|
|
||||||||
|
First published online July 15, 2005; 10.1104/pp.105.061861 Plant Physiology 138:2165-2173 (2005) © 2005 American Society of Plant Biologists Development of a Virus-Induced Gene-Silencing System for Hexaploid Wheat and Its Use in Functional Analysis of the Lr21-Mediated Leaf Rust Resistance Pathway1United States Department of Agriculture, Agricultural Research Service, Crop Production and Pest Control Research Unit, West Lafayette, Indiana 47907 (S.R.S., A.S.B.); Department of Agronomy, Purdue University, West Lafayette, Indiana 47907 (S.R.S., A.S.B.); and Department of Plant Pathology, Throckmorton Plant Sciences Center, Kansas State University, Manhattan, Kansas 66506 (L.H., B.S.G.)
Virus-induced gene silencing (VIGS) is an important tool for the analysis of gene function in plants. In VIGS, viruses engineered to carry sequences derived from plant gene transcripts activate the host's sequence-specific RNA degradation system. This mechanism targets the RNAs of the viral genome for degradation, and as the virus contains transcribed plant sequence, homologous host mRNAs are also targeted for destruction. While routinely used in some dicots, no VIGS system was known for monocot plants until the recent report of silencing in barley (Hordeum vulgare) by barley stripe mosaic virus (BSMV). Here, we report development of protocols for use of BSMV to efficiently silence genes in hexaploid wheat (Triticum aestivum). The VIGS system was first optimized in studies silencing phytoene desaturase expression. Next, we used it to assay genes functioning in leaf rust resistance mediated by Lr21, which encodes a nucleotide binding site-leucine-rich repeat class resistance gene product. We demonstrated that infection with BSMV constructs carrying a 150-bp fragment of Lr21 caused conversion of incompatible interactions to compatible, whereas infection with a control construct or one that silences phytoene desaturase had no effect on resistance or susceptibility. Additionally, silencing the RAR1, SGT1, and HSP90 genes, known to be required in many but not all nucleotide binding site-leucine-rich repeat resistance pathways in diverse plant species, resulted in conversion to compatibility, indicating that these genes are essential in Lr21-mediated resistance. These studies indicate that BSMV-VIGS is a powerful tool for dissecting the genetic pathways of disease resistance in hexaploid wheat.
Wheat is one of the most important sources of protein in the human diet. It is a staple for 35% of the human population and supplies approximately 20% of the calories consumed worldwide (http://www.cymmt.org/). Losses from pathogens and pests greatly impact wheat production. One of the most pervasive of these diseases is leaf rust, caused by Puccinia triticina, which over the course of human history has caused famines and ruined the economies of entire countries (Agrios, 1988
Plants have evolved potent surveillance and response systems that provide resistance to a diverse set of pathogens, including fungi, bacteria, viruses, nematodes, and insects. Despite this broad range of intruders, in most cases examined, the resistance pathways (R-pathways) that counter them are based on very similar molecular architecture. One of the best-characterized modes of disease resistance is known as gene-for-gene resistance (Flor, 1971
Intense analysis of NB-LRR-mediated resistance in model plants has greatly expanded our understanding of the mechanisms of gene-for-gene disease resistance. One of the great hopes for this research was that it would make possible the transfer of useful modes of resistance to agriculturally important crops. However, several studies have indicated that it is unlikely that R-genes will retain function when transferred across wide species boundaries, an effect known as restrictive taxonomic functionality (Tai et al., 1999
The genetic analysis of disease resistance in wheat and isolation of genes encoding components of R-pathways is greatly complicated by the fact that most cultivated wheat (>90%) is hexaploid, also called common or bread wheat (Triticum aestivum). In addition to difficulties stemming from genetic redundancy, the wheat genome is extremely large, containing approximately 16,000 Mb of DNA (Arumuganathan and Earle, 1991
RNA-induced gene silencing should be a very useful tool for gene identification and functional analysis in hexaploid wheat. While there are many different systems for triggering RNA-induced gene silencing, all of them involve a common initial step, the production of large quantities of double-stranded RNA (dsRNA) within cells. Accumulation of sufficient levels of dsRNA activates a host defense mechanism that targets all of the sequence within the dsRNA for cleavage into short (2125 nucleotide) interfering RNAs. The short interfering RNAs become incorporated into the RNA-induced silencing complex, where they direct the degradation of any RNAs with sufficient sequence complementarity (Denli and Hannon, 2003
Virus-induced gene silencing (VIGS) strategies have proven very useful in the analysis of gene function in dicot plants (Lu et al., 2003b
Silencing PDS Expression in Hexaploid Wheat Varieties
Our initial tests of BSMV-VIGS in wheat targeted the PDS gene, which provides a convenient visual reporter for silencing. PDS is essential in the carotenoid pigment biosynthetic pathway, and suppression of its activity results in photolysis of chlorophyll, also referred to as photobleaching, in the affected tissues. Two of the BSMV Seven days after rub inoculating the first and second leaves of 7-d-old seedlings with BSMV:PDS4 or BSMV:PDS4as, evidence of photobleaching was first apparent in third and fourth leaves of the barley plants. Photobleaching also developed in wheat, but it was not detectable until 10 d after viral inoculation. No evidence of photobleaching was observed in the plants infected with BSMV:00. Interestingly, the mosaic symptoms and chlorosis characteristic of BSMV infection in barley were much less pronounced in wheat. The extent of photobleaching is similar in both species; the primary area affected is the base of the third leaf, while areas throughout the length of the fourth leaf are often bleached (Fig. 1A). Photobleaching was very rarely observed in the fifth leaves of either species. While the photobleaching phenotypes are very similar in wheat and barley, the most striking difference is that photobleaching in wheat often did not encompass the entire width of a leaf; photobleaching was often confined to narrow stripes that were parallel to the leaf veins (Fig. 1B). No consistent differences were apparent in the photobleaching resulting from the sense or antisense orientation of the PDS4 fragment (data not shown). Therefore, for simplicity we chose to use the antisense orientation of plant cDNA fragments in all subsequent work.
