This Article Abstract Full Text (PDF) All Versions of this Article: 138/4/2165    most recent pp.105.061861v1 Alert me when this article is cited Alert me if a correction is posted Services Email this article to a friend Similar articles in this journal Similar articles in ISI Web of Science Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via CrossRef Citing Articles via ISI Web of Science (35) Citing Articles via Google Scholar Google Scholar Articles by Scofield, S. R. Articles by Gill, B. S. Search for Related Content PubMed PubMed Citation Articles by Scofield, S. R. Articles by Gill, B. S. Agricola Articles by Scofield, S. R. Articles by Gill, B. S.

PLANTS INTERACTING WITH OTHER ORGANISMS

Development of a Virus-Induced Gene-Silencing System for Hexaploid Wheat and Its Use in Functional Analysis of the Lr21-Mediated Leaf Rust Resistance Pathway¹

United States Department of Agriculture, Agricultural Research Service, Crop Production and Pest Control Research Unit, West Lafayette, Indiana 47907 (S.R.S., A.S.B.); Department of Agronomy, Purdue University, West Lafayette, Indiana 47907 (S.R.S., A.S.B.); and Department of Plant Pathology, Throckmorton Plant Sciences Center, Kansas State University, Manhattan, Kansas 66506 (L.H., B.S.G.)

	ABSTRACT

TOP ABSTRACT RESULTS DISCUSSION MATERIALS AND METHODS LITERATURE CITED

 
Virus-induced gene silencing (VIGS) is an important tool for the analysis of gene function in plants. In VIGS, viruses engineered to carry sequences derived from plant gene transcripts activate the host's sequence-specific RNA degradation system. This mechanism targets the RNAs of the viral genome for degradation, and as the virus contains transcribed plant sequence, homologous host mRNAs are also targeted for destruction. While routinely used in some dicots, no VIGS system was known for monocot plants until the recent report of silencing in barley (Hordeum vulgare) by barley stripe mosaic virus (BSMV). Here, we report development of protocols for use of BSMV to efficiently silence genes in hexaploid wheat (Triticum aestivum). The VIGS system was first optimized in studies silencing phytoene desaturase expression. Next, we used it to assay genes functioning in leaf rust resistance mediated by Lr21, which encodes a nucleotide binding site-leucine-rich repeat class resistance gene product. We demonstrated that infection with BSMV constructs carrying a 150-bp fragment of Lr21 caused conversion of incompatible interactions to compatible, whereas infection with a control construct or one that silences phytoene desaturase had no effect on resistance or susceptibility. Additionally, silencing the RAR1, SGT1, and HSP90 genes, known to be required in many but not all nucleotide binding site-leucine-rich repeat resistance pathways in diverse plant species, resulted in conversion to compatibility, indicating that these genes are essential in Lr21-mediated resistance. These studies indicate that BSMV-VIGS is a powerful tool for dissecting the genetic pathways of disease resistance in hexaploid wheat.

Plants have evolved potent surveillance and response systems that provide resistance to a diverse set of pathogens, including fungi, bacteria, viruses, nematodes, and insects. Despite this broad range of intruders, in most cases examined, the resistance pathways (R-pathways) that counter them are based on very similar molecular architecture. One of the best-characterized modes of disease resistance is known as gene-for-gene resistance (Flor, 1971), whereby resistance to a specific pathogen requires the presence of a particular allele of a plant resistance gene (R-gene) and a gene encoding its cognate elicitor in the pathogen. The vast majority of R-genes that have been isolated are known to encode proteins that contain a nucleotide binding site (NB) and Leu-rich repeat domains (LRR) and are designated as NB-LRR proteins. NB-LRR proteins recognize pathogen effector molecules, either directly or indirectly, and activate a signal transduction pathway that results in expression of a resistance response that typically involves rapid ion fluxes, production of reactive oxygen intermediates, and rapid localized cell death at the site of infection, known as the hypersensitive response.

Intense analysis of NB-LRR-mediated resistance in model plants has greatly expanded our understanding of the mechanisms of gene-for-gene disease resistance. One of the great hopes for this research was that it would make possible the transfer of useful modes of resistance to agriculturally important crops. However, several studies have indicated that it is unlikely that R-genes will retain function when transferred across wide species boundaries, an effect known as restrictive taxonomic functionality (Tai et al., 1999). Although significant progress has been gained from studying disease resistance in model dicot plants, improvement of disease resistance in wheat will require the analysis of resistance mechanisms and the isolation of genes encoding R-pathway components from wheat.

The genetic analysis of disease resistance in wheat and isolation of genes encoding components of R-pathways is greatly complicated by the fact that most cultivated wheat (>90%) is hexaploid, also called common or bread wheat (Triticum aestivum). In addition to difficulties stemming from genetic redundancy, the wheat genome is extremely large, containing approximately 16,000 Mb of DNA (Arumuganathan and Earle, 1991), 128 times larger than Arabidopsis (Arabidopsis thaliana; Gill et al., 2004). Although elegant cytogenetic stocks exist to aid in coarse-scale mapping of wheat genes, many resources common in model plant systems do not exist. Mutagenized diploid wheat collections are not available, and, since wheat is recalcitrant to T-DNA transformation, no T-DNA insertion libraries exist in diploid wheat that could be used to streamline gene isolation. No active wheat transposons have been characterized, and transgenic systems for transposon-based gene tagging are not widely available (McElroy et al., 1997). Despite these obstacles, at least three wheat R-genes, Lr21 (Huang et al., 2003), Lr10 (Feuillet et al., 2003), and Pm3b (Yahiaoui et al., 2004), have been isolated through strategies employing chromosome walking followed by complementation in transgenic plants to confirm gene function. Nonetheless, it is clear that new tools are needed to increase the efficiency of gene isolation and functional analysis in wheat.

