|
|
||||||||
|
First published online June 10, 2005; 10.1104/pp.105.060327 Plant Physiology 138:1723-1733 (2005) © 2005 American Society of Plant Biologists Mutational Decay and Age of Chloroplast and Mitochondrial Genomes Transferred Recently to Angiosperm Nuclear Chromosomes1,[w]Australian Centre for Plant Functional Genomics, School of Agriculture and Wine, University of Adelaide, Waite Campus, Glen Osmond, South Australia 5064, Australia (C.Y.H.); Institute of Botany III, University of Duesseldorf, 40225 Duesseldorf, Germany (N.G., N.A., W.M.); and School of Molecular and Biomedical Sciences, University of Adelaide, South Australia 5005, Australia (J.N.T.)
Transfers of organelle DNA to the nucleus established several thousand functional genes in eukaryotic chromosomes over evolutionary time. Recent transfers have also contributed nonfunctional plastid (pt)- and mitochondrion (mt)-derived DNA (termed nupts and numts, respectively) to plant nuclear genomes. The two largest transferred organelle genome copies are 131-kb nuptDNA in rice (Oryza sativa) and 262-kb numtDNA in Arabidopsis (Arabidopsis thaliana). These transferred copies were compared in detail with their bona fide organelle counterparts, to which they are 99.77% and 99.91% identical, respectively. No evidence for purifying selection was found in either nuclear integrant, indicating that they are nonfunctional. Mutations attributable to 5-methylcytosine hypermutation have occurred at a 6- to 10-fold higher rate than other point mutations in Arabidopsis numtDNA and rice nuptDNA, respectively, revealing this as a major mechanism of mutational decay for these transferred organelle sequences. Short indels occurred preferentially within homopolymeric stretches but were less frequent than point mutations. The 131-kb nuptDNA is absent in the O. sativa subsp. indica or Oryza rufipogon nuclear genome, suggesting that it was transferred within the O. sativa subsp. japonica lineage and, as revealed by sequence comparisons, after its divergence from the indica chloroplast lineage. The time of the transfer for the rice nupt was estimated as 148,000 (74,000296,000) years ago and that for the Arabidopsis numtDNA as 88,000 (44,000176,000) years ago. The results reveal transfer and integration of entire organelle genomes into the nucleus as an ongoing evolutionary process and uncover mutational mechanisms affecting organelle genomes recently transferred into a new mutational environment.
Mitochondria (mt) and plastids (pt) are the descendants of once free-living prokaryotes, a proteobacterium and a cyanobacterium, respectively. During evolution, the bulk of their nuclear genomes has either been transferred to the eukaryotic host genome or lost, such that only remnants of the prokaryotic genomes are retained in the extant organelles (Timmis et al., 2004
Most of the nuclear-integrated DNA segments that have been transferred from mitochondria (numts) and plastids (nupts) are currently less than 1 kb in length (Ricchetti et al., 1999
Mutations in Oryza nuptDNA
Three rice plastid genome sequences are currently available for comparison with the 131-kb nuptDNA on chromosome 10 of rice: those of O. sativa subsp. japonica (Hiratsuka et al. [1989]
The japonica rice (cv Nipponbare) nuptDNA bears 39, 43, and 47 indels relative to the indica, nivara, and japonica chloroplast genomes, respectively. The majority of these indels entail single nucleotides (Fig. 2A). Indels in ptDNA-nupt comparisons were approximately 2- to 3-fold more frequent than in comparisons of the indica-nivara (13 indels), indica-japonica (16), and nivara-japonica (21) chloroplast genomes (Fig. 2B).
