|
|
||||||||
|
First published online June 17, 2005; 10.1104/pp.104.057638 Plant Physiology 138:1700-1710 (2005) © 2005 American Society of Plant Biologists The Maize Root Transcriptome by Serial Analysis of Gene Expression1,[w]Department of Plant Biology (V.P., H.J.B.) and Department of Crop Sciences (H.J.B.), University of Illinois, Urbana, Illinois 61801; and Division of Plant Sciences, Plant Sciences Unit (L.G.H., W.G.S., H.T.N., R.E.S.), and Department of Computer Science (G.K.S.), University of Missouri, Columbia, Missouri 652117145
Serial Analysis of Gene Expression was used to define number and relative abundance of transcripts in the root tip of well-watered maize seedlings (Zea mays cv FR697). In total, 161,320 tags represented a minimum of 14,850 genes, based on at least two tags detected per transcript. The root transcriptome has been sampled to an estimated copy number of approximately five transcripts per cell. An extrapolation from the data and testing of single-tag identifiers by reverse transcription-PCR indicated that the maize root transcriptome should amount to at least 22,000 expressed genes. Frequency ranged from low copy number (25, 68.8%) to highly abundant transcripts (100 1,200; 1%). Quantitative reverse transcription-PCR for selected transcripts indicated high correlation with tag frequency. Computational analysis compared this set with known maize transcripts and other root transcriptome models. Among the 14,850 tags, 7,010 (47%) were found for which no maize cDNA or gene model existed. Comparing the maize root transcriptome with that in other plants indicated that highly expressed transcripts differed substantially; less than 5% of the most abundant transcripts were shared between maize and Arabidopsis (Arabidopsis thaliana). Transcript categories highlight functions of the maize root tip. Significant variation in abundance characterizes transcripts derived from isoforms of individual enzymes in biochemical pathways.
Serial Analysis of Gene Expression (SAGE) provides an accurate view of expressed genes in tissues or cells, the identification of transcripts, and also permits analyses that compare changes in transcript populations of organisms exposed to different conditions or between distantly related organisms (Velculescu et al., 1995
In contrast to its application in animal systems, where millions of tags have been recorded, SAGE has only recently received attention in plant research. SAGE collections are available for rice seedlings (Oryza sativa; Matsumura et al., 1999
More recently, Massively Parallel Signature Sequencing (MPSS) identifiers have been generated that support the analysis of transcriptome complexity (Meyers et al., 2004a
We have used SAGE to determine the complexity of the maize (Zea mays) root transcriptome. RNA from the primary root of well-watered seedlings was converted into a SAGE library. In total, 161,320 SAGE tags were collected, resulting in the detection of 14,850 expressed genes. In a combination of methods for tag annotation, a set of virtual tags was extracted from maize expressed sequence tag (EST) collections by the V-SAGE algorithm (Poroyko et al., 2004
A Maize Root SAGE Library A SAGE library has been generated with RNA from well-watered primary roots of maize (line FR697) seedlings. In total, 3,652 clones were sequenced, from which 161,320 tags could be extracted (approximately 44 tags/clone). Tags recorded only once (25,749; 15.96%) were initially eliminated because they could represent sequencing errors, contamination, or cloning artifacts (but see below). Thus, 135,571 tags that appeared at least twice were accepted as statistically significant. The distribution of tags according to frequency is shown in Table I, listing 14,850 tags that appeared multiple times with the tag of highest frequency recorded 1,233 times. The majority of the accepted unambiguous unitags, 10,222 in total (68.8%), were present at low copy number (less than five copies), 4,474 tags (30%) were counted between 6 and 99 times, and 154 tags (1%) were present in copy numbers 100 or higher.