RNA-induced gene silencing should be a very useful tool for gene identification and functional analysis in hexaploid wheat. While there are many different systems for triggering RNA-induced gene silencing, all of them involve a common initial step, the production of large quantities of double-stranded RNA (dsRNA) within cells. Accumulation of sufficient levels of dsRNA activates a host defense mechanism that targets all of the sequence within the dsRNA for cleavage into short (21–25 nucleotide) interfering RNAs. The short interfering RNAs become incorporated into the RNA-induced silencing complex, where they direct the degradation of any RNAs with sufficient sequence complementarity (Denli and Hannon, 2003). RNA-induced silencing is particularly appealing in polyploid organisms because its homology-dependent action permits silencing of any redundant copies that share at least approximately 85% nucleotide identity (Thomas et al., 2001).

Virus-induced gene silencing (VIGS) strategies have proven very useful in the analysis of gene function in dicot plants (Lu et al., 2003b; Burch-Smith et al., 2004), but the only demonstration of effective VIGS in a monocot has been the report of silencing barley phytoene desaturase (PDS) expression using barley stripe mosaic virus (BSMV; Holzberg et al., 2002; Lacomme et al., 2003). BSMV is a positive sense, single-strand RNA virus with a tripartite genome, composed of the , , and RNAs (Petty et al., 1989). Fragments of transcribed sequences from the plant gene to be targeted for silencing are inserted into a DNA plasmid, from which the RNA can be synthesized by in vitro transcription. The plant cDNA fragment is cloned immediately downstream of the termination codon of the b open reading frame. BSMV is known to infect other grasses, including wheat. In this study, we have tested whether BSMV can trigger gene silencing in hexaploid wheat and, if so, whether it can be used to assess the functions of genes participating in wheat disease R-pathways.

	RESULTS

TOP ABSTRACT RESULTS DISCUSSION MATERIALS AND METHODS LITERATURE CITED

 

Silencing PDS Expression in Hexaploid Wheat Varieties

Our initial tests of BSMV-VIGS in wheat targeted the PDS gene, which provides a convenient visual reporter for silencing. PDS is essential in the carotenoid pigment biosynthetic pathway, and suppression of its activity results in photolysis of chlorophyll, also referred to as photobleaching, in the affected tissues. Two of the BSMV RNA constructs carried a 185-bp fragment of the barley (Hordeum vulgare) PDS cDNA in either the sense (BSMV:PDS4) or antisense orientation (BSMV:PDS4as) inserted just 3' to the stop codon of the b open reading frame. The sequence of the barley PDS4 fragment is 96% identical to the corresponding region of common wheat PDS expressed sequence tag (EST) BG909124 and, therefore, well within the range of homology necessary for effective silencing (Holzberg et al., 2002). Greenhouse-grown Bobwhite wheat and Black Hulless barley plants were inoculated with 1:1:1 mixtures of in vitro transcripts synthesized from plasmids containing the wild-type BSMV ND18 , and RNAs and derivatives of the RNA that carried either no plant sequence (BSMV:00) or the barley PDS4 or PDS4as fragments.

Seven days after rub inoculating the first and second leaves of 7-d-old seedlings with BSMV:PDS4 or BSMV:PDS4as, evidence of photobleaching was first apparent in third and fourth leaves of the barley plants. Photobleaching also developed in wheat, but it was not detectable until 10 d after viral inoculation. No evidence of photobleaching was observed in the plants infected with BSMV:00. Interestingly, the mosaic symptoms and chlorosis characteristic of BSMV infection in barley were much less pronounced in wheat.

The extent of photobleaching is similar in both species; the primary area affected is the base of the third leaf, while areas throughout the length of the fourth leaf are often bleached (Fig. 1A). Photobleaching was very rarely observed in the fifth leaves of either species. While the photobleaching phenotypes are very similar in wheat and barley, the most striking difference is that photobleaching in wheat often did not encompass the entire width of a leaf; photobleaching was often confined to narrow stripes that were parallel to the leaf veins (Fig. 1B). No consistent differences were apparent in the photobleaching resulting from the sense or antisense orientation of the PDS4 fragment (data not shown). Therefore, for simplicity we chose to use the antisense orientation of plant cDNA fragments in all subsequent work.

View larger version (65K): [in this window] [in a new window]   Figure 1. Silencing of PDS in barley and wheat by BSMV. Black Hulless barley and Bobwhite wheat were infected with in vitro transcribed RNAs representing the , , and RNAs of BSMV:00 or , , and PDS4as RNAs of BSMV:PDS4as 7 d after germination. These photographs were taken 12 d after infection and are representative of 10 different experiments. A, Whole plants; B, representative single leaves.

A derivative of the RNA, in which the a gene encoding the viral coat protein had been deleted (a), was observed to generate more extensive areas of photobleaching in barley (Holzberg et al., 2002). Our tests of a in barley confirmed these observations, but with significantly greater necrosis accompanying the photobleaching, whereas no advantage was observed in wheat (data not shown). The wild-type RNA was used in all subsequent work.

Analysis of Sequence Length Required for Efficient Silencing of PDS

Previously, PDS fragments ranging in size from 1,215 to 185 bp (PDS4 and PDS4as) were compared in their efficiency in silencing barley PDS, but no correlation between length and silencing efficiency was observed (Holzberg et al., 2002). We extended this analysis by making a more focused analysis of the lower limits of fragment size required for effective silencing by constructing a series of deletions from the 3' end of the PDS4as fragment. Silencing by derivatives of PDS4as with lengths of 120, 80, and 40 bp was compared in barley and wheat to the 185-bp PDS4as fragment (Fig. 2). In three replicate experiments, eight plants of each species were infected with each viral construct. A very clear decrease in photobleaching was observed in both wheat and barley when the PDS4as fragments less than 120 bp in length were tested. Only 21% of the wheat and 16% of the barley plants displayed any detectable photobleaching when the 80-bp PDS4as derivative fragment was tested. No photobleaching was observed in any of the plants infected with the 40-bp PDS4as derivative.