There were 271, 292, and 297 isolated single-nucleotide substitutions (i.e. those flanked neither by indels nor other substitutions) in the 131-kb nuptDNA relative to the indica, nivara, and japonica chloroplast genomes, respectively (Fig. 2C). Their distribution (Supplemental Table I) along the nupt in comparison to the japonica plastome was not significantly different from random using a chi-square test. Among the 12 possible kinds of point mutations, C T and G A transitions were by far the most prevalent substitution types in ptDNA-nupt comparisons (Fig. 2C), accounting for over one-half of all substitutions observed in each case. They are far more frequent than any other types of substitution, including the reverse transitions T C and A G (Fig. 2C). C T transitions (and G A transitions on the opposite strand) are the hallmark of spontaneous deamination of 5-methylcytosine (5mC), which produces a G-T mismatch at the deaminated site. The mismatch can be restored to the G-C pair in one direction, but creates an A-T pair in the other direction (Holliday and Grigg, 1993 C transitions (and A G on the opposite strand). Far fewer single-nucleotide substitutions and no predominance of C T and G A transitions were observed in comparisons of the three rice chloroplast genomes (Fig. 2D), indicating that the methylation-derived substitutions have occurred in the nucleus. About 90% of single-nucleotide indels in ptDNA-nupt comparisons occurred within homopolymeric stretches of two to 11 nucleotides (data not shown), suggesting a role for DNA replication slippage. Indels >10 bp were usually flanked by direct repeats involving the terminal of 3 to 4 bp of the inserted/deleted sequence, as exemplified by five nupt-japonica comparisons (Fig. 3A).
Relationship of the Rice nupt to Three Rice Plastomes
With the exception of 12 sites, all polymorphisms in ptDNA-nupt and ptDNA-ptDNA comparisons were autapomorphic (i.e. only one sequence differed). Seven of the 12 nonautapomorphic sites were informative, suggesting relationships between the sequences. They comprise three substitutions, one short inversion, and three indels (Table I). Five polymorphisms (loci 15) were shared between the japonica plastome and the japonica nupt, suggesting that nuclear integration of the japonica nuptDNA occurred from a japonica plastome progenitor. However, two additional sites linked the nupt to the other ptDNAs: one to the nivara plastome (a G
Absence of the 131-kb nuptDNA in the Nuclear Genome of indica
To determine whether the 131-kb nuptDNA is present in indica, PCR analyses were conducted. Oryza rufipogon was included in the analyses because it is considered an outgroup to both indica and japonica (Khush, 1997
Sequencing revealed that the PCR products contained 913 bp for indica rice (EMBL accession no. AJ849475) and were 909 bp in length for O. rufipogon (EMBL accession no. AJ849476). There were four single-nucleotide indels and seven substitutions between indica rice and O. rufipogon, a total of 36 nucleotide insertions and 12 substitutions between indica rice and japonica rice, and a total of 40 nucleotide insertions and 17 substitutions between japonica rice and O. rufipogon. Sequence comparison of 160 bp (nucleotides of the indica PCR product from 195320) containing the integration site between japonica and indica rice (Fig. 4D) revealed a 26-bp insertion (relative to the nuclear sequence of indica rice) 16 bp upstream of the integration site, and a 7-bp sequence (CCGAACC) at both sides of the junction in japonica rice, which differed from that (CCAAACC) in indica rice by one nucleotide. In addition, a 2-bp (CA) insertion was found immediately downstream of CCGAACC at the 5' end of the junction site of japonica rice. There were 11 mutations in this 160-bp region that distinguish japonica and indica rice ptDNA (Fig. 4D), but there was no difference in the same region between indica and O. rufipogon. These data suggest that sequence changes, including two insertions (2 and 26 bp) and a 7-bp duplication of neighboring nuclear DNA, may have occurred during the nupt integration, as was observed recently in laboratory transfer experiments (Huang et al., 2004