Determination of the Maize Root Transcriptome Size
The presence of 14,850 unique tags indicated a minimum number of expressed genes, which does not represent the entire maize root transcriptome. When the number of unique new tags appearing at different periods during DNA sequencing was graphed against the total number of sequenced tags, an extrapolation indicated between 17,000 and 19,000 expressed genes (Fig. 1A). Application of an alternative method, a double-reciprocal plot of all unique tags of identified transcripts versus the total number of tags sequenced after each sequencing interval (Ekman et al., 2003
To test the possibility that single tags might represent genuine, rare transcripts, we used two strategies to analyze the 25,749 single and unidentified tags. When these orphan tags were compared to the V-SAGE collection of transcripts from the maize root, 3,072 single tags matched sequences in this collection. Alternatively, assuming that the single-tag collection might include single-nucleotide sequencing errors, we analyzed the 25,749 single tags again by a program that allowed one base to be variable. This converted 14,485, or 9% of the total number, of the single tags into tags that had been recorded before. A similar percentage, 8%, has been calculated as errors in sequencing in a SAGE analysis of the yeast transcriptome (Velculescu et al. 1997
To identify genes that corresponded to the 14,850 different unitags detected, virtual tags were extracted from known databases. As the reference sequence pool, 17,901 maize root cDNA sequences were available which had been sequenced from the 3'-end that included poly(A) tails. These sequences represented four maize cDNA libraries sequenced from the 3'-end that have been deposited in the NCBI database. The metadata for this collection of root cDNAs are available at http://rootgenomics.missouri.edu, and summarized in Supplemental Table I. All ESTs showed poly(A)+ structures from which the Perl-script V-SAGE (Poroyko et al., 2004 A second approach used BLAST searches to identify exact matches of the SAGE tags in the NCBI database, maize UniGene Build number 40. This set consists of a set of 12,995 nonredundant maize unigenes. Searches by BLASTN of the 14-bp SAGE tags allowed matches to specific genes. Only matches with 100% identity (14 bp) to the mRNA-like strand were accepted. Strand orientation of sequences deposited in the maize UniGene set were determined by BLASTX in comparison with a database of 29,161 Arabidopsis putatively translated protein sequences and the NCBI nonredundant protein database. In total, 5,192 tags were identified for this collection of maize cDNAs. By combining both approaches, 7,840 tags have been identified (Supplemental Table I): 2,976 tags in both reference databases, an additional 2,648 in the EST-based V-SAGE database, and 2,216 matched the UniGene set number 40 for maize deposited in NCBI. For tags that appeared in low abundance, the NCBI maize UniGene Build number 40 retrieved more hits than the V-SAGE collection.
For a number of low-complexity tags, for example CATGNAAAAAAAAA, multiple hits are inevitable. Such tags have been reported before for the Arabidopsis and loblolly pine transcriptomes (Lorenz and Dean, 2002
Fifty-five SAGE tags that had appeared in only one copy were randomly selected to control for the possible presence of extremely rare transcripts. The sequences of these single tags were used in a procedure designed for the generation of long cDNA fragments from SAGE tags for gene identification (GLGI protocol; Chen et al., 2002b
Validation of SAGE by Quantitative RT-PCR
Transcripts for validation by quantitative RT-PCR (qPCR) were chosen to represent tags that appeared with different frequencies to test redundancy reported by SAGE using an independent method. Primers for qPCR were chosen to contain the SAGE tag sequences anchored by a second primer to amplify a region approximately 115 bp upstream of the tag. A comparison of transcript abundance by SAGE and real-time PCR (Table II) revealed general correlation. Products from highly abundant SAGE tags appeared at the expected lower cycle numbers in the quantitative PCR analyses. For example, the tag for CF636411 (971 copies) appeared six cycles earlier than the tag for CF634719 (two copies), i.e. in both measurements a several hundred-fold difference was observed. In addition, quantitative real-time PCR allowed for an estimation of transcript abundance of the sampled tags. In addition, we compared the SAGE tag representation with data for 379 signals with very low intensity obtained by microarray hybridizations with RNA from the same tissue. The correlation between SAGE tag number and microarray intensity signal was 0.93. The results indicated that deviations were most common for transcripts with high %G+C (P. Li, V. Poroyko, and H.J. Bohnert, unpublished data). The data can be used to determine the depth to which the maize root transcriptome had at this stage been sampled. Assuming the total RNA amount for eukaryotic cells to be 13 pg (Okamura and Goldberg, 1989
