|
|
||||||||
|
First published online June 24, 2005; 10.1104/pp.104.052639 Plant Physiology 138:1615-1626 (2005) © 2005 American Society of Plant Biologists
Isolation of a Protein Interacting with Vfphot1a in Guard Cells of Vicia faba1Department of Biology, Faculty of Science, Kyushu University, Ropponmatsu, Fukuoka 8108560, Japan (T.E., T.K., K.S., K.-i.S.); and Department of Biological Science, Graduate School of Science, Hiroshima University, Higashi-Hiroshima 7398526, Japan (Y.M.)
A recent study has demonstrated that phototropins act as blue light receptors in stomatal guard cells. However, the downstream components responsible for phototropin signaling are largely unknown. In this study, using a yeast two-hybrid system, we isolated a Vicia faba protein that has a high similarity to dynein light chain in the C terminus, which interacts with Vicia faba phototropin 1a (Vfphot1a). Protein-blot and two-hybrid analyses revealed that Vfphot1a interacting protein (VfPIP) bound to the C-terminal region of Vfphot1a but did not bind to Vfphot1b. The interaction between VfPIP and Vfphot was indicated by a pull-down assay. Northern analysis revealed that the transcription level of VfPIP gene was more abundant in guard cells than in other tissues or cell types. The transiently expressed fusion protein of VfPIP-green fluorescent protein was localized on cortical microtubules in Vicia guard cells. Microtubule-depolymerizing herbicides partially inhibited both blue light-dependent H+ pumping in Vicia guard cell protoplasts and stomatal opening in the Vicia epidermis. From these results, we conclude that VfPIP may act as a downstream component of phototropin (Vfphot1a) in blue light signaling in guard cells. The possible role of VfPIP in blue light signaling of guard cells is discussed.
Blue light induces a variety of physiological responses including phototropism, chloroplast relocation, leaf expansion, and stomatal opening (Briggs and Huala, 1999
Guard cells modulate stomatal apertures in response to various kinds of external stimuli such as hormones, metabolic demands, CO2 concentration, and light (Assmann and Shimazaki, 1999
Recently, it has been revealed that two proteins interact with phototropins. One is a 14-3-3 protein and the other is NPH3 (nonphototropic hypocotyl 3). The 14-3-3 protein interacts with various target proteins dependent on the phosphorylation of their consensus motifs and has been demonstrated to bind to Vfphots upon their phosphorylations (Kinoshita et al., 2003
In this study, we aimed to find protein components that receive signals from phototropins in guard cells, and employed a yeast two-hybrid screening using a Vicia faba guard-cell cDNA library as prey. Since we have already demonstrated the presence of Vicia faba phototropin 1a (Vfphot1a) and Vfphot1b in guard cells of V. faba (Kinoshita et al., 2003
Isolation of a Protein That Interacts with Vfphot1a in Yeast To isolate proteins that interact with Vfphot1a, the N-terminal region of Vfphot1a, which was devoid of a kinase domain, was used as bait (Gal4 DNA-binding domain [GBD]-N-LOV2) in a yeast two-hybrid system to screen a guard-cell cDNA library from V. faba (Fig. 1A). We screened 3x106 colonies and obtained eight positive clones. All of the positive clones possessed a sequence similar to that of the dynein light chain of animal cells in the C terminus but had a long extension in the N terminus that was lacked in the dynein light chain (Fig. 1B). The sequence similarity between this dynein light chain like protein and human dynein light chain was 52.4% in the C terminus. We named this protein the Vicia faba phototropin1a interacting protein (VfPIP). Since the isolated cDNA clone seemed to contain a part of VfPIP gene, 5' rapid amplification of the cDNA ends was used to obtain the full-length cDNA. The cDNA contained an open reading frame of 939 bp, encoding a deduced polypeptide of 312 amino acid residues with a predicted molecular mass of 34.3 kD (Fig. 1B). The molecular masses of dynein light chain found in animals were usually about 10 kD, but VfPIP had a molecular mass of 34.3 kD because of an added N-terminal region of 24 kD. All of the positive clones obtained by the yeast two-hybrid system encoded the C-terminal region of Val-210 to Asp-312, which possesses a sequence similar to that of dynein light chain.