View larger version (60K): [in this window] [in a new window]   Figure 2. Comparison of silencing of PDS in barley and wheat by BSMV constructs carrying different length PDS sequences. Black Hulless barley and Bobwhite wheat were infected with in vitro transcribed RNAs from BSMV constructs in which the RNAs were engineered to carry a 185-bp fragment of PDS (PDS4as) or deletions of this fragment with lengths of 120, 80, or 40 bp. The third leaves were photographed 12 d after inoculation with BSMV. Ten plants were inoculated with each construct, and the experiment was repeated three times. The leaves shown are representative of all replicates. Silencing by BSMV:PDS40as was visually indistinguishable from BSMV:00.

Our intention to use BSMV-VIGS for assessing the functional requirement for genes in resistance necessitates understanding the time course for establishment and maintenance of silencing. An appropriate interval of time can then be chosen between infecting with BSMV to initiate VIGS and the application of the pathogen to challenge the plant resistance system. To examine the time course of BSMV-VIGS, we employed quantitative real-time PCR (QRT-PCR) to measure the level of wheat PDS expression at 3, 7, 10, 13, 16, 18, and 21 d after inoculation with BSMV:00 or BSMV:PDS4as. Four plants were infected with BSMV:00 and BSMV:PDS4as for each time point. The third leaves of the plants for each treatment were pooled and total RNA was extracted. First-strand cDNA was synthesized from each pooled RNA sample using a mixture of random hexamers and oligo(dT) to prime synthesis. The level of endogenous PDS expression was determined by comparative QRT-PCR (Pfaffl, 2001) using 18S rRNA to normalize RNA amounts (Balaji and Anderson, 2005), and expression in the silenced sample is presented relative to PDS expression in leaves infected with the BSMV:00 control virus (Table I). Three biological replicates of this time-course study were performed.

Employing BSMV-VIGS to Identify Genes Required in Wheat Disease R-Pathways

Having demonstrated that BSMV can silence genes in various hexaploid wheat varieties and having defined the time course for the establishment and maintenance of BSMV-VIGS, we asked if this system could be used to assess the function of genes in a wheat disease R-pathway. The Lr21 R-gene has been cloned and is known to encode a protein that is a member of the largest structural class of R-genes, the NB-LRR family (Huang et al., 2003). Three other genes, RAR1, SGT1, and cytosolic HSP90, have been found to function in many, but not all, of the NB-LRR R-pathways for which tools exist to permit functional analysis (Austin et al., 2002; Azevedo et al., 2002; Tor et al., 2002). Consequently, we attempted to test their requirement in Lr21-mediated resistance.

To make the silencing as specific as possible for Lr21, a 174-bp fragment comprised almost entirely from Lr21 3' untranslated sequence, designated Lr21 (4246-4420), was first chosen for cloning into the BSMV RNA. Genomic Southern-blot analysis showed one copy each of RAR1 and SGT1 genes in A, B, and D genomes of wheat (L. Huang, unpublished data). BLAST comparisons indicate that the longest wheat RAR1 (BJ251120) and SGT1 (BQ295431) ESTs share 93% and 97% homology to the barley transcripts, respectively. BSMV constructs were assembled using fragments of 412 bp and 592 bp, respectively, from the cloned barley RAR1 and SGT1 sequences (Shirasu et al., 1999; Azevedo et al., 2002). Very few data were available to guide the design of the HSP90 silencing experiment. Just one wheat EST, X98582, was found in the databases with significant homology to the barley cytosolic HSP90, and we had no wheat genomic Southern-blot data regarding the number of related sequences, so a 170-bp fragment was amplified from wheat cDNA with primers based on the X98582 EST sequence.

A wheat variety carrying the Lr21 R-gene, WGRC7, and a susceptible line, Wichita (WI), were used in this analysis. Ten plants of each wheat line were inoculated with BSMV:00, BSMV:PDS4as, BSMV:Lr21, BSMV:RAR1, BSMV:SGT1, and BSMV:HSP90 7 d after germination. After an additional 8 d to permit establishment of VIGS, all of the plants were spray inoculated with P. triticina isolate PRTUS6, which is avirulent on WGRC7 and virulent on WI. Infection with BSMV:00 (Fig. 3A) or BSMV:PDS4as (Fig. 3B) had no effect on the normal resistance and susceptibility expected of WGRC7 and WI, respectively. However, when WGRC7 was infected with BSMV:Lr21 (4246-4420), BSMV:RAR1, BSMV:SGT1, or BSMV:HSP90, areas of susceptibility became apparent on approximately the distal most 10 cm of the third leaves of all the plants, indicating that the products of all four genes are required for Lr21-mediated resistance to PRTUS6 (Fig. 4). Infection of WI with each of these BSMV constructs had no observable effect on susceptibility (data not shown).

View larger version (59K): [in this window] [in a new window]   Figure 3. Leaf rust interactions of susceptible and resistant wheat after infection with BSMV:00 or BSMV:PDS4as. All plants were infected with the indicated BSMV constructs 7 d after germination and then spray inoculated with the avirulent P. triticina isolate PTRUS6 8 d after viral infection. The photographs were taken 10 d after inoculation with leaf rust and are representative of all leaves in two different experiments. A, The infection types of WI (1) and WGR7 (2) inoculated with BSMV:00. The necrotic spots in 2 are sites of Lr21-dependent hypersensitive response. B, In a separate experiment, infection type of WI inoculated with BSMV:00 (1) is shown on the left as a control. Infection with BSMV:PDS4as does not alter the infection type of WI (2) or WGRC7 (3).

