|
|
||||||||
|
First published online July 29, 2005; 10.1104/pp.104.054213 Plant Physiology 138:2124-2133 (2005) © 2005 American Society of Plant Biologists Green Sperm. Identification of Male Gamete Promoters in Arabidopsis1,[w]Plant Gene Expression Center, United States Department of Agriculture, Agricultural Research Service, and Department of Plant and Microbial Biology, University of California at Berkeley, Albany, California 94710
Previously, in an effort to better understand the male contribution to fertilization, we completed a maize (Zea mays) sperm expressed sequence tag project. Here, we used this resource to identify promoters that would direct gene expression in sperm cells. We used reverse transcription-polymerase chain reaction to identify probable sperm-specific transcripts in maize and then identified their best sequence matches in the Arabidopsis (Arabidopsis thaliana) genome. We tested five different Arabidopsis promoters for cell specificity, using an enhanced green fluorescent protein reporter gene. In pollen, the AtGEX1 (At5g55490) promoter is active in the sperm cells and not in the progenitor generative cell or in the vegetative cell, but it is also active in ovules, roots, and guard cells. The AtGEX2 (At5g49150) promoter is active only in the sperm cells and in the progenitor generative cell, but not in the vegetative cell or in other tissues. A third promoter, AtVEX1 (At5g62580), was active in the vegetative cell during the later stages of pollen development; the other promoters tested (At1g66770 and At1g73350) did not function in pollen. Comparisons among GEX1 and GEX2 homologs from maize, rice (Oryza sativa), Arabidopsis, and poplar (Populus trichocarpa) revealed a core binding site for Dof transcription factors. The AtGEX1 and AtGEX2 promoters will be useful for manipulating gene expression in sperm cells, for localization and functional analyses of sperm proteins, and for imaging of sperm dynamics as they are transported in the pollen tube to the embryo sac.
In an effort to identify proteins potentially involved in fertilization, we sequenced approximately 5,000 expressed sequence tags (ESTs) from maize (Zea mays) sperm (Engel et al., 2003
A number of pollen-specific promoters have been isolated from plants, but most are active only in the vegetative cell of the pollen grain and not in the sperm cells (e.g. Twell et al., 1990 We wanted to identify promoters that would be useful for driving expression of reporter genes in the sperm cytoplasm. For imaging of sperm dynamics, the ideal promoters should not be active in the vegetative cell of the pollen grain. We selected genes in Arabidopsis that were similar to several different sperm-specific transcripts from maize. The putative promoter regions of five Arabidopsis genes were tested, by expressing enhanced green fluorescent protein (eGFP) in transgenic Arabidopsis plants, and two met this objective, to varying degrees. The promoter of Gamete Expressed 1 (AtGEX1; At5g55490) directed expression in some somatic tissues, but in pollen it directed eGFP expression only in the sperm cells of tricellular pollen and not in the progenitor generative cell or in the vegetative cell. The AtGEX2 promoter (At5g49150) directed eGFP expression in the generative cells of bicellular pollen and in the sperm cells in tricellular pollen grains, but not in other tissues; this pattern was similar to that seen with the LGC1 and the DUO1 promoters. We show that these promoters are useful for imaging sperm dynamics. The AtGEX1 and AtGEX2 promoters will be useful for manipulating gene expression in sperm, via antisense or overexpression constructs, to test whether candidate proteins play critical roles.
