µL reaction volume. RT-PCR conditions were: 48°C for 30 min, 95°C for 10 min followed by 40 cycles of 95°C for 15 s and 60°C for 1 min. Absolute mRNA levels were quantified using synthesized sense strand RNAs as standards. Primers and probes were designed using PRIMER EXPRESS software (Applied Biosystems) and were as follows: PR1b probe 5'-/56-FAM/CAACGGATGGTGGTTCATTTCTTGCA/3BQH_1/-3'; PR1a probe 5'-/56-FAM/TGTGGGTGTCCGAGAGGCCAGA/3BHQ_1/-3'; PR1b forward primer 5'-GGTCGGGCACGTTGCA-3'; PR1b reverse primer 5'-GATCCAGTTGCCTACAGGACATA-3'; PR1a forward primer 5'-GAGGGCAGCCGTGCAA-3'; PR1a reverse primer 5'-CACATTTTTCCACCAACACATTG-3' (Intergrated DNA Technologies, Coralville, IA). Each experiment is representative of two independent biological replicates; n = 2.

Received January 3, 2005; returned for revision March 2, 2005; accepted March 23, 2005.


   FOOTNOTES
 
1 This work was supported in part by the National Science Foundation (grant no. IBN0091064 to H.J.K.) and the Florida Agricultural Experiment Station. This is Florida Agricultural Experiment Station Journal series number R10808. Back

2 Present address: Genesis Research and Development Corp., Ltd., P.O. Box 50, Auckland, New Zealand. Back

Article, publication date, and citation information can be found at www.plantphysiol.org/cgi/doi/10.1104/pp.105.059246.

* Corresponding author; e-mail hjklee{at}ifas.ufl.edu; fax 352–846–2063.


   LITERATURE CITED
TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 
Alexander D, Goodman RM, Gut-Rella M, Glascock C, Weymann K, Friedrich L, Maddox D, Ahl-Goy P, Luntz T, Ward E, et al (1993) Increased tolerance to two oomycete pathogens in transgenic tobacco expressing pathogenesis-related protein 1a. Proc Natl Acad Sci USA 90: 7327–7331[Abstract/Free Full Text]

Bent AF, Innes RW, Ecker JR, Staskawicz BJ (1992) Disease development in ethylene-insensitive Arabidopsis thaliana infected with virulent and avirulent Pseudomonas and Xanthomonas pathogens. Mol Plant Microbe Interact 5: 372–378[ISI][Medline]

Bonas U, Conradsstrauch J, Balbo I (1993) Resistance in tomato to Xanthomonas campestris pv. vesicatoria is determined by alleles of the pepper-specific avirulence gene avrbs3. Mol Gen Genet 238: 261–269[Medline]

Chamnongpol S, Willekens H, Moeder W, Langebartels C, Sandermann H Jr, Van Montagu M, Inze D, Van Camp W (1998) Defense activation and enhanced pathogen tolerance induced by H2O2 in transgenic tobacco. Proc Natl Acad Sci USA 95: 5818–5823[Abstract/Free Full Text]

Ciardi JA, Tieman DM, Jones JB, Klee HJ (2001) Reduced expression of the tomato ethylene receptor gene LeETR4 enhances the hypersensitive response to Xanthomonas campestris pv. vesicatoria. Mol Plant Microbe Interact 14: 487–495[ISI][Medline]

Ciardi JA, Tieman DM, Lund ST, Jones JB, Stall RE, Klee HJ (2000) Response to Xanthomonas campestris pv. vesicatoria in tomato involves regulation of ethylene receptor gene expression. Plant Physiol 123: 81–92[Abstract/Free Full Text]

Conrath U, Pieterse CM, Mauch-Mani B (2002) Priming in plant-pathogen interactions. Trends Plant Sci 7: 210–216[CrossRef][ISI][Medline]

Enkerli J, Gisi U, Mosinger E (1993) Systemic acquired-resistance to Phytophthora-infestans in tomato and the role of pathogenesis-related proteins. Physiol Mol Plant Pathol 43: 161–171[CrossRef]

Friedrich L, Vernooij B, Gaffney T, Morse A, Ryals J (1995) Characterization of tobacco plants expressing a bacterial salicylate hydroxylase gene. Plant Mol Biol 29: 959–968[CrossRef][ISI][Medline]

Gaffney T, Friedrich L, Vernooij B, Negrotto D, Nye G, Uknes S, Ward E, Kessmann H, Ryals J (1993) Requirement of salicylic-acid for the induction of systemic acquired-resistance. Science 261: 754–756

Govrin EM, Levine A (2002) Infection of Arabidopsis with a necrotrophic pathogen, Botrytis cinerea, elicits various defense responses but does not induce systemic acquired resistance (SAR). Plant Mol Biol 48: 267–276[CrossRef][ISI][Medline]