The SAGE profile of the Arabidopsis root reported 80 transcripts with tag copies exceeding 100 (up to 830 copies). These tags represented 12.9% of 144,083 tags. When sampling to the same depth of tags in maize (161,320 tags), 125 tag sequences with copy numbers ranging from 1,233 to 112 were observed. A comparison of root transcript frequencies in different species might provide an indication about similarity or divergence in root function (Table III). These abundant tags in maize and Arabidopsis showed little overlap in transcript identity or functional category. Only three transcripts in this high-abundance class were identical in both species. One transcript encoded a 40S ribosomal protein, S11 (maize tag no. 75; 153 copies) corresponding to Arabidopsis tag number 48 (158 copies). Second, a functionally unknown transcript (maize), which included the functional domain of a mitochondrial ADP/ATP carrier protein (maize tag no. 37; 231 copies), equivalent to Arabidopsis tag number 41 (165 copies; annotated as adenylate translocator). The third overlap was the 40S ribosomal protein S9 for maize tag number 19 (323 copies) and Arabidopsis tag number 70 (112 copies). When high abundance is disregarded, of the 80 most abundant tags/transcripts in Arabidopsis, 20 were also detected in maize, but most of the maize sequences were present at much lower abundance. The list (Table III) exemplifies instances where an Arabidopsis tag (GACTCTCTTA) identifies more than one gene (At3g45030 and At5g60390). Equally, cases are included where multiple tags for a particular single gene have been identified in maize, exemplifying the presence of alternatively spliced transcripts and variable 3'-end formation.
Table IV compares functional categories, according to COG (NCBI), for the most highly abundant Arabidopsis and maize transcripts detected by SAGE analyses. The juxtaposition of categories indicated general similarity, for example in transcripts in the categories ribosome biogenesis and translation, which included many of the most abundant transcripts, posttranslational modification, and ion transport. Also, transcripts for proteins in secondary metabolism were similarly numerous in both species. Differences among the groups of highly expressed transcripts existed between the two species in the categories RNA processing, chromatin structure, cytoskeleton, and energy production, which were more abundant in maize, and in the categories defense mechanisms and cell wall biogenesis, which were more abundant in Arabidopsis. In part at least, these differences may be due to the fact that the maize SAGE profile sampled the apical 20 mm of the root while the Arabidopsis profile included the entire root. Also, the Arabidopsis roots were from 4- to 5-week-old rosette plants while in this experiment the primary root of young seedlings was harvested.
Transcripts for Biochemical Pathways, Transport Facilitators, and Gene Expression Control in Maize Roots We present data on transcript complexity in the maize root for selected functional categories: TFs (Supplemental Table IIA), ion transporters and channels (Supplemental Table IIB), and several biochemical pathways (Fig. 3; Supplemental Table III, AE) in a comparison with Arabidopsis models (The Arabidopsis Information Resource [TAIR], AraCyc: Arabidopsis Biochemical Pathways; http://www.arabidopsis.org/biocyc/). For example, multiple tags have been found representing transcripts for enzymes in all steps of the glycolysis pathway, with a significantly higher number of copies for two enzymes that are known to strongly influence the passage of metabolites through this pathway: Fru bisphosphate aldolase and glyceraldehyde phosphate dehydrogenase (Fig. 3A). Similarly, transcript abundance for enzymes in the oxidative pentose phosphate pathway (Fig. 3B), Suc metabolism (Fig. 3C), lignin biosynthesis (Fig. 3D), and sulfur assimilation (Fig. 3E) show different tag numbers for transcripts of individual enzymes in the respective pathways.
The analysis of tags revealed the expression of at least 44 TFs (Supplemental Table IIA). Many of the sequences encode proteins with a domain structure indicative of TFs, although their involvement in the regulation of gene expression, and in some cases their identity as TFs, has not been demonstrated. Some TFs that have been analyzed in other models are present, however. Unsurprisingly, components of the general transcription complex are present; e.g. subunits of the TFII complex or for the RNA-polymerase II complex are found. Others encode zinc-finger TFs. Included also are GATA-type, LIM, and several less studied factors in the bHLH and bZIP families and TFs, such as knotted or HBP-1a/b, that influence development and/or chromatin structure. Of obvious importance for root functioning are transport facilitators, transporters, and channels. The SAGE profile showed 70 tags (for 54 different transcripts) that clearly identified functions in this category (Supplemental Table IIB). Apart from putative, uncharacterized transport proteins (31), the list includes a variety of functionally known cation and anion, carbohydrate, amino acid, and ABC-type transporters of the plasma membrane and, in addition, intracellular transport proteins. Transcripts for three K+-channel proteins and three voltage-dependent anion channel proteins were among the most abundant SAGE tags.