RT-PCR to Identify Possible Sperm-Specific Promoters
We previously reported the analysis of eight maize sperm transcripts that had similarity to hypothetical or unknown Arabidopsis proteins, and demonstrated by in situ hybridization that one of these transcripts was sperm specific in the mature pollen grain (Engel et al., 2003
While maize is an excellent system for gamete isolation, it is not easy to transform. We were interested in examining gamete gene expression in a more easily manipulated plant. We started with the maize ESTs that appeared to be sperm specific (Engel et al., 2003
We determined the expression patterns for these Arabidopsis genes using RT-PCR. Figure 1 shows the analysis of the five transcripts that appeared to be present predominately in RNA isolated from bud, flower, or pollen, while Supplemental Figure 1 shows the analysis of the other transcripts. At1g66770 and At5g62580 are both similar to Zmsp041. The Zmsp041 transcript was shown to be present in sperm cells by in situ hybridization on pollen grains (Engel et al., 2003
Because these five Arabidopsis genes appeared to be expressed in pollen or unopened buds, we tested whether any of their promoters would confer expression in sperm cells in vivo. Accordingly, sequences (approximately 12 kb) upstream of the putative initiating Met for each gene were amplified by PCR and cloned in front of the eGFP coding region. Arabidopsis (ecotype Columbia) plants were transformed, and the primary transformants were examined for eGFP expression during pollen development. Numerous plants containing the At1g66770::eGFP and At1g73350::eGFP constructs showed no eGFP expression in any tissue examined (data not shown).This was unexpected because At1g66770 was expressed in buds and At1g73350 was expressed in pollen (Fig. 1A); perhaps the promoter fragments used were not long enough or the expression level was too weak. Nonetheless, Figure 2 shows that the other three promoters tested did express eGFP in the pollen grain (Fig. 2, G, M, and S) and that two (At5g55490 and At5g49150) directed expression of eGFP in the sperm cells (Fig. 2, G and M). We named these two genes AtGEX1 (At5g55490) and AtGEX2 (At5g49150). The Vegetative Cell Expressed 1 (AtVEX1; At5g62580) promoter was vegetative cell specific in pollen (Fig. 2S).
Developmental Expression of the Promoter-Reporter Gene Constructs
In tricellular pollen, both the AtGEX1::eGFP and AtGEX2::eGFP transgenic lines expressed eGFP in the sperm cells. We wanted to determine whether the promoters were active only in the sperm cells or if transcription was initiated earlier in pollen development. This question was relevant because by RT-PCR analysis we had found that a number of the maize sperm transcripts that were expressed in the sperm cells were also present at the unicellular and bicellular stages of pollen development (Engel et al., 2003 In plants with the AtGEX2::eGFP construct, expression of eGFP in sperm cells was seen (Fig. 2, M, eGFP, and N, DAPI), but this promoter apparently initiates expression at the bicellular stage of pollen development because eGFP expression was also seen in generative cells (Fig. 2O). DAPI staining (Fig. 2P) showed two nuclei, one brightly staining (the generative cell) and one diffusely staining (the vegetative cell). For both constructs, some green fluorescence was seen at an earlier stage of pollen development. We believe this is autofluorescence and not eGFP because the fluorescence is present in all of the pollen grains (Fig. 2, Q and P, AtGEX2::eGFP; Fig. 2, I and K, AtGEX1::eGFP), even in heterozygous plants, and, more importantly, it is present in wild-type plants (Fig. 2, C and E). AtGEX2::eGFP is not expressed in any other tissues. The AtVEX1 promoter was active in the vegetative cell of the pollen grain in tricellular pollen grains (Fig. 2, S, eGFP, and T, DAPI) and weakly active in bicellular pollen grains (Fig. 2, U and V); however, eGFP expression was not observed in unicellular pollen (Fig. 2, W and X). In addition to the spatial variations observed with the AtGEX1::eGFP and AtGEX2::eGFP constructs, we occasionally observed a low level of greenish fluorescence in the vegetative cell of mature pollen; this expression appeared in addition to the sperm cell expression (Fig. 3C). The pollen grains shown in Figure 3, A and C, are from different flowers on the same AtGEX1::eGFP plant examined on the same day. The AtGEX1::eGFP construct only contained the putative promoter region, so we tested if the 3'UTR of the AtGEX1 gene would affect the expression or translation of eGFP in the pollen grains. However, eGFP expression in plants transformed with a construct containing the 3'UTR (AtGEX1::eGFPb) was not appreciably different from that in plants expressing eGFP under the control of the 5' promoter region alone (data not shown). We saw the same sporadic fluorescence in AtGEX2::eGFP plants; Figure 3, B and D, shows AtGEX2::eGFP pollen from the same plant examined on different days. Over the course of several months, we examined whether developmental stage, time of collection, heat treatment, or repeated desiccation influenced this greenish fluorescence in the vegetative cell, but none of these factors correlated with it. Pollen from wild-type plants grown side by side with the AtGEX1::eGFP or AtGEX2::eGFP plants occasionally exhibited greenish fluorescence (Fig. 2, A and C); thus, the sporadic fluorescence in the vegetative cell is not true expression of the transgene from the AtGEX1 or AtGEX2 promoters but is autofluorescence.