The 262-kb insert of Arabidopsis numtDNA (GenBank accession no. NC_003071) near the centromere of Arabidopsis chromosome 2, which includes 71.4% of the Arabidopsis mt genome, was aligned with the Arabidopsis organellar genome (Unseld et al., 1997
Six deletions larger than 10 bp (nucleotides present in mtDNA but missing in the numtDNA) were identified (Fig. 5), five of which were flanked by direct repeats of 4 to 23 bp (Fig. 3B). Two insertions larger than 10 bp were found, one 99 and the other 50 bp long, which also were flanked by direct repeats (Fig. 3C). The 6-bp repeats associated with the 99-bp insertion are HindIII sites. A database search revealed that this 99-bp integrant (nucleotides 3,412,7153,412,813 of GenBank accession no. NC_003071) was similar to a 170-bp fragment in Brassica napus mtDNA (GenBank accession no. AP006444; nucleotides 141,851142,020) but with a deletion of 71 bp, an insertion of 5 bp, and three nucleotide substitutions. The 99-bp fragment was present neither in the Arabidopsis mtDNA nor in the nuclear genome of Arabidopsis outside the 262-kb numtDNA. The 50-bp insertion (nucleotides 3,397,0373,397,086 of GenBank accession no. NC_003071) was identical to a sequence in B. napus mtDNA (GenBank accession no. AP006444, nucleotides 65,46465,415), which, like the 99-bp integrant, was absent from the mt and nuclear genome of Arabidopsis. These two regions were probably deleted through replication slippage or rearrangement from the Arabidopsis mt genome after the origin of the numtDNA. In the 262-kb numtDNA, as in the rice nupt, single-nucleotide indels predominated over larger ones (Fig. 6A), with 144 single-nucleotide insertions and 123 single-nucleotide deletions found among a total 611 deleted and 320 inserted nucleotides encompassing 287 individual events. The nucleotides flanking inserted or deleted single nucleotides were examined for common patterns, revealing that 79% and 73%, respectively, involved homopolymeric stretches of 2 to 10 nucleotides. Homopolymeric stretches and simple tandem repeats of two to six nucleotides also flanked most of the 2- to 10-bp indels (data not shown).
In this Arabidopsis numtDNA, 241 single-nucleotide substitutions (i.e. those flanked to neither indels nor other substitutions) were observed relative to the mt copy (Fig. 6B). Their distribution (Supplemental Table II) along the numt in comparison to the Arabidopsis mt genome was not significantly different from random using a chi-square test. As in the case of rice nuptDNA, C T and G A transitions were far more frequent (accounting for 46% of the total) than other substitutions, including the reverse transitions T C and A G (Fig. 6B).
The observed bias toward C
Are the 131-kb nuptDNA and 262-kb numtDNA under Selection?
When transferred organelle DNA arrives in the nucleus, its expression and mutation are subject to the regulation of the nuclear compartment. In order to become fixed as a functional gene, the transferred DNA must acquire a promoter to become transcribed and expression must lead to a product upon which selection can act, otherwise the sequence will, sooner or later, undergo mutational decay (Martin and Herrmann, 1998
Rate of 5mC Hypermutation Relative to Other Substitution Types
In the Arabidopsis numt, there were 54 C
The japonica nuptDNA is 99.77% identical (297/130,625 single-nucleotide differences) to the organelle-localized copy of the japonica plastome (Fig. 2C; Supplemental Table I), and the Arabidopsis numtDNA is 99.91% identical (241/259,944 differences) to the DNA from Arabidopsis mt (Unseld et al., 1997
Table I suggests that the 131-kb rice nuptDNA is more closely related to the japonica plastome among the three sampled here, and Figure 4 suggests that the transfer occurred within the japonica rice lineage. We scored 297 single-nucleotide substitutions among 130,625 sites of the pseudogene region between the japonica nupt and the japonica plastome sequences (Table VI). The 6.5 x 109 per site per year rate as applied to 297 substitutions would correspond to insertion of this nuptDNA about 350,000 years ago. However, the predominance of C