View larger version (149K): [in this window] [in a new window]   Figure 4. The effects of silencing Lr21, RAR1, SGT1, and HSP90 on Lr21-mediated resistance. Ten plants resistant to PTRUS6 were inoculated with (A) BSMV:00, (B) BSMV:Lr21, (C) BSMV:RAR1, (D) BSMV:SGT1, and (E) BSMV:HSP90, 7 d after germination. All plants were spray inoculated with PTRUS6 8 d after viral infection, and leaf rust symptoms were photographed 8 d after fungal inoculation.

To test this hypothesis, a second VIGS experiment using a conserved portion of Lr21A, B, and D homeologs was undertaken. A 219-bp fragment from the LRR domain of Lr21 was cloned into the BSMV vector, and the resulting construct, designated BSMV:Lr21 (3493-3712), was used to silence Lr21A, B, and D. Silencing with this construct in WGRC7 resulted in similar conversion to susceptibility as seen previously with BSMV:Lr21 (4246-4420) (data not shown). As this silencing was performed targeting the conserved LRR portion of the gene, QRT-PCR probes derived from the 3' end of Lr21D that we hypothesized to be unique could be used to specifically measure Lr21D expression. As shown in Table II, these measurements indicate that Lr21D expression is suppressed by at least 80%, supporting our hypothesis. A similar explanation may apply to measurements of suppression for HSP90, but only one EST sequence is available for wheat HSP90 at this time, so we know nothing about the sequences of other gene family members.

	DISCUSSION

TOP ABSTRACT RESULTS DISCUSSION MATERIALS AND METHODS LITERATURE CITED

 
Here, we demonstrate that vectors based on BSMV can be effective reverse-genetics tools for the analysis of gene function in hexaploid wheat. Our initial tests focused on comparing the BSMV:VIGS systems in wheat and barley using the convenient photobleaching phenotype generated by silencing PDS. These comparisons indicated that BSMV-VIGS gave largely similar results in barley and wheat. When the first and second leaves of barley and wheat were inoculated, large areas of photobleaching were observed in the third and fourth leaves of both species; however, in wheat photobleaching less frequently extends across the width of the leaf without interruption and often has a striped appearance. All of our PDS silencing studies in wheat were performed using derivatives of the barley PDS cDNA, which is 96% identical to the wheat EST sequence, with four divergent bases at positions 48, 66, 126, and 140 in the longest fragment tested (PDS4 and PDS4as). Therefore, it is possible that these phenotypic differences may be due to the imperfect homology between the barley PDS VIGS fragment and the wheat genes targeted. Tests using the equivalent wheat PDS sequence will resolve this question.

In these studies, five different genes were targeted and successfully silenced in leaf tissue of wheat. Our long-term goal is to employ BSMV-VIGS to characterize the pathways of resistance to a number of pathogens of wheat, and, therefore, four of the genes that were silenced in this study were chosen for their likely involvement in gene-for-gene-mediated disease resistance. The Lr21 NB-LRR R-gene serves as a positive control for BSMV-VIGS in the leaf rust assay because its function had been confirmed by complementation in transgenic wheat (Huang et al., 2003).

The remaining three genes tested, RAR1, SGT1, and HSP90, were chosen for study because they are among the small group of genes whose products have been demonstrated to be required for the function of multiple R-pathways in Arabidopsis, tobacco (Nicotiana benthamiana), tomato (Lycopersicon esculentum), and barley. RAR1 has been shown to be required in about one-half of the R-pathways in which its function has been tested. SGT1 was first identified as a RAR1-interacting protein in yeast two-hybrid screens. It is also required in a wide range of R-gene and nonhost resistance mechanisms (Peart et al., 2002). Unlike RAR1, complete loss of SGT1 function is lethal (Muskett and Parker, 2003); therefore, only transient silencing methodologies such as VIGS and biolistic bombardment of dsRNA can be used to assess SGT1 functionality.

Recent studies have demonstrated that the cytosolic HSP90 plays an essential role in the Rx, Pto, N, RPM1, RPS2, and RPS4 R-pathways (Hubert et al., 2003; Lu et al., 2003a; Takahashi et al., 2003; Liu et al., 2004; Zhang et al., 2004). HSP90 is known to function as a molecular chaperone that aids the correct folding of proteins in many biological systems, particularly molecules involved in signaling pathways (Picard, 2002). The chaperone functions of HSP90 are coordinated by cochaperone molecules, and evidence suggests that SGT1 and RAR1 may serve similar roles for HSP90. SGT1 has two structural motifs found in cochaperones of HSP90, the TRP and CS domains (Takahashi et al., 2003). Also, this model is strongly supported by the demonstration of pairwise interactions between HSP90, SGT1, and RAR1 (Hubert et al., 2003; Lu et al., 2003a; Takahashi et al., 2003) in various protein interaction assays. While much remains to be learned about the mechanisms of HSP90, RAR1, and SGT1, the evidence suggests that these three proteins act to stabilize the accumulation and to maintain R-gene products in the correct conformation for resistance signaling. The work described here indicates that Lr21-mediated resistance in wheat requires the expression of RAR1, SGT1, and HSP90.

We believe that BSMV-VIGS will be an excellent tool for the functional analysis of the Lr21-mediated R-pathway. The assay has been repeated many times under greenhouse and growth chamber conditions, and in each test silencing these genes resulted in a very clear conversion to susceptibility. A robust assay for loss of Lr21-mediated disease resistance will be a great advantage when we begin to screen for genes encoding novel Lr21-pathway components. VIGS screens for genes required in other R-pathways have been based on loss of the hypersensitive response as the primary criteria for identifying genes, but it was found that only a small fraction of genes identified in this way was actually essential for disease resistance (Lu et al., 2003a).