We retransduced these positive clones into yeast and measured the -galactosidase activity to estimate the interaction between VfPIP210312 and Vfphot1a (Fig. 1C). The results indicated that N-LOV2 fused to GBD interacted with VfPIP210312 fused to Gal4 activation domain (GAD) but did not interact with GAD alone. Furthermore, GBD did not interact with VfPIP210312 fused to GAD. To examine the interaction between Vfphot and VfPIP in vitro, we expressed the glutathione S-transferase (GST)-fused C terminus of VfPIP190312 (Met-190 to Asp-312) in Escherichia coli and isolated the microsomal fraction from etiolated seedlings of V. faba. The microsomal fraction was used as a source of Vfphot. GST-VfPIP190312 was incubated with this microsome fraction, and then GST-VfPIP190312 was pulled down by glutathione-sepharose beads. Proteins bound to the beads were released and the released proteins were subjected to western-blot analysis using antibodies against Vfphot. The results revealed that Vfphot protein was obtained when GST-VfPIP190312 was present (Fig. 2A, lane 2) but was not found by the GST moiety alone (Fig. 2A, lane 4). In the absence of microsomal fractions, Vfphot was not found (Fig. 2A, lane 1). These results indicate that Vfphot interacts with VfPIP190312 in vitro. Since it has been demonstrated that phototropin is autophosphorylated in response to blue light, it is possible that the interaction between Vfphot and VfPIP is dependent on phosphorylation. To investigate this, a microsomal fraction was isolated from seedlings that had been preilluminated with blue light for 1 min and was used for a pull-down assay. However, no significant difference in the interaction of Vfphot with VfPIP190312 was observed (Fig. 2A, lanes 2 and 3). We confirmed the occurrence of autophosphorylation through the binding of 14-3-3 protein to Vfphot by this blue light treatment (Fig. 2B, lanes 3 and 4). The 14-3-3 protein bound to Vfphot only when the seedlings had been illuminated with blue light. Western analysis revealed that the amount of Vfphot used in this experiment was the same (Fig. 2B, lanes 1 and 2). We also confirmed that equal amounts of GST-VfPIP190312 were used for the pull-down assay by amido black staining (data not shown). Furthermore, full-length VfPIP interacted with Vfphot because Vfphot was efficiently pulled down by the GST-VfPIP (Fig. 2C) in the presence of microsome.
Specific Interaction between VfPIP and Vfphot1a Homologs
Since Vfphot1a and Vfphot1b migrated similarly on the SDS-PAGE (Kinoshita et al., 2003
Interaction Site of VfPIP in Vfphot1a
A quantitative interaction assay using a yeast two-hybrid system was employed to determine the binding site of VfPIP in Vfphot1a. A series of Vfphot1a deletion constructs were generated by cloning of Vfphot1a fragments into pAS2-1 bait vectors (Fig. 4A). These constructs were cotransformed into yeast together with VfPIP190312 that was cloned into the pAD-GAL4-2.1 prey vector. The interaction between bait and prey in yeast results in activation of the lacZ reporter gene and is assayed by measuring
Expression of Gene Products of VfPIP in Several Tissues The transcription levels of VfPIP were investigated in guard cell protoplasts, mesophyll cell protoplasts, root, and etiolated seedlings of V. faba (Fig. 5A). A digoxigenin (DIG)-labeled probe for VfPIP gene transcript hybridized to a band of mRNA of 1,500 bp in each lane. This length corresponded to that of the full-length mRNA encoding VfPIP. The transcription level of VfPIP gene was the highest in guard cell protoplasts among other tissues including mesophyll cell protoplast, roots, and etiolated seedlings. Transcript of VfPIP gene was more abundant in roots than in mesophyll cell protoplasts and seedlings.
Expression of VfPIP protein was investigated in these tissues of V. faba by western analysis using antibodies raised against VfPIP190312. As shown in Figure 5B, a 35.5-kD band was found, and this molecular mass corresponded to that of VfPIP deduced from the amino acid sequence (34.3 kD). The expression level of VfPIP protein was highest in guard cell protoplasts and lowest in mesophyll cell protoplasts. VfPIP was also found in seedlings, although the transcript level was very low.