Repeating the above calculation for the time of insertion of the Arabidopsis numtDNA, where we observed 241 substitutions among 259,944 sites (0.09%), excluding the 77 excess C T and G A transitions, correcting for the roughly 10-fold difference in mt versus nuclear substitution rate (Wolfe et al., 1987
Phylogenetic relationships within the genus Oryza are not simple. Based on recent findings from simple sequence repeat variation in chloroplast and mt genomes among 50 Oryza accessions, Nishikawa et al. (2005)
Dinucleotide and trinucleotide substitutions were rare compared to single-nucleotide substitutions in the chloroplast and nupt comparisons, yet they were just as frequent in comparisons of pt genomes (10 dinucleotide and eight trinucleotide substitutions) as they were in ptDNA-nupt comparisons (11 and seven events, respectively; Table IV). All but two such substitutions occurred outside protein-coding regions. Averof et al. (2000)
Chloroplast and mt genomes exhibit very low levels of cytosine methylation (Timmis and Scott, 1983
The vast majority of single-nucleotide insertions and deletions (the most frequent class of indels observed here) occurred at homopolymeric regions in the nupt and numtDNAs. Direct repeats (36 bp) and homopolymeric stretches (210 bp) flank most indels of two nucleotides or more in both numtDNA and nuptDNA. Two direct repeats of 6 bp flanking a deletion were found previously in a tobacco (Nicotiana tabacum) nuptDNA (Ayliffe and Timmis, 1992 In the Arabidopsis numt, 287 indel events were observed as compared to 241 point mutations (164 after correction for 77 5mC-derived transitions), indicating that substitutions and indels occur at roughly similar rates. After correction for 5mC-derived transitions, indels were found to occur at one-third the rate of substitutions in rice ptDNA-nupt comparisons, and at one-half the rate in ptDNA. Replication slippage clearly plays an important role in the early mutational decay of transferred organelle DNA, but less so than 5mC hypermutation in both species.
The dates of integration that we estimate for the 131-kb rice nuptDNA (between 74,000296,000 years ago) and for the 262-kb Arabidopsis numtDNA (between 44,000176,000 years ago) indicate that organelle DNA flux to the nucleus is a dynamic, ongoing process in plants. It is noteworthy that the first two higher plant genomes sequenced each contain a copy of a more or less complete organelle genome that was transferred somewhere on the order of 44,000 to 296,000 years ago. This suggests that fixation of complete organelle DNA integrants in the nucleus is rare in rice and Arabidopsis, and it implies transfer frequencies that are considerably lower than those found in recent laboratory experiments (Huang et al., 2003
Sequence Alignments and Analysis Sequences of Arabidopsis (Arabidopsis thaliana) mtDNA, rice (Oryza sativa) ptDNA, and nuclear organelle DNA integrants were retrieved from GenBank (accession no. NC_001284 for the Arabidopsis mt genome, AY522329 for the indica rice chloroplast genome, AY522331 for the japonica rice chloroplast genome, AP006728 for the Oryza nivara chloroplast genome, NC_003071 for the numtDNA sequence on Arabidopsis chromosome 2, and AE017082 for the nuptDNA sequence on rice chromosome 10). Initial nupt indica segment alignments were obtained using MegaBlast (http://www.ncbi.nlm.nih.gov/BLAST). Refined segment alignments were made with ContigExpress of Vector NTI version 8 (InforMax, Bethesda, MD). A 130-kb alignment (available upon request) of the three pt genomes and the nupt (after colinearization to ptDNA by rearranging the segments corresponding to nupt positions 1,32418,455 and 119,739132,205 in Fig. 1) was prepared with MLAGAN (http://lagan.stanford.edu). Regions corresponding to the recombination junctions (nupt positions 18,45518,456 and 119,738119,739 in Fig. 1) were excluded from analysis. Deletions, insertions, and substitutions were identified by shell scripts and by visual inspection of the alignments.