SAGE provides an economical way to sample transcript profiles under specific experimental conditions. Sequencing of a relatively small number of clones will result in identifying the majority of expressed genes, which in our example provided nearly 15,000 unigenes after sequencing of 3,652 clones. A crucial element and potential problem in SAGE studies is tag-to-gene assignment with two approaches for a resolution (Lee et al., 2002
The results of several studies using SAGE on plant tissue have been reported recently. SAGE has been used for a study of gene expression in rice seedlings to a depth of approximately 10,000 tags (Matsumura et al., 1999
Specifically for root tissues, SAGE (approximately 32,000 tags) has been used to profile transcript complexity in Arabidopsis and to assess responses to TNT (Ekman et al., 2003
The complexity of the maize root transcriptome is comparable with estimates of the complexity for the Arabidopsis root transcript population. Our analyses may indicate that the number could exceed 22,000 transcripts. This is based on attempts to analyze the origin of unmatched (single) tags from human tissues, using PCR amplification of approximately 1,000 of such orphan matches in a collection of 4,285,923 SAGE tags (Chen et al., 2002a
Information about transcript abundance is an important aspect of the SAGE analysis of the maize root because it can provide a control for many other analyses. In our hands, SAGE provided a more accurate or sensitive representation of the transcript population, in particular with respect to variability of 3'-end formation. Accuracy and completeness of SAGE profiling has been analyzed in a comparison of 76,790 tags for transcripts from rat hippocampal tissue with Affymetrix genechip data (Evans et al., 2002
The value of this tag collection will increase as more maize genomic sequences become available. For example, the genechip-based analysis of the Arabidopsis root (Birnbaum et al., 2003 The results from this analysis will become accessible to reinterpretation once a larger segment of the maize genome is available. First, the number of alternatively terminated transcripts is high and may reveal functions in RNA turnover, silencing, or targeting, or may have a developmental and cell specificity role as documented in the Supplemental Table II where identical accession numbers identify different 3'-end tags for the same transcript. The presence of tags that match more than one gene can be resolved only when the genome has been sequenced. Importantly, exemplified in Figure 3, transcripts for proteins in primary metabolism provide information that surpasses what can be obtained by microarray analysis. Also, the diversity of transcript numbers for different enzymes/proteins in a pathway and the expression of different isoforms for pathway enzymes reveal information about regulatory circuits, pathway networks, and possibly even protein half-life. Recording SAGE or MPSS tags in tissues and cells, at various developmental stages or under diverse experimental manipulations in the most widely used models and crop species, will eventually provide baseline values for true transcript complexity and abundance.
Root Material, RNA Isolation, and SAGE Library Construction
Maize (Zea mays L. cv FR697) seeds were imbibed for 24 h in 1 mM CaSO4 and were germinated for 28 h in vermiculite well moistened with 1 mM CaSO4 at 29°C in the dark (Spollen et al., 2000
The library was plated on agar with zeocin 50 µg/mL and colonies were picked. Bacteria were inoculated into 96-well-deep culture plates with Luria-Bertani medium and grown overnight. Plasmid DNA was purified from bacterial cultures using the Qiagen-9600 BioRobot. Sequencing reactions were performed by BigDye terminator chemistry (Applied Biosystems, Foster City, CA) using the standard primer M13 reverse for 48. Sequencing of clones was carried out with ABI3700 and ABI3730xl capillary systems at the Keck Center, University of Illinois Urbana-Champaign.