Dynein light chain is a member of the cytoplasmic dynein complex, which is associated with microtubules in animal cells. However, all of the dynein subunits except D are absent in the Arabidopsis genome database. We investigated the distribution of VfPIP in guard cells using VfPIP-green fluorescent protein (GFP) fusion proteins in a transient expression assay. The construct of VfPIP-GFP was introduced into guard cells of Vicia leaf epidermis by particle bombardment to allow the expression of fusion protein. In the transformant, guard cells displayed a marked filamentous fluorescence in the vicinity of the plasma membrane (Fig. 6, AC). Because this fluorescence profile resembled the distribution of cytoskeletons including the microtubule and actin filament, the localization of VfPIP-GFP was compared with those of the microtubule-associated protein MAP, the microtubule binding domain of MAP4, and the actin-associated protein, mouse Talin. These cytoskeleton-associated proteins were expressed transiently as GFP fusion proteins. GFP-MAP4 revealed the filamentous fluorescence close to the plasma membrane and slightly in cytoplasm (Fig. 6, DF). By contrast, GFP-muTalin showed a strong mesh-like fluorescence close to the plasma membrane, and the fluorescence was also found inside the cells, probably in the cytoplasm (Fig. 6, GI).
The fluorescence profile of VfPIP-GFP resembled that of GFP-MAP4, and it is most likely that VfPIP-GFP is localized on the microtubules. To demonstrate this, the transformant of Vicia leaf epidermis that expressed GFP fusion proteins was treated with depolymerizing compounds of microtubules. The treatments by oryzalin and trifluralin almost completely destroyed the filamentous structure of VfPIP and released the VfPIP-GFP to the cytoplasm, and stimulated the translocation of VfPIP-GFP to the plasma membrane. The results suggest that VfPIP localized on the cortical microtubules and was released from the microtubules after destruction of their structures by the compounds. In accord with the above results, the treatments with oryzalin and trifluralin destroyed the filamentous structure of GFP-MAP4, and some of the GFP-MAP4 was stimulated to move to the cytoplasm (Fig. 7, DF). By contrast, neither treatment destroyed the mesh-like fluorescent structure of GFP-muTalin (Fig. 7, GI), suggesting that the compounds used here specifically affect the microtubule structure but not the actin filaments.
Effects of Microtubule-Depolymerizing Compounds on Blue Light-Dependent Stomatal Opening and H+ Pumping
VfPIP localized on cortical microtubules and interacted with Vfphot1a, and thus it is expected that some function of Vfphot1a is mediated by the microtubules. Since phototropins in V. faba mediate stomatal opening in response to blue light (Kinoshita et al., 2003
Since inhibition occurs in the opening response specific to blue light, it is expected that these compounds affect blue light-dependent H+ pumping, which in turn drives stomatal opening. To test this, isolated guard cell protoplasts from Vicia were treated with these compounds and blue light-dependent H+ pumping was measured (Table II). As shown in Table II, the magnitudes of blue light-dependent H+ pumping were decreased by 10 µM trifluralin and 10 µM oryzalin to 62.0% and 54.1%, respectively. The maximum rates of blue light-dependent H+ pumping were similarly inhibited by these compounds. Inhibitions by trifluralin and oryzalin were concentration-dependent. However, the inhibitory action of propyzamide on H+ pumping was not obvious, and these results were in accord with those of stomatal opening shown above. From these results, it is likely that the cortical microtubules may play some important roles in mediating light signals from Vfphot1a to the plasma membrane H+-ATPase. However, we note that, in all cases, the effects of compounds are somewhat stronger in the opening responses in epidermal peels than in H+ pumping in guard cell protoplasts.
It is possible that these microtubule-depolymerizing compounds directly affect the activity of plasma membrane H+-ATPase. To check this possibility, we determined the rate of fusicoccin (FC)-dependent H+ pumping in the presence of trifluralin and oryzalin at the same concentrations. FC directly activates the plasma membrane H+-ATPase by stimulation of binding of the 14-3-3 protein to the C terminus. However, the rates of FC-dependent H+-pumping were not inhibited by these compounds, indicating that the H+-ATPase activity was not affected by the compounds. The rate and magnitude of FC-dependent H+ pumping even increased in the presence of 20 µM propyzamide (Table II).