The AtGEX1 promoter has lower expression levels overall than the AtGEX2 promoter (Fig. 2, G versus M) and has variable expression, even in homozygous lines. This is most obvious in a quartet background, where all of the pollen grains from one meiosis remain attached to each other (Preuss et al., 1994
Live Imaging of Sperm Cell Dynamics
Transmission electron microscopy studies of sperm cells have revealed the subcellular organization of the sperm cells and their close association with the vegetative cell nucleus (for review, see Dumas and Mogensen, 1993
Analysis of Promoter Sequences Genes with common patterns of expression frequently have common sequence motifs in their promoters. We wanted to determine if there were any common sequence motifs that might be responsible for sperm cell expression. We compared AtGEX1 and AtGEX2 to LGC1 from lily, to the putative maize ZmGEX1 promoter, to the putative rice OsGEX1 and OsGEX2 promoters, and to the putative poplar (Populus trichocarpa) PtGEX1 and PtGEX2 promoters. The putative ZmGEX1 promoter was identified using the BLAST function at the Maize Genome Assembly Project (http://maize.ece.iastate.edu/magi.html). The Zmsp943 sequence was used to identify a Maize Assembled Genomic Island (MAGI) that contained the same sequence. Successive searches using each identified MAGI to find an overlapping MAGI allowed us to isolate the entire coding region of the ZmGEX1 gene and 1.4 kb upstream of the predicted initiating Met. We called the region upstream of the predicted initiating Met the putative promoter. There currently is no MAGI that contains the initiating Met of the ZmGEX2 gene, so we were unable to examine the putative promoter region from this gene. We used a database search to identify the rice proteins that were most similar to the AtGEX1 and AtGEX2 proteins. We then analyzed the 2-kb regions upstream of the initiating Met of these rice proteins.
It has been reported (Singh et al., 2003
G boxes were found in the AtGEX2 promoter and in both OsGEX2 (japonica and indica cultivars) putative promoters. A G-box binding protein transcript was present several times in the maize sperm EST sequences (Engel et al., 2003
We also compared the promoters of AtGEX1 and AtGEX2 to two other promoters known to drive expression in sperm cells, DUO1 and ANTIKEVORKIAN (Rotman et al., 2005
An alignment of the rice, maize, sorghum (Sorghum bicolor), poplar, and Arabidopsis GEX1 proteins is shown in Supplemental Figure 4, and an alignment of the partial ZmGEX2 protein sequence and the rice (japonica and indica cultivars), poplar, and Arabidopsis GEX2 proteins is shown in Supplemental Figure 5. We used the BLASTP program to search for conserved domains in the GEX1 and GEX2 proteins, but we were unable to find any significant matches, i.e. e-values of 1e8 or smaller. The TMPred (Prediction of Transmembrane Regions and Orientation) program (http://www.ch.embnet.org/software/TMPRED_form.html) predicts that AtGEX1 encodes a protein with three transmembrane domains. The PSORT program (http://psort.nibb.ac.jp) predicts a cleavable signal sequence of 24 amino acids. This predicted signal sequence is not included in the annotated version of At5g55490 (The Arabidopsis Information Resource [TAIR] and the National Center for Biotechnology Information [NCBI]) but is in frame with an upstream Met in the genomic sequence. The annotated OsGEX1 protein (NCBI) includes this region, which encodes a predicted signal sequence. The ZmGEX1 and the PtGEX1 genes also have a predicted signal sequence. Since all four proteins appear to have a similar structure, we believe that the Arabidopsis protein is misannotated. We isolated the AtGEX1 coding region; with the exception of a single amino acid change, it does not differ from the protein sequence predicted in the database. TMPred predicts that ZmGEX1, OsGEX1 (japonica and indica cultivars), PtGEX1 (poplar), and SbGEX1 (sorghum) have three transmembrane domains. AtGEX2 is predicted to have six transmembrane domains, but is not predicted to have a cleavable signal sequence. The AtGEX2 coding region we isolated has a splice site change from the annotated protein sequence (TAIR, NCBI) that removes 11 amino acids; these 11 amino acids are not present in the rice and poplar GEX2 proteins. The presence or absence of these 11 amino acids does not affect the prediction of the transmembrane domains. The OsGEX2-japonica and OsGEX2-indica proteins are also predicted to have six transmembrane domains. They also have predicted cleavable signal sequences by PSORT; however, they have approximately 140 additional N-terminal amino acids, and, for both proteins, there is a Met present after the predicted signal sequence. Thus, these proteins maybe misannotated. PtGEX2 is also predicted to have six transmembrane domains; however, because of the uncertainty of the initiating Met, we cannot determine whether it has a cleavable signal sequence. We have not isolated the full-length ZmGEX2 coding region.