For SAGE library analysis and SAGE tag extraction the SAGE-2000 v4.5 software package was used (http://www.invitrogen.com/sage). SAGE tags were identified in two ways (Lee et al., 2002
Functional categorization and annotation for parental maize datasets was done according to clustering of orthologous groups for eukaryotic complete genomes NCBI (http://www.ncbi.nlm.nih.gov/COG/) (Tatusov et al., 1997
For RT, 2 µg of total RNA were used. Reactions were done using Superscript II (Invitrogen) according to the manufacturer's instructions. The product of the RT reaction was diluted by a factor of 20 and used as a template for quantitative PCR. Reactions were performed using Smart Cycler (Cepheid, Sunnyvale, CA). Primers for qPCR were designed to produce amplicons of equal size (approximately 115 bp; Supplemental Table IVA). Primers selected for low-complexity tags are used as an additional test of SAGE veracity (Supplemental Table IVB). The composition of reaction mixtures for quantitative PCR (final volume 25 µL) was 12.5 µL Sybr green master mix (Applied Biosystems), 2 µL of diluted cDNA template, and 1 µL of each (10 µM) of the primers. The PCR amplification program included one cycle at 95°C (15 min), 40 cycles at 95°C (each 15 s), 60°C (30 s), 72°C (30 s), and one cycle at 72°C (2 min). Melting curves for each product were made by heating of from 60°C to 95°C at 0.2°C/s. All melting curves generated a single melting point, indicating homogeneity of the products.
Absolute copy number amounts were determined by a standard curve for each selected amplicon as described (QuantiTect SYBR Green PCR; Qiagen). The transcript-per-cell ratio was calculated by the formula: C = 2,600*N/m, with C, transcript per cell amount; N, number of molecules determined in a QPCR reaction; m, amount of RNA taken for RT (pg). The value of 2,600 represents a constant derived from sample dilution and total RNA amount per eukaryotic cell (estimated at 13 pg; see Okamura and Goldberg, 1989
The same total RNA sample used for SAGE analyses was used for GLGI. RT was done by using Superscript III (Invitrogen), 4 µg of total RNA and 3' adapter primer ACTATCTAGAGCGGCCGCTTTTTTTTTTTTTTTTTTN at a final concentration of 5 µM. The reaction conditions were selected according the manufacturer instructions. Finally, the RT reaction was diluted 10 times (ddH2O) and used for subsequent amplification. Tag-specific amplification used the Peltier Thermal Cycler (C225, MJ Research, Reno, NV). The GLGI master mixture containing the antisense primer, cDNA template, and DNA polymerase was prepared: 21 µL per reaction, including 10 µL of Eppendorf MasterMix (2.5x) (Eppendorf, Westbury, NY), 4 µL of 3' universal amplification primer ACTATCTAGAGCGGCCGCTT (10 µM), 7 µL of diluted template. The tag-specific sense primer 4 µL (10 µM) then was added to each well GGATCCCATG[XXXXXXXXXX]. The tag-specific 5' primers were designed for 55 randomly selected single-copy SAGE tags (Supplemental Table V). The PCR conditions used were as follows (Chen et al., 2002b
We thank Dr. Alvaro Hernandez and Dr. Ryan Kim (University of Illinois Urbana-Champaign) and Ruth Grene (Virginia Tech University) for discussions, and the team at the Keck Center for Comparative and Functional Genomics and Vladimir Calugaru for help. The data discussed here have been incorporated into a database, supplemental tables are part of this manuscript, and data are available from a project Web site: http://rootgenomics.missouri.edu/prgc/index.html. Received January 26, 2005; returned for revision March 15, 2005; accepted March 21, 2005.
1 This work was supported by the National Science Foundation (grant nos. DBI0223905 and DBI0211842) and by University of Illinois Urbana-Champaign and University of Missouri institutional grants.
[w] The online version of this article contains Web-only data. Article, publication date, and citation information can be found at www.plantphysiol.org/cgi/doi/10.1104/pp.104.057638. * Corresponding author; e-mail bohnerth{at}life.uiuc.edu; fax 2173335574.