Phototropins have been identified as blue light receptors involved in phototropism, chloroplast relocation, leaf extension, and stomatal opening (Briggs and Christie, 2002
Dyneins are molecular motors that translocate to microtubules. The dyneins are comprised of subunits ranging in mass from 9 to over 500 kD. The largest of these subunits, the dynein heavy chains, are involved in force production, whereas the others are defined as accessory subunits based on their association with the dynein complex (King, 2000
Dynein heavy chains genes are ubiquitously present in fungi and animals. However, dynein heavy chains genes are absent from the Arabidopsis genome (Lawrence et al., 2001
It has been reported that dynein light chains have been found not only in microtubules but also in the cytoplasm and nucleus (Crépieux et al., 1997
It has been reported that Atphot1 uniformly localizes on the plasma membrane in guard cells of Arabidopsis and a fraction of Atphot1 dissociates from the plasma membrane in response to blue light (Sakamoto and Briggs, 2002 VfPIP is most likely to be associated directly or indirectly with cortical microtubules in guard cells. Clarifying the functional role of VfPIP in guard cells is the best way to investigate the stomatal response of disruption mutants of VfPIP. By screening the genomic database of Arabidopsis, we found five isoforms of dynein light chains, and the amino acid sequence of one of the isoforms highly resembled that of VfPIP in its C terminus, with 80% identity in the C terminus. We found that Arabidopsis dynein light chain, which has the highest homology to VfPIP, also binds to Atphot1 by protein-blot analysis (data not shown). However, the dynein light chain of Arabidopsis lacked the N terminus found in VfPIP, and a protein homologous to dynein light chain with the N terminus was not found in the database. Two T-DNA insertional lines of Arabidopsis in coding regions of dynein light chain genes were obtained and stomatal openings in the two mutant plants were tested in response to blue light. The stomatal responses of the two mutant lines could not be distinguished from those of wild-type plants (data not shown). This was likely due to functional redundancy in these isoforms of dynein light chains in Arabidopsis. Since VfPIP seems to localize to the cortical microtubules, the function of VfPIP may be mediated by the microtubules. To investigate this, we treated the epidermis and guard cell protoplasts with microtubule-depolymerizing compounds such as trifluralin, oryzalin, and propyzamide, and measured blue light-dependent-stomatal opening and H+ pumping. As shown in Tables I and II, microtubule disruption by the compounds inhibited both stomatal opening and H+ pumping, and the effect was consistently more severe in opening responses than in H+ pumping. This was probably because the microtubule may not only mediate light signals from phototropins to the plasma membrane H+-ATPase, but may also stimulate stomatal opening by appropriately organizing the microtubule structure. As shown in Figure 7, however, microtubule-depolymerizing compounds almost completely destroyed the structure of the microtubules, but inhibition of blue light-dependent H+ pumping by these compounds was up to 50%. If all of the blue light signals from phototropins were transmitted to the plasma membrane H+-ATPase via microtubules, the magnitude of inhibition would have been greater than 50%. This discrepancy can be interpreted as follows. Since only Vfphot1a interacts with VfPIP, and since Vfphot1a seems to act redundantly with Vfphot1b in guard cells, a significant portion of the light signals from Vfphot1b may have been transmitted to the plasma membrane H+-ATPase irrespective of the microtubule structure. This may have decreased the sensitivity of blue light-dependent responses to the microtubule-depolymerizing compounds (Tables I and II). Alternatively, the effect of the microtubule-depolymerizing compounds on blue light-dependent H+ pumping may have been indirect.
Taking these results together, we conclude that VfPIP may act as a signal molecule that transduces the light signals from phototropins to cortical microtubules, thereby supporting stomatal opening. It is also possible that the microtubule mediates the light signal to the plasma membrane H+-ATPase for activation via phosphorylation in stomatal guard cells. In accord with these observations, Marcus et al. (2001)
It has been suggested that, in response to environmental stimuli, guard cells control their cytoskeletons as well as their intracellular ion concentrations (Kim et al., 1995
Plant Materials
Plants of Vicia faba L. cv Ryosai Issun were cultured hydroponically for 4 to 7 weeks in a greenhouse (Shimazaki et al., 1992 Plants of Arabidopsis (Arabidopsis thaliana) were grown in a chamber with a 14-h fluorescent-light/10-h-dark cycle at 24°C and 50% to 60% humidity. Etiolated seedlings of Arabidopsis were grown on an agarose plate containing a 0.5 x Murashige and Skoog salt base, 0.05% MES-KOH, pH 5.7, and 0.8% agarose for 3 d in the dark at 24°C in 50% to 60% humidity after cold treatment of seeds for 4 d.
Guard cell protoplasts were isolated enzymatically as described previously (Kinoshita and Shimazaki, 1999
The cDNA library was prepared using a HybriZAP-2.1 Two-Hybrid cDNA Gigapack Cloning kit and HybriZAP-2.1 Two-Hybrid cDNA Synthesis kit (Stratagene, La Jolla, CA). Total RNA was extracted from V. faba guard cell protoplasts using ISOGEN (Nippon Gene, Tokyo). mRNA was isolated from total RNA using a QuickPrep Micro mRNA Purification kit (Amersham Biosciences, Tokyo). Construction of bait plasmid and yeast two-hybrid screening were performed using a MATCHMAKER Two-Hybrid System 2 (CLONTECH, Palo Alto, CA) according to the manufacturer's instructions.