Proteins involved in sperm-egg or sperm-central cell interactions are likely to be secreted or plasma membrane bound. AtGEX1 and AtGEX2 are expressed in sperm, and the proteins encoded by them are both predicted to encode plasma membrane proteins. To determine if AtGEX1 and AtGEX2 are plasma membrane bound, we examined their expression as N-terminal fusion proteins with eGFP, under the control of the cauliflower mosaic virus (CaMV) 35S promoter. The constructs were bombarded into onion (Allium cepa) epidermal peels. Figure 6A shows an onion cell expressing the AtGEX1-eGFP fusion protein; the eGFP signal is located primarily in the margins of the cell. When these onion peels were plasmolyzed by treating with 0.75 M sodium chloride, according to the protocol of Guyon et al. (2004)
We have used maize sperm ESTs to identify three Arabidopsis promoters that are active in pollen. In microarray experiments (AtGenExpress, 2004
We set out to identify promoters that could be used to express reporter or other transgenes specifically and consistently in male gametes. How reliable are the AtGEX1 and AtGEX2 promoters for these purposes? Expression from the AtGEX2 promoter was more robust than from the AtGEX1 promoter. AtGEX2 can drive expression of transgenes in both the generative cell and the sperm cells. Whether this is a result of transcription or translation in the sperm cells or of partitioning of transcripts or protein from the generative cell is unknown. Expression from the AtGEX1 promoter is much weaker than that from the AtGEX2 promoter. Perhaps the threshold needed for eGFP fluorescence to be visualized is not reached in all pollen grains, resulting in stochastic gene expression. It is known that expression levels can be changed by small changes in promoter sequence, which indicates that different promoters have different levels of variability (Raser and O'Shea, 2004
Because the AtGEX2 promoter has a higher level of expression and more reproducible expression in all pollen grains, it will be the most useful for future expression studies. In pollen, the AtGEX1 promoter-reporter gene construct directed gene expression only in sperm cells and not in the progenitor generative cell, but weak expression was noticed in ovules, roots, and guard cells. Therefore the AtGEX1 promoter is not as useful. However, analysis of the AtGEX1 promoter-reporter gene construct did allow us to answer whether sperm are transcriptionally and translationally competent. Because some sperm-specific transcripts were present in earlier stages of pollen development in maize (Engel et al., 2003
The AtGEX2 promoter drives expression similar to that of the LGC1 promoter from lily and the Arabidopsis DUO1 promoter, while the AtGEX1 promoter is expressed later. Because AtGEX1 and AtGEX2 are expressed at different developmental stages, it is likely that they have differential transcriptional regulation. Even when promoters drive similar patterns of gene expression, they may not have significant sequence similarity, as is the case for the extensively characterized pollen promoters LAT52 and LAT59 (Twell et al., 1991
Expression of eGFP in the sperm cells will allow for improved imaging of sperm dynamics under both in vivo and in vitro conditions (Fig. 5; Supplemental Fig. 2, AD). Strongly expressed eGFP frequently concentrates in the nuclei of cells (e.g. Fig. 5A). The absence of eGFP in the sperm nuclei (e.g. Fig. 5K) is likely due to the relatively weaker expression from the AtGEX promoters, given that a nuclearly targeted red fluorescent protein was able to mark sperm nuclei (Rotman et al., 2005
Although we did not set out to find a late-stage vegetative cell promoter, the AtVEX1 promoter should prove useful. Most promoters used for expression of transgenes in pollen, such as LAT52 (Twell et al., 1990