Three rice taxa were used in the PCR analysis of the 131-kb nuptDNA integrant to investigate the time of its transfer to the nucleus: japonica (cv Nipponbare), indica (cv Hsin Tieh Ta), and Oryza rufipogon Griff. Total genomic DNA was prepared from young leaves and used in the amplification of the integration site of the 131-kb nuptDNA with primers F1 (5' TGCTGTCGGATAGTCTGATG) and R1 (5' CCTGCATCTGGACATAAAGA) or R2 (5' TTCCGGTTAGCATCACTTTT). Products of PCR were separated by gel electrophoresis, purified by using a QIAquick gel extraction kit (Qiagen, Valencia, CA), and sequenced by using Applied Biosystems (Foster City, CA) sequencing technology. Sequence data from this article have been deposited with the EMBL/GenBank data libraries under accession numbers AJ849475 and AJ849476.
We thank U. Baumann and S. Gregory for technical advice on initial rice ptDNA alignments, J. Kretschmer for technical assistance in sequence analysis, L. Lewin for providing rice seeds, and Dario Leister both for discussions and for communicating results prior to publication. Received January 26, 2005; returned for revision March 30, 2005; accepted April 5, 2005.
1 This work was supported by the Grains Research and Development Corporation (C.Y.H.), the Australian Research Council (C.Y.H., J.N.T.), and the Deutsche Forschungsgemeinschaft (W.M.).
[w] The online version of this article contains Web-only data. Article, publication date, and citation information can be found at www.plantphysiol.org/cgi/doi/10.1104/pp.105.060327. * Corresponding author; e-mail chunyuan.huang{at}adelaide.edu.au; fax 61883037102.
Arabidopsis Genome Initiative (2000) Analysis of the genome sequence of the flowering plant Arabidopsis thaliana. Nature 408: 796815[CrossRef][Medline]
Averof M, Rokas A, Wolfe KH, Sharp PM (2000) Evidence for a high frequency of simultaneous double-nucleotide substitutions. Science 287: 12831286 Ayliffe MA, Scott NS, Timmis JN (1998) Analysis of plastid DNA-like sequences within the nuclear genomes of higher plants. Mol Biol Evol 15: 738745[Abstract] Ayliffe MA, Timmis JN (1992) Tobacco nuclear DNA contains long tracts of homology to chloroplast DNA. Theor Appl Genet 85: 229238 Bensasson D, Feldman MW, Petrov DA (2003) Rates of DNA duplication and mitochondrial DNA insertion in the human genome. J Mol Evol 57: 343354[CrossRef][ISI][Medline]
Böhle U-R, Hilger HH, Martin W (1996) Island colonisation and evolution of the insular woody habit in Echium L. (Boraginaceae). Proc Natl Acad Sci USA 93: 1174011745 Bromham L, Penny D (2003) The modern molecular clock. Nat Rev Genet 4: 216224[CrossRef][ISI][Medline]
Devos KM, Brown JK, Bennetzen JL (2002) Genome size reduction through illegitimate recombination counteracts genome expansion in Arabidopsis. Genome Res 12: 10751079
Esser C, Ahmadinejad N, Wiegand C, Rotte C, Sebastaini F, Gelius-Dietrich G, Henze K, Kretschmann E, Richly E, Leister D, et al (2004) A genome phylogeny for mitochondria among Finnegan EJ, Genger RK, Peacock WJ, Dennis ES (1998) DNA methylation in plants. Annu Rev Plant Physiol Plant Mol Biol 49: 223247[CrossRef][ISI]
Finnegan EJ, Peacock WJ, Dennis ES (1996) Reduced DNA methylation in Arabidopsis thaliana results in abnormal plant development. Proc Natl Acad Sci USA 93: 84498454
Gabaldón T, Huynen MA (2003) Reconstruction of the proto-mitochondrial metabolism. Science 301: 609