For measurement of
Two primers, CACTATGCAATGCCATGCTGGTCC and GCCTCTATCCTCGCCGCCGTATC, were used for the 5' RACE. The 5' RACE was performed using a GeneRacer kit (Invitrogen, Carlsbad, CA) according to the manufacturer's instructions. PCR products were cloned into a pCR4-TOPO vector (Invitrogen).
The recombinant VfPIP was expressed and purified from E. coli cells (JM109) as follows. The coding sequence of VfPIP was amplified by PCR using synthetic oligonucleotides that contained an EcoRI site at the 5' ends and cloned in-frame with GST into the pGEX-4T-1 plasmid vector (Amersham Biosciences). Expression and purification were performed using Bulk and RediPack GST purification modules (Amersham Biosciences) according to the manufacturer's instructions.
Recombinant Atphot was expressed in insect cells. The coding sequence of Atphot1 was inserted into the EcoRI site of the pAcHLT-A (BD Biosciences Pharmingen, Palo Alto, CA) and transfected into Sf9 (Spodoptera frugiperda) insect cells using a BaculoGold Transfection kit (BD Biosciences Pharmingen) according to the supplier's instructions. Recombinant baculovirus was used to infect Sf9 insect cells. The expression of recombinant His6-tagged Atphot1 was measured as described previously (Christie et al., 1998
To isolate the microsome fraction, V. faba etiolated seedlings were homogenized in a buffer containing 50 mM MOPS-KOH, pH 7.5, 2.5 mM EDTA, 100 mM NaCl, 1 mM phenylmethylsulfonyl fluoride, 20 µM leupeptin, and 5 mM dithiothreitol (DTT). The homogenate was centrifuged at 10,000g for 5 min. The supernatant was centrifuged again at 100,000g for 60 min. The microsomal membrane fraction was obtained as a pellet. The pellet was resuspended in Tris-buffered saline (TBS) buffer (20 mM Tris-HCl, pH 7.4, 140 mM NaCl) containing 0.1% (w/v) Tween 20, 1 mM phenylmethylsulfonyl fluoride, 20 µM leupeptin, and 1 mM DTT. Glutathione-sepharose beads that bound to GST-fused VfPIP were suspended in TBS buffer. Five microliters of glutathione-sepharose beads was mixed with 200 µL of 300 µg microsome solution, and the mixture was incubated at 4°C for 4 h. Proteins bound to the beads through VfPIP were released from the beads followed by boiling in Laemmli's buffer. The released proteins were separated by 12.5% SDS-PAGE and transferred onto nitrocellulose membranes (Hybond-C; Amersham Biosciences) using Trans-blot (Bio-Rad, Hercules, CA).
RNA was isolated from guard cell protoplasts, mesophyll cell protoplasts, leaves, and roots of V. faba with ISOGEN (Nippon Gene, Tokyo). DIG-labeled probes from 482 bp to 1,314 bp of VfPIP gene were obtained by PCR using a PCR DIG-labeling mix (Roche, Tokyo) and used as probe. Northern hybridization was performed using a Digoxigenin Luminescent Detection Kit (Roche) according to the manufacturer's instructions. Signals were detected using CDP-Star (Roche).
The C-terminal region of VfPIP was used as an antigen and was expressed in E. coli as a recombinant protein. The 366-bp DNA fragment encoding Met-190 to Asp-312 of VfPIP was amplified by PCR. The resulting amplified DNA fragment was cloned into the pGEX2T (Amersham Biosciences) and used to transform E. coli. This polypeptide was expressed as a fusion protein with GST and was purified using glutathione-sepharose 4B. The C-terminal region of VfPIP was obtained by digestion with thrombin. Purified polypeptide was used to immunize the rabbits.