The AtGEX1 and ATGEX2 promoters can be used to examine the function of sperm proteins thought to be involved in fertilization, by using them to express GFP-fusion proteins to examine protein localization, or to express antisense or overexpression constructs. It is likely that the GEX1 and GEX2 genes will have similar expression patterns in other organisms, and so these promoters or their homologs should prove useful for similar studies in a variety of plant species. Finally, GFP-tagged sperm cells (Fig. 5, U and V), combined with FACS sorting (Engel et al., 2003
RT-PCR
RNA was extracted from Arabidopsis (Arabidopsis thaliana) leaves, buds, flowers, pistils, and pollen using the RNeasy Kit (Qiagen, Valencia, CA), and from roots, seedlings, and seeds according to Scott (1995)
The putative promoters were amplified from Arabidopsis ecotype Columbia genomic DNA, using the following primer pairs: for the 1-kb putative promoter of At1g73350, F, 5'GATCGAAGCTTGAAGATTCATGTCACGTCTC3', and R, 5'GATGGATCCGATTCTACCTCGCTTTAATCCCG3'; for the 1.8-kb putative promoter of At1g66770, F, 5'GATCGAAGCTTGACGCGAAGACGTGGTC3', and R, 5'GATGGATCCGTTATGATGAAGGGTAGTTATC3'; for the 2.1-kb putative promoter of At5g62850, F, 5'CGGGATCCATATGTATAACCGTTGAATTTTC3', and R, 5'TTCCCGGGCTAAAGAAGAATTCTTTATCTTC3'; for the 1.8-kb putative promoter of At5g55490, F, 5'GATCTCTAGAGCTACCTCAACGCACCTTG3', and R, 5'GTAGCCGGGCCTTGTGATTGATCACCTAC3'; and for the 1.8-kb putative promoter of At5g49150, F, 5'GGTCTGAATTCTTACATCGGATGGATTCAC3', and R, 5'CTAACACCCGGGTACATTAACCCTTCACAACAAG3'. The putative promoter fragments were cloned into pEGAD (Cutler et al., 2000
Arabidopsis cv Columbia was transformed by Agrobacterium-mediated transformation (Clough and Bent, 1998
Open flowers and closed buds were dissected and the anthers removed. Mature and immature pollen was dissected from the anthers and placed in 0.05 M NaPO4, pH 7.0, and 0.5% Triton X-100 containing 1 µg/mL DAPI.
To study the dynamics of sperm cell movement in germinating pollen tubes, pollen was germinated on a Nucleopore membrane using the protocol of Johnson-Brousseau and McCormick (2004)
Pollen was examined with a Zeiss Axiovert 200 M microscope (Carl Zeiss, Jena, Germany), and images were captured using an AxioCamMR camera and AxioVision 4.3 software. The microscope was equipped with a GFP filter set comprised of an excitation filter (BP 470/20 nm), a beam splitter (495 nm), and an emission filter (LP 505530 nm) and a DAPI filter set comprised of an excitation filter (BP 365/12 nm), a beam splitter (395 nm), and an emission filter (LP 397 nm). The objectives used for imaging were the Neofluar 40x oil, the Apochromat 63x oil, and the Neofluar 100x oil. The software and camera automatically determined optimal exposure time. The exposure time for each image is noted. The images were compiled using Adobe Photoshop Elements version 2.0 (Adobe Systems).
The full-length At5g55490 protein and the full-length At5g49150 protein were expressed as N-terminal fusions with eGFP under the control of the CaMV35S promoter. The AtGEX1 cDNA was isolated from Arabidopsis pollen RNA by using At5g55490Ra, 5'TAGCCGGATCCAATCTTCTAGTCAATGATGAAG3', for first-strand synthesis and amplifying with At5g55490Ra and At5g55490Fa, 5'ATCCGAATTCATGGATCGTTTCAGCAG3'. The AtGEX2 cDNA was isolated from Arabidopsis pollen using At5g49150Ra, 5'GCTAGGTACCACCTATCAGAACCATTAAC3', for first-strand synthesis and amplifying the product with At5g49150Ra and At5g49150Fa, 5'CTAGTCTAGAATGTACCCATCTGTTAGTG3'. Both cDNAs were cloned into pCAMBIA-2300 (http://www.cambia.org/main/r_et_vman.htm) between the CaMV35S promoter and eGFP from the pEGAD vector. Onion (Allium cepa) epidermal cells were transformed by gold particle bombardment using a Bio-Rad (Hercules, CA) gene gun. Upon request, all novel materials described in this publication will be made available in a timely manner for noncommercial research purposes, subject to the requisite permission from any third-party owners of all or part of the material. Obtaining any permissions will be the responsibility of the requestor.