Anisimov SV, Tarasov KV, Stern MD, Lakatta EG, Boheler KR (2002) A quantitative and validated SAGE transcriptome reference for adult mouse heart. Genomics 80: 213222[CrossRef][Web of Science][Medline] Arabidopsis Genome Initiative (2000) Analysis of the genome sequence of the flowering plant Arabidopsis thaliana. Nature 408: 796815[CrossRef][Medline]
Birnbaum K, Shasha DE, Wang JY, Jung JW, Lambert GM, Galbraith DW, Benfey PN (2003) A gene expression map of the Arabidopsis root. Science 302: 19561960
Boon K, Osório EC, Greenhut SF, Schaefer CF, Shoemaker J, Polyak K, Morin PJ, Buetow KH, Strausberg RL, de Souza SJ, et al (2002) An anatomy of normal and malignant gene expression. Proc Natl Acad Sci USA 99: 1128711292 Chen J, Lee S, Zhou G, Wang SM (2002b) High-throughput GLGI procedure for converting a large number of serial analysis of gene expression tag sequences into 3' complementary DNAs. Genes Chromosomes Cancer 33: 252261[CrossRef][Web of Science][Medline]
Chen J, Sun M, Lee S, Zhou G, Rowley JD, Wang SM (2002a) Identifying novel transcripts and novel genes in the human genome by using novel SAGE tags. Proc Natl Acad Sci USA 99: 1225712262 Ding C, Cantor CR (2004) Quantitative analysis of nucleic acids: the last few years of progress. J Biochem Mol Biol 37: 110[Web of Science][Medline]
Ekman DR, Lorenz WW, Przybyla AE, Wolfe NL, Dean JFD (2003) SAGE analysis of transcriptome responses in Arabidopsis roots exposed to 2,4,6-trinitrotoluene. Plant Physiol 133: 13971406 Evans SJ, Datson NA, Kabbaj M, Thompson RC, Vreugdenhil E, De Kloet ER, Watson SJ, Akil H (2002) Evaluation of Affymetrix Gene Chip sensitivity in rat hippocampal tissue using SAGE analysis. Eur J Neurosci 16: 409413[CrossRef][Web of Science][Medline]
Fizames C, Muñis S, Cazettes C, Nacry P, Boucherez J, Gaymard F, Piquemal D, Delorme V, Commes T, Doumas P, et al (2004) The Arabidopsis root transcriptome by serial analysis of gene expression: gene identification using the genome sequence. Plant Physiol 134: 6780 Gibbings JG, Cook BP, Dufault MR, Madden SL, Khuri S, Turnbull CJ, Dunwell JM (2003) Global transcript analysis of rice leaf and seed using SAGE technology. Plant Biotechnol J 1: 271285[CrossRef][Medline]
Gowda M, Jantasuriyarat C, Dean RA, Wang GL (2004) Robust-LongSAGE (RL-SAGE): a substantially improved LongSAGE method for gene discovery and transcriptome analysis. Plant Physiol 134: 890897
Huang X, Madan A (1999) CAP3: a DNA sequence assembly program. Genome Res 9: 868877
Jansen R, Gerstein M (2000) Analysis of the yeast transcriptome with structural and functional categories: characterizing highly expressed proteins. Nucleic Acids Res 28: 14811488 Jung SH, Lee JY, Lee DH (2003) Use of SAGE technology to reveal changes in gene expression in A. thaliana leaves undergoing cold stress. Plant Mol Biol 52: 553567[CrossRef][Web of Science][Medline]
Lee JY, Lee DH (2003) Use of serial analysis of gene expression technology to reveal changes in gene expression in Arabidopsis pollen undergoing cold stress. Plant Physiol 132: 517529 Lee S, Clark T, Chen J, Zhou G, Scott LR, Rowley JD, Wang SM (2002) Correct identification of genes from serial analysis of gene expression tag sequences. Genomics 79: 598602[CrossRef][Web of Science][Medline]
Liang P (2002) SAGE Genie: a suite with panoramic view of gene expression. Proc Natl Acad Sci USA 99: 1154711548 Lorenz WW, Dean JFD (2002) SAGE profiling and demonstration of differential gene expression along the axial developmental gradient of lignifying xylem in loblolly pine (Pinus taeda). Tree Physiol 22: 301310[Abstract] Matsumura H, Nirasawa S, Terauchi R (1999) Transcript profiling in rice (O. sativa L.) seedlings using serial analysis of gene expression (SAGE). Plant J 20: 719726[CrossRef][Web of Science][Medline]