The BSMV:PDS4as photobleaching phenotype is robust and reliable and can be generated throughout the year in greenhouse-grown wheat; however, the affected leaf area was reduced and viral symptoms increased during the summer. This led us to explore the use of growth chambers. We found that growing the plants in a growth chamber set for 16-h light and operating at 25°C during the day and 20°C at night gave excellent results in VIGS experiments targeting PDS expression. In the course of our work, six additional hexaploid wheat varieties and one wheat-wheatgrass translocation line (Crasta et al., 2000
A derivative of the
Previously, PDS fragments ranging in size from 1,215 to 185 bp (PDS4 and PDS4as) were compared in their efficiency in silencing barley PDS, but no correlation between length and silencing efficiency was observed (Holzberg et al., 2002
Time-Course Analysis of PDS mRNA Abundance when Targeted for Silencing by BSMV-VIGS
Our intention to use BSMV-VIGS for assessing the functional requirement for genes in resistance necessitates understanding the time course for establishment and maintenance of silencing. An appropriate interval of time can then be chosen between infecting with BSMV to initiate VIGS and the application of the pathogen to challenge the plant resistance system. To examine the time course of BSMV-VIGS, we employed quantitative real-time PCR (QRT-PCR) to measure the level of wheat PDS expression at 3, 7, 10, 13, 16, 18, and 21 d after inoculation with BSMV:00 or BSMV:PDS4as. Four plants were infected with BSMV:00 and BSMV:PDS4as for each time point. The third leaves of the plants for each treatment were pooled and total RNA was extracted. First-strand cDNA was synthesized from each pooled RNA sample using a mixture of random hexamers and oligo(dT) to prime synthesis. The level of endogenous PDS expression was determined by comparative QRT-PCR (Pfaffl, 2001
This analysis indicated that silencing of PDS in the uninoculated third leaves was detectable as early as 3 d after inoculation with BSMV:PDS4as. Reduction of PDS expression by at least 60% was evident throughout the entire time course. Significant variation was evident between time points, and each biological replicate displays examples where the PDS message levels were found to be higher than the preceding or succeeding measurements. Given the variation in the visual appearance of photobleaching that is often observed, we believe that this fluctuation is likely to be a result of heterogeneity in the areas of leaf tissue affected by silencing. However, it is also possible that these variations reflect fluctuations in the level of silencing over time resulting from an unknown aspect of BSMV infection and silencing mechanisms.
Having demonstrated that BSMV can silence genes in various hexaploid wheat varieties and having defined the time course for the establishment and maintenance of BSMV-VIGS, we asked if this system could be used to assess the function of genes in a wheat disease R-pathway. The Lr21 R-gene has been cloned and is known to encode a protein that is a member of the largest structural class of R-genes, the NB-LRR family (Huang et al., 2003
To make the silencing as specific as possible for Lr21, a 174-bp fragment comprised almost entirely from Lr21 3' untranslated sequence, designated Lr21 (4246-4420), was first chosen for cloning into the BSMV A wheat variety carrying the Lr21 R-gene, WGRC7, and a susceptible line, Wichita (WI), were used in this analysis. Ten plants of each wheat line were inoculated with BSMV:00, BSMV:PDS4as, BSMV:Lr21, BSMV:RAR1, BSMV:SGT1, and BSMV:HSP90 7 d after germination. After an additional 8 d to permit establishment of VIGS, all of the plants were spray inoculated with P. triticina isolate PRTUS6, which is avirulent on WGRC7 and virulent on WI. Infection with BSMV:00 (Fig. 3A) or BSMV:PDS4as (Fig. 3B) had no effect on the normal resistance and susceptibility expected of WGRC7 and WI, respectively. However, when WGRC7 was infected with BSMV:Lr21 (4246-4420), BSMV:RAR1, BSMV:SGT1, or BSMV:HSP90, areas of susceptibility became apparent on approximately the distal most 10 cm of the third leaves of all the plants, indicating that the products of all four genes are required for Lr21-mediated resistance to PRTUS6 (Fig. 4). Infection of WI with each of these BSMV constructs had no observable effect on susceptibility (data not shown).