Gaut BS, Morton BR, McCaig BC, Clegg MT (1996) Substitution rate comparisons between grasses and palms: synonymous rate differences at the nuclear gene Adh parallel rate differences at the plastid gene rbcL. Proc Natl Acad Sci USA 93: 1027410279 Graur D, Li W-H (2000) Fundamentals of Molecular Evolution. Sinauer Associates, Sunderland, MA Hazkani-Covo E, Sorek R, Graur D (2003) Evolutionary dynamics of large numts in the human genome: rarity of independent insertions and abundance of post-insertion duplications. J Mol Evol 56: 169174[CrossRef][ISI][Medline] Hiratsuka J, Shimada H, Whittier R, Ishibashi T, Sakamoto M, Mori M, Kondo C, Honji Y, Sun CR, Meng BY, et al (1989) The complete sequence of the rice (Oryza sativa) chloroplast genome: intermolecular recombination between distinct tRNA genes accounts for a major plastid DNA inversion during the evolution of the cereals. Mol Gen Genet 217: 185194[CrossRef][ISI][Medline] Holliday R, Grigg GW (1993) DNA methylation and mutation. Mutat Res 285: 6167[CrossRef][ISI][Medline] Huang CY, Ayliffe MA, Timmis JN (2003) Direct measurement of the transfer rate of chloroplast DNA into the nucleus. Nature 422: 7276[CrossRef][Medline]
Huang CY, Ayliffe MA, Timmis JN (2004) Simple and complex nuclear loci created by newly transferred chloroplast DNA in tobacco. Proc Natl Acad Sci USA 101: 97109715 Khush GS (1997) Origin, dispersal, cultivation and variation of rice. Plant Mol Biol 35: 2534[CrossRef][ISI][Medline]
Koch MA, Haubold B, Mitchell-Olds T (2000) Comparative evolutionary analysis of chalcone synthase and alcohol dehydrogenase loci in Arabidopsis, Arabis, and related genera (Brassicaceae). Mol Biol Evol 17: 14831498 Lin X, Kaul S, Rounsley S, Shea TP, Benito MI, Town CD, Fujii CY, Mason T, Bowman CL, Barnstead M, et al (1999) Sequence and analysis of chromosome 2 of the plant Arabidopsis thaliana. Nature 402: 761768[CrossRef][Medline]
Lindroth AM, Cao X, Jackson JP, Zilberman D, McCallum CM, Henikoff S, Jacobsen SE (2001) Requirement of CHROMOMETHYLASE3 for maintenance of CpXpG methylation. Science 292: 20772080
Ma J, Bennetzen JL (2004) Rapid recent growth and divergence of rice nuclear genomes. Proc Natl Acad Sci USA 101: 1240412410
Ma J, Devos KM, Bennetzen JL (2004) Analyses of LTR-retrotransposon structures reveal recent and rapid genomic DNA loss in rice. Genome Res 14: 860869
Martin W, Herrmann RG (1998) Gene transfer from organelles to the nucleus: how much, what happens, and why? Plant Physiol 118: 917
Martin W, Rujan T, Richly E, Hansen A, Cornelsen S, Lins T, Leister D, Stoebe B, Hasegawa M, Penny D (2002) Evolutionary analysis of Arabidopsis, cyanobacterial, and chloroplast genomes reveals plastid phylogeny and thousands of cyanobacterial genes in the nucleus. Proc Natl Acad Sci USA 99: 1224612251 Masood MS, Nishikawa T, Fukuoka S-I, Njenga PK, Tsudzuki T, Kadowaki K-I (2004) The complete nucleotide sequence of wild rice (Oryza nivara) chloroplast genome: first genome wide comparative sequence analysis of wild and cultivated rice. Gene 340: 133139[CrossRef][ISI][Medline]
Morton BR, Gaut BS, Clegg MT (1996) Evolution of alcohol dehydrogenase genes in the palm and grass families. Proc Natl Acad Sci USA 93: 1173511739