Meyers BC, Lee DK, Vu TH, Tej SS, Edberg SB, Matvienko M, Tindell LD (2004a) Arabidopsis MPSS: an online resource for quantitative expression analysis. Plant Physiol 135: 801813
Meyers BC, Tej SS, Vu TH, Haudenschild CD, Agrawal V, Edberg SB, Ghazal H, Decola S (2004b) The use of MPSS for whole-genome transcriptional analysis in Arabidopsis. Genome Res 14: 16411653 Okamura JK, Goldberg RB (1989) Regulation of plant gene expression: general principles. In A Marcus, ed, The Biochemistry of Plants, Vol 15. Academic Press, San Diego, pp 182 Osato N, Yamada H, Satoh K, Ooka H, Yamamoto M, Suzuki K, Kawai J, Carninci P, Ohtomo Y, Murakami K, et al (2003) Antisense transcripts with rice full-length cDNAs. Genome Biol 5: R5 Poroyko V, Calugaru V, Fredricksen M, Bohnert HJ (2004) Virtual-SAGE: a new approach to EST data analysis. DNA Res 11: 145152[Abstract]
Robinson SJ, Cram DJ, Lewis CT, Parkin IA (2004) Maximizing the efficacy of SAGE analysis identifies novel transcripts in Arabidopsis. Plant Physiol 136: 32233233
Saab IN, Sharp RE, Pritchard J, Voetberg GS (1990) Increased endogenous abscisic acid maintains primary root growth and inhibits shoot growth of maize seedlings at low water potentials. Plant Physiol 93: 13291336 Saha S, Sparks AB, Rago C, Akmaev V, Wang CJ, Vogelstein B, Kinzler KW, Velculescu VE (2002) Using the transcriptome to annotate the genome. Nat Biotechnol 20: 508512[CrossRef][Web of Science][Medline]
Sharp RE, Poroyko V, Hejlek LG, Spollen WG, Springer GK, Bohnert HJ, Nguyen HT (2004) Root growth maintenance during water deficits: physiology to functional genomics. J Exp Bot 55: 23432351
Spollen WG, LeNoble ME, Samuels TD, Bernstein N, Sharp RE (2000) Abscisic acid accumulation maintains maize primary root elongation at low water potentials by restricting ethylene production. Plant Physiol 122: 967976
Stern MD, Anisimov SV, Boheler KR (2003) Can transcriptome size be estimated from SAGE catalogs? Bioinformatics 19: 443448 Tatusov RL, Fedorova ND, Jackson JD, Jacobs AR, Kiryutin B, Koonin EV, Krylov DM, Mazumder R, Mekhedov SL, Nikolskaya AN, et al (2003) The COG database: an updated version including eukaryotes. BMC Bioinformatics 4: 41[CrossRef][Medline]
Tatusov RL, Koonin EV, Lipman DJ (1997) A genomic perspective on protein families. Science 278: 631637 Tuteja R, Tuteja N (2004) Serial analysis of gene expression: applications in malaria parasite, yeast, plant, and animal studies. J Biomed Biotechnol 2: 106112
Unneberg P, Wennborg A, Larsson M (2003) Transcript identification by analysis of short sequence tags: influence of tag length, restriction site and transcript database. Nucleic Acids Res 31: 22172226
Velculescu VE, Zhang L, Vogelstein B, Kinzler KW (1995) Serial analysis of gene expression. Science 270: 484487 Velculescu VE, Zhang L, Zhou W, Vogelstein J, Basrai MA, Bassett DE, Hieter P, Vogelstein B, Kinzler KW (1997) Characterization of the yeast transcriptome. Cell 88: 243251[CrossRef][Web of Science][Medline]
Wei CL, Ng P, Chiu KP, Wong CH, Ang CC, Lipovich L, Liu ET, Ruan Y (2004) 5' Long serial analysis of gene expression (Long-SAGE) and 3' Long-SAGE for transcriptome characterization and genome annotation. Proc Natl Acad Sci USA 101: 1170111706 Related articles in Plant Physiol.:
This article has been cited by other articles:
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ASPB Publications | PLANT PHYSIOLOGY® | THE PLANT CELL | |
|---|---|---|---|