Comparative QRT-PCR was performed to confirm the silencing of each of the targeted genes (Table II). Sets of four WGRC7 plants were infected with BMSV:00, BSMV:Lr21 (4246-4420), BSMV:RAR1, BSMV:SGT1, or BSMV:HSP90. The third leaves of each set were collected 12 d after inoculation and pooled for RNA extraction. The expression level for each target gene was determined relative to the expression of the same gene in the BSMV:00-treated leaves. The degree of suppression determined for RAR1 and SGT1, 54% and 83%, respectively, is similar to what had been determined for PDS; however, less suppression was measured for Lr21 and HSP90.
In the case of Lr21, we have reason to believe that the level of suppression may actually be significantly greater than what was measured in this analysis. Because of the large number of NB-LRR genes in the wheat genome, a fragment from the Lr21 gene that is comprised almost entirely of 3' untranslated sequence was selected for cloning into the BSMV RNA in an effort to enhance the specificity of Lr21 silencing. Lr21 is encoded on chromosome 1D of wheat (Lr21D); however, homeoloci of Lr21 are also present on chromosomes 1A and 1B, but they encode no known resistance specificities. After initiating these studies, a nullisomic1D-tetrasomic1A wheat line (missing 1D but having four copies of 1A and two copies of 1B chromosomes; Sears, 1954
To test this hypothesis, a second VIGS experiment using a conserved portion of Lr21A, B, and D homeologs was undertaken. A 219-bp fragment from the LRR domain of Lr21 was cloned into the BSMV
Here, we demonstrate that vectors based on BSMV can be effective reverse-genetics tools for the analysis of gene function in hexaploid wheat. Our initial tests focused on comparing the BSMV:VIGS systems in wheat and barley using the convenient photobleaching phenotype generated by silencing PDS. These comparisons indicated that BSMV-VIGS gave largely similar results in barley and wheat. When the first and second leaves of barley and wheat were inoculated, large areas of photobleaching were observed in the third and fourth leaves of both species; however, in wheat photobleaching less frequently extends across the width of the leaf without interruption and often has a striped appearance. All of our PDS silencing studies in wheat were performed using derivatives of the barley PDS cDNA, which is 96% identical to the wheat EST sequence, with four divergent bases at positions 48, 66, 126, and 140 in the longest fragment tested (PDS4 and PDS4as). Therefore, it is possible that these phenotypic differences may be due to the imperfect homology between the barley PDS VIGS fragment and the wheat genes targeted. Tests using the equivalent wheat PDS sequence will resolve this question.
In these studies, five different genes were targeted and successfully silenced in leaf tissue of wheat. Our long-term goal is to employ BSMV-VIGS to characterize the pathways of resistance to a number of pathogens of wheat, and, therefore, four of the genes that were silenced in this study were chosen for their likely involvement in gene-for-gene-mediated disease resistance. The Lr21 NB-LRR R-gene serves as a positive control for BSMV-VIGS in the leaf rust assay because its function had been confirmed by complementation in transgenic wheat (Huang et al., 2003
The remaining three genes tested, RAR1, SGT1, and HSP90, were chosen for study because they are among the small group of genes whose products have been demonstrated to be required for the function of multiple R-pathways in Arabidopsis, tobacco (Nicotiana benthamiana), tomato (Lycopersicon esculentum), and barley. RAR1 has been shown to be required in about one-half of the R-pathways in which its function has been tested. SGT1 was first identified as a RAR1-interacting protein in yeast two-hybrid screens. It is also required in a wide range of R-gene and nonhost resistance mechanisms (Peart et al., 2002
Recent studies have demonstrated that the cytosolic HSP90 plays an essential role in the Rx, Pto, N, RPM1, RPS2, and RPS4 R-pathways (Hubert et al., 2003
We believe that BSMV-VIGS will be an excellent tool for the functional analysis of the Lr21-mediated R-pathway. The assay has been repeated many times under greenhouse and growth chamber conditions, and in each test silencing these genes resulted in a very clear conversion to susceptibility. A robust assay for loss of Lr21-mediated disease resistance will be a great advantage when we begin to screen for genes encoding novel Lr21-pathway components. VIGS screens for genes required in other R-pathways have been based on loss of the hypersensitive response as the primary criteria for identifying genes, but it was found that only a small fraction of genes identified in this way was actually essential for disease resistance (Lu et al., 2003a