Strompen et al. (2005) demonstrated that At3g08560 is sperm expressed. This promoter also has a Dof transcription factor binding site at 343 from the ATG. Strompen G, Dettmer J, Stierhof Y-D, Schumacher K, Jurgens G, Mayer U (2005) Arabidopsis vacuolar H+-ATPase subunit E isoform 1 is required for Golgi organization and vacuole function in embryogenesis. Plant J 41: 125132 Sequence data from this article have been deposited with the EMBL/GenBank data libraries under accession numbers AY746360 (AtGEX1) and AY746359 (AtGEX2).
We thank all the members of the McCormick lab for useful discussions throughout the course of this work and for helpful comments on this manuscript. We thank David Hantz and his staff for excellent greenhouse maintenance. Received September 30, 2004; returned for revision May 4, 2005; accepted May 13, 2005.
1 This work was supported by the National Science Foundation (Plant Genome grant no. 0211742 to S.M.).
[w] The online version of this article contains Web-only data. Article, publication date, and citation information can be found at www.plantphysiol.org/cgi/doi/10.1104/pp.104.054213. * Corresponding author; e-mail sheilamc{at}nature.berkeley.edu; fax 5105595678.
AtGenExpress (2004) Developmental series of flowers and pollen. NASCArrays Experiment. http://128.243.111.177/narrays/experimentpage.pl?experimentid=152 (September 21, 2004)
Bedinger PA, Edgerton MD (1990) Developmental staging of maize microspores reveals a transition in developing microspore proteins. Plant Physiol 92: 474479 Clough SJ, Bent AF (1998) Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J 16: 735743[CrossRef][Web of Science][Medline]
Craigon DJ, James N, Okyere J, Higgins J, Jotham J, May S (2004) NASCArrays: a repository for microarray data generated by NASC's transcriptomics service. Nucleic Acids Res (Database issue) 32: D575D577
Cutler SR, Ehrhardt DW, Griffitts JS, Somerville CR (2000) Random GFP::cDNA fusions enable visualization of subcellular structures in cells of Arabidopsis at a high frequency. Proc Natl Acad Sci USA 97: 37183723
Dumas C, Mogensen HL (1993) Gametes and fertilization: maize as a model system for experimental embryogenesis in flowering plants. Plant Cell 5: 13371348
Durbarry A, Vizir I, Twell D (2005) Male germ line development in Arabidopsis. duo pollen mutants reveal gametophytic regulators of generative cell cycle progression. Plant Physiol 137: 297307 Engel ML, Chaboud A, Dumas C, McCormick S (2003) Sperm cells of Zea mays have a complex complement of mRNAs. Plant J 34: 697707[CrossRef][Web of Science][Medline] Eyal Y, Curie C, McCormick S (1995) Pollen specificity elements reside in 30 bp of the proximal promoters of two pollen-expressed genes. Plant Cell 7: 373384[Abstract] Guyon V, Tang WH, Monti MM, Raiola A, Lorenzo GD, McCormick S, Taylor LP (2004) Antisense phenotypes reveal a role for SHY, a pollen-specific leucine-rich repeat protein, in pollen tube growth. Plant J 39: 643654[CrossRef][Web of Science][Medline]
Higo K, Ugawa Y, Iwamoto M, Korenaga T (1999) Plant cis-acting regulatory DNA elements (PLACE) database: 1999. Nucleic Acids Res 27: 297300 Huang S, An YQ, McDowell JM, McKinney EC, Meagher RB (1996) The Arabidopsis thaliana ACT4/ACT12 actin gene subclass is strongly expressed throughout pollen development. Plant J 10: 189202[CrossRef][Medline]
Iguchi N, Tanaka H, Yamada S, Nishimura H, Nishimune Y (2004) Control of mouse hils1 gene expression during spermatogenesis: identification of regulatory element by transgenic mouse. Biol Reprod 70: 12391245 Johnson-Brousseau SA, McCormick S (2004) A compendium of methods useful for characterizing Arabidopsis pollen mutants and gametophytically-expressed genes. Plant J 395: 761775