Phototropins were detected immunologically with antibodies according to the method of Gallagher et al. (1992)
Protein-blot analysis (far western blotting) was performed as described previously (Kinoshita and Shimazaki, 1999
VfPIP-GFP was constructed using full-length VfPIP and GFP under the control of the CaMV 35S promoter. GFP-MAP4 was constructed using the microtubule binding domain of human MAP4 (amino acids 6701,088) and GFP under the control of the CaMV 35S promoter. GFP-talin was constructed using mouse talin (amino acids 2,3452,541) and GFP under the control of the CaMV 35S promoter (Olson et al., 1995 Plasmid DNA was precipitated onto 1-µm gold particles according to the manufacturer's instructions. The abaxial side of Vicia leaves was shot at a pressure of 1,350 psi (1 psi = 6.89 kPa) at a distance of 4 cm from the macrocarrier holder by a Biolistic PDS-1000/He particle delivery system (Bio-Rad). Approximately 1 µg DNA was used per shot. Transfected leaves were stored in the dark overnight at room temperature, and the epidermis was peeled. The epidermis was incubated with microtubule-depolymerizing compounds (10 µM trifluralin and 10 µM oryzalin) in incubation medium (5 mM MES-BisTris-propane, 0.1 mM CaCl2, and 50 mM KCl, pH 6.5) for 2 h in the dark and then examined with a confocal laser-scanning microscope (Digital Eclipse C1; Nikon, Tokyo).
The epidermis was obtained from a fully expanded Vicia leaf and was placed in incubation medium (5 mM MES-BisTris-propane, 0.1 mM CaCl2, and 50 mM KCl, pH 6.5) in the dark for 1 h. The leaf epidermis was incubated with a microtubule-depolymerizing herbicide (10 µM trifluralin, 10 µM oryzalin, and 20 µM propyzamide) in incubation buffer for 2 h in the dark and illuminated with red light at 150 µmol m2 s1 or with blue light at 15 µmol m2 s1 superimposed on the background red light for 2 h.
Blue light-dependent H+ pumping by guard cell protoplasts from V. faba was measured with a glass pH electrode (Beckman 39532) using a dual-beam protocol described previously (Shimazaki et al., 1992
Red light was obtained from a tungsten lamp (Sylvania EXR 150 W) by passing the light through a red glass filter (Corning 261, >610 nm, Corning, New York) and blue light was obtained from a tungsten lamp (Sylvania EXR 300W) through a blue glass filter (Corning 560, peak 420 nm, half band width 45 nm). Photon flux density was determined with a quantum meter (LI-COR model 185A; Lincoln, NE).
All sequences were determined using an ABI PRISM 3100 Sequence Kit and ABI PRISM 3100 Genetic Analyzer (Applied Biosystems, Foster City, CA). Nucleotide and amino acid sequences were analyzed using the GENETYX software system (Software Development, Tokyo). Sequence data from this article have been deposited with the EMBL/GenBank data libraries under accession number AB215106.
We thank Professor M. Ito, Graduate School of Bioresource and Bioenvironmental Science, Kyushu University for using confocal laser-scanning microscope. Received August 31, 2004; returned for revision January 24, 2005; accepted March 10, 2005.
1 This work was supported by the Ministry of Science, Sports, and Culture of Japan (grant no. 13139202 to K.S.). Article, publication date, and citation information can be found at www.plantphysiol.org/cgi/doi/10.1104/pp.104.052639. * Corresponding author; e-mail kenrcb{at}mbox.nc.kyushu-u.ac.jp; fax 81927264758.
Albagli O, Dhordain P, Deweindt C, Lecocq G, Leprince D (1995) The BTB/POZ domain: a new protein-protein interaction motif common to DNA- and actin-binding proteins. Cell Growth Differ 6: 11931198[Abstract] Aravind L, Koonin EV (1999) Fold prediction and evolutionary analysis of the POZ domain: structural and evolutionary relationship with the potassium channel tetramerization domain. J Mol Biol 285: 13531361[CrossRef][Web of Science][Medline] Assmann SM (1993) Signal transduction in guard cells. Annu Rev Cell Biol 9: 345375[CrossRef][Web of Science][Medline]
Assmann SM, Baskin TI (1998) The function of guard cells does not require an intact array of cortical microtubules. J Exp Bot 49: 163170