At the outset of our work, we were concerned that the physiological stresses associated with viral infection or defense responses to BSMV might interfere with our ability to observe the operation of the R-pathways that we are attempting to functionally dissect. However, it was noted that the symptoms associated with infection with the BSMV:00 control virus that contains no plant gene sequences were significantly less severe in wheat than in barley. This suggests that the background physiological changes associated with BSMV infection may be less severe in wheat, which would be a great benefit for work investigating disease resistance or other plant processes. Additionally, in our work with several different barley and wheat varieties, we observed that in contrast to the wheat lines, which were uniformly conducive to BSMV-VIGS, several barley lines supported BSMV-VIGS at clearly reduced levels. Variation in the susceptibility of different barley genotypes to BSMV infection has been reported (McKinney, 1965), and resistance to BSMV has been an objective in some barley improvement programs (Sisler and Timian, 1956). This, together with our own limited experience, suggests that there may be less genotypic restriction in the application of BSMV-VIGS in wheat in comparison to barley.

It is interesting to note that the location of tissue that displayed susceptibility to P. triticina in our studies was not coincident with the area of maximum photobleaching in the PDS silencing experiments. Susceptibility developed in the distal 10 cm of the third leaves, while photobleaching most frequently appeared at the base of the third leaf and rarely extended into the tip region. The limitation of susceptibility to the leaf tip is a consequence of leaf growth that occurs during the 8 d between the application of P. triticina and the development of rust symptoms; the lower portion of the leaf was not exposed to the fungus because it had not formed at the time of fungal inoculation. However, in the case of PDS, while silencing occurs throughout the length of the third leaf, photobleaching is rarely observed near the tip. We believe this is best explained by the biological differences underlying these two phenotypes. PDS has an essential function in the production of carotenoid pigments, which are likely to be very stable once produced. Therefore, if PDS silencing is not established before these pigments are synthesized at the leaf tip, photobleaching will not appear there (Guo et al., 2003). Our results suggest that the gene products of Lr21, RAR1, SGT1, and HSP90 are significantly less stable than carotenoid pigments. Therefore, even if silencing of these R-pathway components is not established as the tip of the third leaf forms, it is possible to observe silencing there at a later time, after silencing is established and prevents replacement of these gene products as they turnover.

Development of an effective VIGS system for wheat is a significant achievement. Conventional methods of gene isolation and confirmation of gene function are not easily accomplished given wheat's large genome with high ratios of physical to genetic distance, high genetic redundancy due to polyploidy, and its recalcitrance to most methods of transformation that involve regeneration. The steps required to utilize the BSMV-VIGS system are straightforward and, with the exception of inoculating plants with BSMV transcripts, not highly labor intensive. We anticipate that large-scale screens of hundreds of candidate wheat cDNAs will be possible with BSMV-VIGS.

	MATERIALS AND METHODS

TOP ABSTRACT RESULTS DISCUSSION MATERIALS AND METHODS LITERATURE CITED

 

Construction of BSMV-Derived Vectors

The plasmids utilized in these experiments are based on the constructs described by Holzberg et al. (2002). The BSMV constructs utilized to evaluate the silencing efficiency of different length PDS4 fragments were constructed as follows: Derivatives of the PDS4as fragment (Holzberg et al., 2002) with lengths of 120, 80, and 40 bp were generated by performing three PCRs using pPDS4 as a template. A common reverse primer, TATGCGGCCGCCTACTTTCAGGAGGATTAC, was used with the following forward primers: ATATTAATTAACAATTTCATAAACCCTGACG, ATATTAATTAATGATTGCTCTAAACCGTTTTC, and ATATTAATTAAAAAATGGCATTCTTGGATGG. The PCR products were digested with NotI and PacI and ligated into NotI + PacI-digested pPDS4as (Holzberg et al., 2002). Silencing of Lr21 and HSP90 was performed using a RNA vector, pSS031-1, which was generated by digesting pPDS4as with NotI + PacI and replacing the PDS4as insert with annealed oligonucleotides that form a unique SmaI site between the NotI and PacI cloning sites.

PCR Amplification of Plant Genes

The fragments used to silence Lr21, RAR1, and SGT1 were generated by PCR amplification from plasmids containing the cloned genes. A 172-bp fragment of Lr21 was amplified from the plasmid pLr21 with the forward primer GAACGAAGATGACGAACAA and reverse primer ATGAGCCGGTACTAAAGGTC. A 412-bp fragment of barley (Hordeum vulgare) RAR1 was amplified from plasmid pLK14 (Shirasu et al., 1999) using the forward primer ATATTAATTAAAAGGCAACCCCACCAAAGTCAGC and reverse primer TATGCGGCCGCATCAGCATTGTGCCACCCCTTTG. A 592-bp fragment of barley SGT1 was PCR amplified from the plasmid pCA110 (Azevedo et al., 2002) with the forward primer ATATTAATTAAGGAGAATGCACAGCCAACGGTAG and reverse primer TATGCGGCCGCCGTCTTTTTCCCGACATCTTTCC. To generate the fragment of common wheat (Triticum aestivum) HSP90 that was used for silencing, total RNA was prepared from WGRC7 and reverse transcribed as described below. A 170-bp fragment of HSP90 was amplified from this cDNA using the forward primer GGCGCCTGAGAACGACAC and the reverse primer AAACCGATACAGCGACCATCC.

In Vitro Transcription of Viral RNAs and Plant Inoculations

Capped in vitro transcripts were prepared from three linearized plasmids that contain the tripartite BSMV genome using the mMessage mMachine T7 in vitro transcription kit (Ambion, Austin, TX), following the manufacturer's protocol. These in vitro transcription reactions typically result in 1 to 1.5 µg/µL final concentration of RNA. Plants were infected with BSMV using a modified protocol (Holzberg et al., 2002). One microliter of each of the in vitro transcription reactions for the , , and RNAs were combined and added to 22.5 µL of FES (Pogue et al., 1998). This mixture was then applied to plants by rub inoculation. The mixture was pipetted between the pinched thumb and first finger of a gloved hand. The base of the plant to be inoculated was then held with the other hand while the first leaf was gently squeezed between gloved first finger and thumb. The entire leaf surface was then coated with this mixture by sliding the gently pinched fingers from base to tip two times. Over the course of our studies, greater than 95% of the wheat plants that were inoculated with BSMV:PDS4as developed photobleaching.