Hunt MD, Ryals JA (1996) Systemic acquired resistance signal transduction. Crit Rev Plant Sci 15: 583–606

Jeun YC, Siegrist J, Buchenauer H (2000) Biochemical and cytological studies on mechanisms of systemically induced resistance to Phytophthora infestans in tomato plants. J Phytopathol 148: 129–140

Klee HJ, Hayford MB, Kretzmer KA, Barry GF, Kishore GM (1991) Control of ethylene synthesis by expression of a bacterial enzyme in transgenic tomato plants. Plant Cell 3: 1187–1193[Abstract/Free Full Text]

Knoester M, Pieterse CM, Bol JF, Van Loon LC (1999) Systemic resistance in Arabidopsis induced by rhizobacteria requires ethylene-dependent signaling at the site of application. Mol Plant Microbe Interact 12: 720–727[ISI][Medline]

Knoester M, van Loon LC, van den Heuvel J, Hennig J, Bol JF, Linthorst HJM (1998) Ethylene-insensitive tobacco lacks nonhost resistance against soil-borne fungi. Proc Natl Acad Sci USA 95: 1933–1937[Abstract/Free Full Text]

Kunkel BN, Brooks DM (2002) Cross talk between signaling pathways in pathogen defense. Curr Opin Plant Biol 5: 325–331[CrossRef][ISI][Medline]

Lawton K, Weymann K, Friedrich L, Vernooij B, Uknes S, Ryals J (1995) Systemic acquired resistance in Arabidopsis requires salicylic acid but not ethylene. Mol Plant Microbe Interact 8: 863–870[ISI][Medline]

Lund ST, Stall RE, Klee HJ (1998) Ethylene regulates the susceptible response to pathogen infection in tomato. Plant Cell 10: 371–382[Abstract/Free Full Text]

McDowell J, Dangl J (2000) Signal transduction in the plant immune response. Trends Biochem Sci 25: 79–82[CrossRef][ISI][Medline]

O'Donnell PJ, Jones JB, Antoine FR, Ciardi J, Klee HJ (2001) Ethylene-dependent salicylic acid regulates an expanded cell death response to a plant pathogen. Plant J 25: 315–323[CrossRef][ISI][Medline]

O'Donnell PJ, Schmelz E, Block A, Miersch O, Wasternack C, Jones JB, Klee HJ (2003) Multiple hormones act sequentially to mediate a susceptible tomato pathogen defense response. Plant Physiol 133: 1181–1189[Abstract/Free Full Text]

Oldroyd GED, Staskawicz BJ (1998) Genetically engineered broad-spectrum disease resistance in tomato. Proc Natl Acad Sci USA 95: 10300–10305[Abstract/Free Full Text]

Pearce G, Strydom D, Johnson S, Ryan CA (1991) A polypeptide from tomato leaves induces wound-inducible proteinase-inhibitor proteins. Science 253: 895–898[Abstract/Free Full Text]

Pieterse CMJ, van Wees SCM, van Pelt JA, Knoester M, Laan R, Gerrits N, Weisbeek PJ, van Loon LC (1998) A novel signaling pathway controlling induced systemic resistance in Arabidopsis. Plant Cell 10: 1571–1580[Abstract/Free Full Text]

Ryals JA, Neuenschwander UH, Willits MG, Molina A, Steiner HY, Hunt MD (1996) Systemic acquired resistance. Plant Cell 8: 1809–1819[CrossRef][ISI][Medline]

Schmelz EA, Engelberth J, Tumlinson JH, Block A, Alborn HT (2004) The use of vapor phase extraction in metabolic profiling of phytohormones and other metabolites. Plant J 39: 770–808

Vernooij B, Friedrich L, Goy PA, Staub T, Kessmann H, Ryals J (1995) 2,6-Dichloroisonicotinic acid-induced resistance to pathogens without the accumulation of salicylic-acid. Mol Plant Microbe Interact 8: 228–234




This article has been cited by other articles:


Home page
 Crop Sci.Home page
A. F. Bent, T. K. Hoffman, J. S. Schmidt, G. L. Hartman, D. D. Hoffman, P. Xue, and M. L. Tucker
Disease- and Performance-Related Traits of Ethylene-Insensitive Soybean
Crop Sci., February 24, 2006; 46(2): 893 - 901.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
138/3/1481    most recent
pp.105.059246v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (4)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Block, A.
Right arrow Articles by Klee, H. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Block, A.
Right arrow Articles by Klee, H. J.
Agricola
Right arrow Articles by Block, A.
Right arrow Articles by Klee, H. J.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
ASPB Publications PLANT PHYSIOLOGY THE PLANT CELL
Copyright © 2005 by the American Society of Plant Biologists