Assmann SM, Shimazaki K (1999) The multisensory guard cell. Stomatal responses to blue light and abscisic acid. Plant Physiol 119: 809815 Assmann SM, Simoncini L, Schroeder JI (1985) Blue light activates electrogenic ion pumping in guard cell protoplasts of Vicia faba L. Nature 318: 285287[CrossRef] Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72: 248254[CrossRef][Web of Science][Medline] Briggs WR, Christie JM (2002) Phototropins 1 and 2: versatile plant blue-light receptors. Trends Plant Sci 7: 204210[CrossRef][Web of Science][Medline] Briggs WR, Huala E (1999) Blue-light photoreceptors in higher plants. Annu Rev Cell Dev Biol 15: 3362[CrossRef][Web of Science][Medline]
Christie JM, Reymond P, Powell GK, Bernasconi P, Raibekas AA, Liscum E, Briggs WR (1998) Arabidopsis NPH1: a flavoprotein with the properties of a photoreceptor for phototropism. Science 282: 16981701 Crépieux P, Kwon H, Leclerc N, Spencer W, Richard S, Lin R, Hiscott J (1997) I kappaB alpha physically interacts with a cytoskeleton-associated protein through its signal response domain. Mol Cell Biol 17: 73757385[Abstract]
Emi T, Kinoshita T, Shimazaki K (2001) Specific binding of vf14-3-3a isoform to the plasma membrane H+-ATPase in response to blue light and fusicoccin in guard cells of broad bean. Plant Physiol 125: 11151125 Eun S-O, Lee Y (1997) Actin filaments of guard cells are reorganized in response to light and abscisic acid. Plant Physiol 115: 14911498[Abstract]
Fukuda M, Hasezawa S, Asai N, Nakajima N, Kondo N (1998) Dynamic organization of microtubules in guard cells of Vicia faba L. with diurnal cycle. Plant Cell Physiol 39: 8086 Gallagher S, Winston SE, Hurrell JGR (1992) Immunoblotting and immunodetection. In FM Ausubel, R Brent, RE Kingston, DD Moore, JG Seidman, JA Smith, K Struhl, eds, Current Protocols in Molecular Biology. Greene Publishing and Wiley-Interscience, New York, pp 10.8.110.8.16 Hedrich R, Schroeder JI (1989) The physiology of ion channels and electrogenic pumps in higher plants. Annu Rev Plant Physiol 40: 539569 Herzig RP, Andersson U, Scarpulla RC (2000) Dynein light chain interacts with NRF-1 and EWG, structurally and functionally related transcription factors from humans and Drosophila. J Cell Sci 113: 42634273[Abstract]
Huala E, Oeller PW, Liscum E, Han IS, Larsen E, Briggs WR (1997) Arabidopsis NPH1: a protein kinase with a putative redox-sensing domain. Science 278: 21202123
Hwang J-U, Lee Y (2001) Abscisic acid-induced actin reorganization in guard cells of dayflower is mediated by cytosolic calcium levels and by protein kinase and protein phosphatase activities. Plant Physiol 125: 21202128 Hwang J-U, Suh S, Yi H, Kim J, Lee Y (1997) Actin filaments modulates both stomatal opening and inward K+-channel activities in guard cells of Vicia faba L. Plant Physiol 115: 335342[Abstract]
Inada S, Ohgishi M, Mayama T, Okada K, Sakai T (2004) RPT2 is a signal transducer involved in phototropic response and stomatal opening by association with phototropin1 in Arabidopsis thaliana. Plant Cell 16: 887896
Jaffrey SR, Snyder SH (1996) PIN: an associated protein inhibitor of neuronal nitric oxide synthase. Science 274: 774777
Kagawa T, Sakai T, Suetsugu N, Oikawa K, Ishiguro S, Kato T, Tabata S, Okada K, Wada M (2001) Arabidopsis NPL1: a phototropin homolog controlling the chloroplast high-light avoidance response. Science 291: 21382141 Kim M, Hepler PK, Eun S-O, Ha KS, Lee Y (1995) Actin filaments in mature guard cells are radially distributed and involved in stomatal movement. Plant Physiol 109: 10771084[Abstract] King SM (2000) The dynein microtubule motor. Biochim Biophys Acta 1496: 6075[Medline]
King SM, Patel-King RS (1995) The Mr=8,000 and 11,000 outer arm dynein light chains from Chlamydomonas flagella have cytoplasmic homologues. J Biol Chem 270: 1144511452 Kinoshita T, Doi M, Suetsugu N, Kagawa T, Wada M, Shimazaki K (2001) phot1 and phot2 mediate blue light regulation of stomatal opening. Nature 414: 656660[CrossRef][Medline]