RNA Extraction and cDNA Synthesis

Total RNA was extracted from plants using the TriZol (Sigma-Aldrich, Milwaukee, WI) protocol as given by the manufacturer. All RNA samples were digested with DNAse I prior to synthesizing cDNA, using the TURBO DNA-Free kit as recommended by the manufacturer (Ambion). First-strand cDNA was synthesized using the I-SCRIPT kit (Bio-Rad, Hercules, CA), following the manufacturer's protocol.

Measurements of mRNAs by QRT-PCR

Expression of the genes targeted for silencing was quantified by comparative QRT-PCR. The measurements were performed in a Stratagene MX3000P QRT-PCR machine using the I-TAQ SYBR reagent kit (Bio-Rad). Four plants were grown and infected with each BSMV construct. The third leaves of each treated plant were harvested 12 d after infection, unless described otherwise. Leaves from each treatment were pooled and total RNA was prepared as described above. QRT-PCR was performed in quadruplicate for each RNA sample/primer combination. The amounts of RNA in each reaction were normalized using primers specific for 18S rRNA. The sequences used to detect each gene are as follows: 18S forward, GTGACGGGTGACGGAGAATT; 18S reverse, GACACTAATGCGCCCGGTAT; PDS forward, TGTCTTTAGCGTGCAAG; PDS reverse, GATGATTTCGGTGTCACT; HSP90 forward, CGACCAGCACGCTCACGAT; HSP90 reverse, GCGATGGTCCCGAGGTTGT; RAR1 forward, ATGCGGTGCCAGCGAATA; RAR1 reverse, GGGTTGTCGTCGTCGGTG; SGT1 forward, CAAGCTGGGCAGTTAC; and SGT1 reverse, GCTTTATGCATCGAAGGA. Suppression of Lr21 using the Lr21 (4246-4420) VIGS construct was measured with the following primers: Lr21 forward, AGCCCGGTCATGTGACTA, and Lr21 reverse, GGAGCTGTTGGTTCGTGT. Suppression by Lr21 (3493-3712) was assayed with the following primers: Lr21(2) forward, GAACGAAGATGACGAACAA, and Lr21(2) reverse, ATGAGCCGGTACTAAAGGTC. In all cases, expression of the targeted gene is presented as the expression level in the silenced plant relative to expression of the same gene in plants infected with BSMV:00.

Plant Material and Growth Conditions

Barley cv Black Hulless and common wheat cv Bobwhite, WI, and WRGC-7 seeds were sown in 4-inch pots containing potting soil and placed under greenhouse conditions: 20°C to 25°C with supplemental light to provide daylengths equal to or greater than 11.5 h and watered as needed. Plants were also grown in a Conviron PGR15 growth chamber (Winnipeg, Canada) equipped with high-intensity discharge lamps, with light intensity ranging between 450 and 700 µmol m^–2 s^–1, programmed for 16-h days with 25°C during the day and 20°C at night.

Puccinia triticina-Wheat Interaction Assays

Leaf rust resistance was evaluated on newly emerging leaves 8 d after viral inoculation. BSMV-infected plants were sprayed with P. triticina spores (isolate PRTUS6) using an air compressor and nozzle, then placed in a moist chamber at 15°C overnight. Infection type was documented and photographed 9 to 10 d after rust inoculation.

Availability of Biomaterials

Upon request, all novel materials described in this publication will be made available in a timely manner for noncommercial research purposes, subject to the requisite permission from any third party owners of all or parts of the material. Obtaining any permissions will be the responsibility of the requestor.

The use of any trademarked products does not constitute an endorsement by the U.S. Department of Agriculture, Agricultural Research Service.

	ACKNOWLEDGMENTS

 
We thank the Large Scale Biology Corporation for making available for these studies the BSMV constructs described by Holzberg et al. (2002). S.R.S. thanks Ken Shirasu (Sainsbury Laboratory, Norwich, UK) for sending plasmids containing the barley RAR1 and SGT1 sequences. S.R.S. and A.S.B. acknowledge the assistance with plant growth provided by Lauren Greig. We thank Larry Dunkle, Cliff Weil, and Joe Anderson for reviewing this manuscript, and Andy Jackson and John Lindbo for helpful discussions.

Received February 23, 2005; returned for revision May 12, 2005; accepted May 27, 2005.

	FOOTNOTES

 
¹ This work was supported by the U.S. Department of Agriculture, Agricultural Research Service Current Research Information System (project 3602–21220–008–00D; S.R.S. and A.S.B.), and by the Plant Biotechnology Center at Kansas State University and the Kansas Wheat Commission (funds to L.H. and B.S.G.).

² These authors contributed equally to the paper.

Article, publication date, and citation information can be found at www.plantphysiol.org/cgi/doi/10.1104/pp.105.061861.

^* Corresponding author; e-mail scofield{at}purdue.edu; fax 765–496–2926.