Kaneko KJ, DePamphilis ML (2000) Soggy, a spermatocyte-specific gene, lies 3.8 kb upstream of and antipodal to TEAD-2, a transcription factor expressed at the beginning of mouse development. Nucleic Acids Res 28: 39823990
Lalanne E, Twell D (2002) Genetic control of male germ unit organization in Arabidopsis. Plant Physiol 129: 865875 Lee H-S, Karunanandaa B, McCubbin A, Gilroy S, Kao TH (1996) PRK1, a receptor-like kinase of Petunia inflata, is essential for postmeiotic development of pollen. Plant J 9: 613624
Preuss D, Rhee SY, Davis RW (1994) Tetrad analysis possible in Arabidopsis with mutation of the QUARTET (QRT) genes. Science 264: 14581460
Quandt K, Frech K, Karas H, Wingender E, Werner T (1995) MatInd and MatInspector: new fast and versatile tools for detection of consensus matches in nucleotide sequence data. Nucleic Acids Res 23: 4878884
Raser JM, O'Shea EK (2004) Control of stochasticity in eukaryotic gene expression. Science 304: 18111814 Rotman N, Durbarry A, Wardle A, Yang WC, Chaboud A, Faure J-E, Berger F, Twell D (2005) A novel class of MYB factors controls sperm-cell formation in plants. Curr Biol 15: 244248[CrossRef][Web of Science][Medline] Scott RJ (1995) Isolation of whole cell (total) RNA. Methods Mol Biol 49: 197202[Medline]
Sheahan MB, Staiger CJ, Rose RJ, McCurdy DW (2004) A green fluorescent protein fusion to actin-binding domain 2 of Arabidopsis fimbrin highlights new features of a dynamic actin cytoskeleton in live plant cells. Plant Physiol 136: 39683978 Singh M, Bhalla PL, Xu H, Singh MB (2003) Isolation and characterization of a flowering plant male gametic cell-specific promoter. FEBS Lett 542: 4752[CrossRef][Web of Science][Medline] Thorsness MK, Kandasamy MK, Nasrallah ME, Nasrallah JB (1993) Genetic ablation of floral cells in Arabidopsis. Plant Cell 5: 253261[Abstract] Twell D, Yamaguchi J, McCormick S (1990) Pollen-specific gene expression in transgenic plants: coordinate regulation of two different tomato gene promoters during microsporogenesis. Development 109: 705713[Abstract]
Twell D, Yamaguchi J, Wing RA, Ushiba J, McCormick S (1991) Promoter analysis of genes that are coordinately expressed during pollen development reveals pollen-specific enhancer sequences and shared regulatory elements. Genes Dev 5: 496507
Vicente-Carbajosa J, Moose SP, Parsons RL, Schmidt RJ (1997) A maize zinc-finger protein binds the prolamin box in zein gene promoters and interacts with the basic leucine zipper transcriptional activator Opaque2. Proc Natl Acad Sci USA 94: 76857690 Voronin V, Touraev A, Kieft H, van Lammeren AA, Heberle-Bors E, Wilson C (2001) Temporal and tissue-specific expression of the tobacco ntf4 MAP kinase. Plant Mol Biol 45: 679689[CrossRef][Web of Science][Medline]
Weterings K, Russell SD (2004) Experimental analysis of the fertilization process. Plant Cell 16: S107S118
Xu H, Swoboda I, Bhalla PL, Singh MB (1999) Male gametic cell-specific gene expression in flowering plants. Proc Natl Acad Sci USA 96: 25542558 Yanagisawa S, Schmidt RJ (1999) Diversity and similarity among recognition sequences of Dof transcription factors. Plant J 17: 209214[CrossRef][Web of Science][Medline] Zhang B, Foley RC, Singh KB (1993) Isolation and characterization of two related Arabidopsis ocs-element bZIP binding proteins. Plant J 4: 711716[CrossRef][Web of Science][Medline] Related articles in Plant Physiol.:
This article has been cited by other articles:
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ASPB Publications | PLANT PHYSIOLOGY® | THE PLANT CELL | |
|---|---|---|---|