Mourier T, Hansen AJ, Willerslev E, Arctander P (2001) The Human Genome Project reveals a continuous transfer of large mitochondrial fragments to the nucleus. Mol Biol Evol 18: 18331837 Muse SV (2000) Examining rates and patterns of nucleotide substitution in plants. Plant Mol Biol 42: 2543[CrossRef][ISI][Medline] Nishikawa T, Vaughan DA, Kadowaki K-I (2005) Phylogenetic analysis of Oryza species, based on simple sequence repeats and their flanking nucleotide sequences from the mitochondrial and chloroplast genomes. Theor Appl Genet 110: 696705[CrossRef][ISI][Medline] Oldenburg DJ, Bendich AJ (2004) Most chloroplast DNA of maize seedlings in linear molecules with defined ends and branched forms. J Mol Biol 335: 953970[Medline] Ricchetti M, Fairhead C, Dujon B (1999) Mitochondrial DNA repairs double strand breaks in yeast chromosomes. Nature 402: 96100[CrossRef][Medline]
Rice Chromosome 10 Sequencing Consortium (2003) In-depth view of structure, activity, and evolution of rice chromosome 10. Science 300: 15661569
Richly E, Leister D (2004a) NUMTs in sequenced eukaryotic genomes. Mol Biol Evol 21: 10811084
Richly E, Leister D (2004b) NUPTs in sequenced eukaryotes and their genomic organization in relation to NUMTs. Mol Biol Evol 21: 19721980
Stegemann S, Hartmann S, Ruf S, Bock R (2003) High-frequency gene transfer from the chloroplast genome to the nucleus. Proc Natl Acad Sci USA 100: 88288833
Stupar RM, Lilly JW, Town CD, Cheng Z, Kaul S, Buell CR, Jiang J (2001) Complex mtDNA constitutes an approximate 620-kb insertion on Arabidopsis thaliana chromosome 2: implication of potential sequencing errors caused by large-unit repeats. Proc Natl Acad Sci USA 98: 50995103
Tang J, Xia H, Cao M, Zhang X, Zeng W, Hu S, Tong W, Wang J, Wang J, Yu J, et al (2004) A comparison of rice chloroplast genomes. Plant Physiol 135: 412420 Timmis JN, Ayliffe MA, Huang CY, Martin W (2004) Endosymbiotic gene transfer: organelle genomes forge eukaryotic chromosomes. Nat Rev Genet 5: 123135[CrossRef][ISI][Medline] Timmis JN, Scott NS (1983) Spinach nuclear and chloroplast DNAs have homologous sequences. Nature 305: 6567[CrossRef] Unseld M, Marienfeld JR, Brandt P, Brennicke A (1997) The mitochondrial genome of Arabidopsis thaliana contains 57 genes in 366,924 nucleotides. Nat Genet 15: 5761[CrossRef][ISI][Medline]
Wolfe KH, Li W-H, Sharp PM (1987) Rates of nucleotide substitution vary greatly among plant mitochondrial, chloroplast, and nuclear DNAs. Proc Natl Acad Sci USA 84: 90549058 Wolfe KH, Sharp PM, Li W-H (1989) Rates of synonymous substitution in plant nuclear genes. J Mol Evol 29: 208211[CrossRef]
Wu S-Y, Culligan K, Lamers M, Hays J (2003) Dissimilar mispair-recognition spectra of Arabidopsis DNA-mismatch-repair proteins MSH2·MSH6 (MutS Yuan Q, Hill J, Hsiao J, Moffat K, Ouyang S, Cheng Z, Jiang J, Buell CR (2002) Genome sequencing of 239-kb region of rice chromosome 10L reveals a high frequency of gene duplication and a large chloroplast DNA insertion. Mol Genet Genomics 267: 713720[CrossRef][ISI][Medline]
Zhang L, Vision TJ, Gaut BS (2002) Patterns of nucleotide substitution among simultaneously duplicated gene pairs in Arabidopsis thaliana. Mol Biol Evol 19: 14641473 Zhu Y, Strassmann JE, Queller DC (2000) Insertions, substitutions, and the origin of microsatellites. Genet Res 76: 227236[CrossRef][ISI][Medline] This article has been cited by other articles:
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||