	LITERATURE CITED

TOP ABSTRACT RESULTS DISCUSSION MATERIALS AND METHODS LITERATURE CITED

 
Agrios GN (1988) Plant Pathology, Ed 3. Academic Press, San Diego

Arumuganathan K, Earle ED (1991) Nuclear DNA content of some important plant species. Plant Mol Biol Rep 9: 208–219

Austin MJ, Muskett P, Kahn K, Feys BJ, Jones JD, Parker JE (2002) Regulatory role of SGT1 in early R gene-mediated plant defenses. Science 295: 2077–2080[Abstract/Free Full Text]

Azevedo C, Sadanandom A, Kitagawa K, Freialdenhoven A, Shirasu K, Schulze-Lefert P (2002) The RAR1 interactor SGT1, an essential component of R gene-triggered disease resistance. Science 295: 2073–2076[Abstract/Free Full Text]

Balaji B, Anderson JM (2005) Choosing appropriate endogenous control genes as internal references for quantitative real-time PCR analysis in cereals crops. J Exp Bot (in press)

Burch-Smith TM, Anderson JC, Martin GB, Dinesh-Kumar SP (2004) Applications and advantages of virus-induced gene silencing for gene function studies in plants. Plant J 39: 734–746[CrossRef][ISI][Medline]

Crasta OR, Francki MG, Bucholz DB, Sharma HC, Zhang J, Wang RC, Ohm HW, Anderson JM (2000) Identification and characterization of wheat-wheatgrass translocation lines and localization of barley yellow dwarf virus resistance. Genome 43: 698–706[Medline]

Denli AM, Hannon GJ (2003) RNAi: an ever-growing puzzle. Trends Biochem Sci 28: 196–201[CrossRef][ISI][Medline]

Feuillet C, Travella S, Stein N, Albar L, Nublat A, Keller B (2003) Map-based isolation of the leaf rust disease resistance gene Lr10 from the hexaploid wheat (Triticum aestivum L.) genome. Proc Natl Acad Sci USA 100: 15253–15258[Abstract/Free Full Text]

Flor HH (1971) Current status of the gene-for-gene concept. Annu Rev Phytopathol 9: 275–296[CrossRef][ISI]

Gill BS, Appels R, Botha-Oberholster AM, Buell CR, Bennetzen JL, Chalhoub B, Chumley F, Dvorak J, Iwanaga M, Keller B, et al (2004) A workshop report on wheat genome sequencing: International Genome Research on Wheat Consortium. Genetics 168: 1087–1096[Abstract/Free Full Text]

Guo HS, Fei JF, Xie Q, Chua NH (2003) A chemical-regulated inducible RNAi system in plants. Plant J 34: 383–392[CrossRef][ISI][Medline]

Holzberg S, Brosio P, Gross C, Pogue GP (2002) Barley stripe mosaic virus-induced gene silencing in a monocot plant. Plant J 30: 315–327[CrossRef][ISI][Medline]

Huang L, Brooks SA, Li W, Fellers JP, Trick HN, Gill BS (2003) Map-based cloning of leaf rust resistance gene Lr21 from the large and polyploid genome of bread wheat. Genetics 164: 655–664[Abstract/Free Full Text]

Hubert DA, Tornero P, Belkhadir Y, Krishna P, Takahashi A, Shirasu K, Dangl JL (2003) Cytosolic HSP90 associates with and modulates the Arabidopsis RPM1 disease resistance protein. EMBO J 22: 5679–5689[CrossRef][ISI][Medline]

Lacomme C, Hrubikova K, Hein I (2003) Enhancement of virus-induced gene silencing through viral-based production of inverted-repeats. Plant J 34: 543–553[CrossRef][ISI][Medline]

Liu Y, Burch-Smith T, Schiff M, Feng S, Dinesh-Kumar SP (2004) Molecular chaperone Hsp90 associates with resistance protein N and its signaling proteins SGT1 and Rar1 to modulate an innate immune response in plants. J Biol Chem 279: 2101–2108[Abstract/Free Full Text]

Lu R, Malcuit I, Moffett P, Ruiz MT, Peart J, Wu AJ, Rathjen JP, Bendahmane A, Day L, Baulcombe DC (2003a) High throughput virus-induced gene silencing implicates heat shock protein 90 in plant disease resistance. EMBO J 22: 5690–5699[CrossRef][ISI][Medline]

Lu R, Martin-Hernandez AM, Peart JR, Malcuit I, Baulcombe DC (2003b) Virus-induced gene silencing in plants. Methods 30: 296–303[CrossRef][ISI][Medline]

McElroy D, Louwerse JD, McElroy SM, Lemaux PG (1997) Development of a simple transient assay for Ac/Ds activity in cells of intact barley tissue. Plant J 11: 157–165[CrossRef][Medline]

McKinney HH (1965) Biological Characteristics of Barley Stripe-Mosaic Virus Strains and Their Evolution. Agricultural Research Service, U.S. Department of Agriculture, Washington, DC

Muskett P, Parker J (2003) Role of SGT1 in the regulation of plant R gene signalling. Microbes Infect 5: 969–976[CrossRef][ISI][Medline]

Peart JR, Lu R, Sadanandom A, Malcuit I, Moffet P, Brice DC, Schauser L, Jaggard DA, Xiao S, Coleman MJ, Dow M, Jones JD, Shirasu K, Baulcombe DC (2002) Proc Natl Acad Sci USA 99: 10865–10869[Abstract/Free Full Text]

Petty IT, Hunter BG, Wei N, Jackson AO (1989) Infectious barley stripe mosaic virus RNA transcribed in vitro from full-length genomic cDNA clones. Virology 171: 342–349[CrossRef][Medline]

Pfaffl MW (2001) A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res 29: e45[Abstract/Free Full Text]

Picard D (2002) Heat-shock protein 90, a chaperone for folding and regulation. Cell Mol Life Sci 59: 1640–1648[CrossRef][ISI][Medline]

Pogue GP, Lindbo JA, Dawson WO, Turpen TH, editors (1998) Tobamovirus Transient Expression Vectors: Tools for Plant Biology and High-Level Expression of Foreign Proteins in Plants. Kluwer Academic Publishers, Dordrecht, The Netherlands

Sears ER (1954) The aneuploids of common wheat. Mo Agric Exp Stn Res Bull 572: 1–58

Shirasu K, Lahaye T, Tan MW, Zhou F, Azevedo C, Schulze-Lefert P (1999) A novel class of eukaryotic zinc-binding proteins is required for disease resistance signaling in barley and development in C. elegans. Cell 99: 355–366[CrossRef][ISI][Medline]