Kinoshita T, Emi T, Tominaga M, Sakamoto K, Shigenaga A, Doi M, Shimazaki K (2003) Blue-light-and phosphorylation-dependent binding of a 14-3-3 protein to phototropins in stomatal guard cells of broad bean. Plant Physiol 133: 14531463 Kinoshita T, Shimazaki K (1999) Blue light activates the plasma membrane H+-ATPase by phosphorylation of the C-terminus in stomatal guard cells. EMBO J 18: 55485558[CrossRef][Web of Science][Medline] Kost B, Spielhofer P, Chua NH (1998) A GFP-mouse talin fusion protein labels plant actin filaments in vivo and visualizes the actin cytoskeleton in growing pollen tubes. Plant J 16: 393401[CrossRef][Web of Science][Medline]
Lahav M, Abu-Abied M, Belausov E, Schwartz A, Sadot E (2004) Microtubules of guard cells are light sensitive. Plant Cell Physiol 45: 573582 Lawrence CJ, Morris NR, Meagher RB, Dawe RK (2001) Dyneins have run their course in plant lineage. Traffic 2: 362363[CrossRef][Medline] Lupas A (1996) Coiled coils: new structures and new functions. Trends Biochem Sci 21: 375382[CrossRef][Web of Science][Medline]
Marcus AI, Moore RC, Cyr RJ (2001) The role of microtubules in guard cell function. Plant Physiol 125: 387395
Motchoulski A, Liscum E (1999) Arabidopsis NPH3: a NPH1 photoreceptor-interacting protein essential for phototropism. Science 286: 961964 Olson KR, McIntosh JR, Olmsted JB (1995) Analysis of MAP4 function in living cells using green fluorescent protein (GFP) chimeras. J Cell Biol 130: 636650 Puthalakath H, Huang DCS, O'Reilly LA, King SM, Strasser A (1999) The proapoptotic activity of the Bcl-2 family member Bim is regulated by interaction with the dynein motor complex. Mol Cell 3: 287296[CrossRef][Web of Science][Medline]
Sakai T, Kagawa T, Kasahara M, Swartz TE, Christie JM, Briggs WR, Wada M, Okada K (2001) Arabidopsis nph1 and npl1: blue light receptors that mediate both phototropism and chloroplast relocation. Proc Natl Acad Sci USA 98: 69696974
Sakai T, Wada T, Ishiguro S, Okada K (2000) RPT2: a signal transducer of the phototropic response in Arabidopsis. Plant Cell 12: 225236
Sakamoto K, Briggs WR (2002) Cellular and subcellular localization of phototropin1. Plant Cell 14: 17231735 Salomon M, Christie JM, Knieb E, Lempert U, Briggs WR (2000) Photochemical and mutational analysis of the FMN-binding domains of the plant blue light receptor, phototropin. Biochemistry 39: 94019410[CrossRef][Medline] Salomon M, Knieb E, von Zeppelin T, Rüdiger W (2003) Mapping of low- and high-fluence autophosphorylation sites in phototropin 1. Biochemistry 42: 42174225[CrossRef][Medline] Schroeder JI, Allen GJ, Hugouvieux V, Kwak JM, Waner D (2001) Guard cell signal transduction. Annu Rev Plant Physiol Plant Mol Biol 52: 627658[CrossRef][Web of Science][Medline] Schwartz A, Zeiger E (1984) Metabolic energy for stomatal opening. Roles of photophosphorylation and oxidative phosphorylation. Planta 161: 129136[CrossRef]
Shimazaki K, Gotow K, Kondo N (1982) Photosynthetic properties of guard cell protoplasts from Vicia faba L. Plant Cell Physiol 23: 871879 Shimazaki K, Iino M, Zeiger E (1986) Blue light-dependent proton extrusion by guard-cell protoplasts of Vicia faba. Nature 319: 324326[CrossRef]
Shimazaki K, Kinoshita T, Nishimura M (1992) Involvement of calmodulin and calmodulin-dependent myosin light chain kinase in blue light-dependent H+ pumping by guard cell protoplasts from Vicia faba L. Plant Physiol 99: 14161421 Tai AW, Chuang JZ, Bode C, Wolfrum U, Sung CH (1999) Rhodopsin's carboxy-terminal cytoplasmic tail acts as a membrane receptor for cytoplasmic dynein by binding to the dynein light chain Tctex-1. Cell 97: 877887[CrossRef][Web of Science][Medline]
Tai AW, Chuang JZ, Sung CH (1998) Localization of Tctex-1, a cytoplasmic dynein light chain, to the Golgi apparatus and evidence for dynein complex heterogeneity. J Biol Chem 273: 1963919649 This article has been cited by other articles:
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ASPB Publications | PLANT PHYSIOLOGY® | THE PLANT CELL | |
|---|---|---|---|