Sisler WW, Timian RG (1956) Inheritance of the barley stripe mosaic virus resistance of Modjo (C.I. 3212) and C.I. 3212-1. Plant Dis Rep 40: 1106–1107

Tai TH, Dahlbeck D, Clark ET, Gajiwala P, Pasion R, Whalen MC, Stall RE, Staskawicz BJ (1999) Expression of the Bs2 pepper gene confers resistance to bacterial spot disease in tomato. Proc Natl Acad Sci USA 96: 14153–14158[Abstract/Free Full Text]

Takahashi A, Casais C, Ichimura K, Shirasu K (2003) HSP90 interacts with RAR1 and SGT1 and is essential for RPS2-mediated disease resistance in Arabidopsis. Proc Natl Acad Sci USA 100: 11777–11782[Abstract/Free Full Text]

Thomas CL, Jones L, Baulcombe DC, Maule AJ (2001) Size constraints for targeting post-transcriptional gene silencing and for RNA-directed methylation in Nicotiana benthamiana using a potato virus X vector. Plant J 25: 417–425[CrossRef][ISI][Medline]

Tor M, Gordon P, Cuzick A, Eulgem T, Sinapidou E, Mert-Turk F, Can C, Dangl JL, Holub EB (2002) Arabidopsis SGT1b is required for defense signaling conferred by several downy mildew resistance genes. Plant Cell 14: 993–1003[Abstract/Free Full Text]

Yahiaoui N, Srichumpa P, Dudler R, Keller B (2004) Genome analysis at different ploidy levels allows cloning of the powdery mildew resistance gene Pm3b from hexaploid wheat. Plant J 37: 528–538[CrossRef][ISI][Medline]

Zhang Y, Dorey S, Swiderski M, Jones JD (2004) Expression of RPS4 in tobacco induces an AvrRps4-independent HR that requires EDS1, SGT1 and HSP90. Plant J 40: 213–224[CrossRef][ISI][Medline]

This article has been cited by other articles:

				S. C. Lee, I. S. Hwang, H. W. Choi, and B. K. Hwang Involvement of the Pepper Antimicrobial Protein CaAMP1 Gene in Broad Spectrum Disease Resistance Plant Physiology, October 1, 2008; 148(2): 1004 - 1020. [Abstract] [Full Text] [PDF]

				A. Sindhu, S. Chintamanani, A. S. Brandt, M. Zanis, S. R. Scofield, and G. S. Johal A guardian of grasses: Specific origin and conservation of a unique disease-resistance gene in the grass lineage PNAS, February 5, 2008; 105(5): 1762 - 1767. [Abstract] [Full Text] [PDF]

				B. Spitzer, M. M. B. Zvi, M. Ovadis, E. Marhevka, O. Barkai, O. Edelbaum, I. Marton, T. Masci, M. Alon, S. Morin, et al. Reverse Genetics of Floral Scent: Application of Tobacco Rattle Virus-Based Gene Silencing in Petunia Plant Physiology, December 1, 2007; 145(4): 1241 - 1250. [Abstract] [Full Text] [PDF]

				Y. Dong, T. M. Burch-Smith, Y. Liu, P. Mamillapalli, and S. P. Dinesh-Kumar A Ligation-Independent Cloning Tobacco Rattle Virus Vector for High-Throughput Virus-Induced Gene Silencing Identifies Roles for NbMADS4-1 and -2 in Floral Development Plant Physiology, December 1, 2007; 145(4): 1161 - 1170. [Abstract] [Full Text] [PDF]

				H.-C. Jing, D. Kornyukhin, K. Kanyuka, S. Orford, A. Zlatska, O. P. Mitrofanova, R. Koebner, and K. Hammond-Kosack Identification of variation in adaptively important traits and genome-wide analysis of trait marker associations in Triticum monococcum J. Exp. Bot., October 1, 2007; 58(13): 3749 - 3764. [Abstract] [Full Text] [PDF]

				Y. M. Crane and S. B. Gelvin RNAi-mediated gene silencing reveals involvement of Arabidopsis chromatin-related genes in Agrobacterium-mediated root transformation PNAS, September 18, 2007; 104(38): 15156 - 15161. [Abstract] [Full Text] [PDF]

				A. Oikawa, A. Rahman, T. Yamashita, H. Taira, and S.-i. Kidou Virus-induced gene silencing of P23k in barley leaf reveals morphological changes involved in secondary wall formation J. Exp. Bot., July 1, 2007; 58(10): 2617 - 2625. [Abstract] [Full Text] [PDF]

				K. K. Bhattarai, Q. Li, Y. Liu, S. P. Dinesh-Kumar, and I. Kaloshian The Mi-1-Mediated Pest Resistance Requires Hsp90 and Sgt1 Plant Physiology, May 1, 2007; 144(1): 312 - 323. [Abstract] [Full Text] [PDF]

				J. Cockram, H. Jones, F. J. Leigh, D. O'Sullivan, W. Powell, D. A. Laurie, and A. J. Greenland Control of flowering time in temperate cereals: genes, domestication, and sustainable productivity J. Exp. Bot., April 9, 2007; (2007) erm042v1. [Abstract] [Full Text] [PDF]

				H.-C. Lu, H.-H. Chen, W.-C. Tsai, W.-H. Chen, H.-J. Su, D. C.-N. Chang, and H.-H. Yeh Strategies for Functional Validation of Genes Involved in Reproductive Stages of Orchids Plant Physiology, February 1, 2007; 143(2): 558 - 569. [Abstract] [Full Text] [PDF]

				E. A. Kellogg Progress and challenges in studies of the evolution of development J. Exp. Bot., October 1, 2006; 57(13): 3505 - 3516. [Abstract] [Full Text] [PDF]