At the outset of our work, we were concerned that the physiological stresses associated with viral infection or defense responses to BSMV might interfere with our ability to observe the operation of the R-pathways that we are attempting to functionally dissect. However, it was noted that the symptoms associated with infection with the BSMV:00 control virus that contains no plant gene sequences were significantly less severe in wheat than in barley. This suggests that the background physiological changes associated with BSMV infection may be less severe in wheat, which would be a great benefit for work investigating disease resistance or other plant processes. Additionally, in our work with several different barley and wheat varieties, we observed that in contrast to the wheat lines, which were uniformly conducive to BSMV-VIGS, several barley lines supported BSMV-VIGS at clearly reduced levels. Variation in the susceptibility of different barley genotypes to BSMV infection has been reported (McKinney, 1965
It is interesting to note that the location of tissue that displayed susceptibility to P. triticina in our studies was not coincident with the area of maximum photobleaching in the PDS silencing experiments. Susceptibility developed in the distal 10 cm of the third leaves, while photobleaching most frequently appeared at the base of the third leaf and rarely extended into the tip region. The limitation of susceptibility to the leaf tip is a consequence of leaf growth that occurs during the 8 d between the application of P. triticina and the development of rust symptoms; the lower portion of the leaf was not exposed to the fungus because it had not formed at the time of fungal inoculation. However, in the case of PDS, while silencing occurs throughout the length of the third leaf, photobleaching is rarely observed near the tip. We believe this is best explained by the biological differences underlying these two phenotypes. PDS has an essential function in the production of carotenoid pigments, which are likely to be very stable once produced. Therefore, if PDS silencing is not established before these pigments are synthesized at the leaf tip, photobleaching will not appear there (Guo et al., 2003 Development of an effective VIGS system for wheat is a significant achievement. Conventional methods of gene isolation and confirmation of gene function are not easily accomplished given wheat's large genome with high ratios of physical to genetic distance, high genetic redundancy due to polyploidy, and its recalcitrance to most methods of transformation that involve regeneration. The steps required to utilize the BSMV-VIGS system are straightforward and, with the exception of inoculating plants with BSMV transcripts, not highly labor intensive. We anticipate that large-scale screens of hundreds of candidate wheat cDNAs will be possible with BSMV-VIGS.
Construction of BSMV-Derived Vectors
The plasmids utilized in these experiments are based on the constructs described by Holzberg et al. (2002)
The fragments used to silence Lr21, RAR1, and SGT1 were generated by PCR amplification from plasmids containing the cloned genes. A 172-bp fragment of Lr21 was amplified from the plasmid pLr21 with the forward primer GAACGAAGATGACGAACAA and reverse primer ATGAGCCGGTACTAAAGGTC. A 412-bp fragment of barley (Hordeum vulgare) RAR1 was amplified from plasmid pLK14 (Shirasu et al., 1999
Capped in vitro transcripts were prepared from three linearized plasmids that contain the tripartite BSMV genome using the mMessage mMachine T7 in vitro transcription kit (Ambion, Austin, TX), following the manufacturer's protocol. These in vitro transcription reactions typically result in 1 to 1.5 µg/µL final concentration of RNA. Plants were infected with BSMV using a modified protocol (Holzberg et al., 2002
Total RNA was extracted from plants using the TriZol (Sigma-Aldrich, Milwaukee, WI) protocol as given by the manufacturer. All RNA samples were digested with DNAse I prior to synthesizing cDNA, using the TURBO DNA-Free kit as recommended by the manufacturer (Ambion). First-strand cDNA was synthesized using the I-SCRIPT kit (Bio-Rad, Hercules, CA), following the manufacturer's protocol.
Expression of the genes targeted for silencing was quantified by comparative QRT-PCR. The measurements were performed in a Stratagene MX3000P QRT-PCR machine using the I-TAQ SYBR reagent kit (Bio-Rad). Four plants were grown and infected with each BSMV construct. The third leaves of each treated plant were harvested 12 d after infection, unless described otherwise. Leaves from each treatment were pooled and total RNA was prepared as described above. QRT-PCR was performed in quadruplicate for each RNA sample/primer combination. The amounts of RNA in each reaction were normalized using primers specific for 18S rRNA. The sequences used to detect each gene are as follows: 18S forward, GTGACGGGTGACGGAGAATT; 18S reverse, GACACTAATGCGCCCGGTAT; PDS forward, TGTCTTTAGCGTGCAAG; PDS reverse, GATGATTTCGGTGTCACT; HSP90 forward, CGACCAGCACGCTCACGAT; HSP90 reverse, GCGATGGTCCCGAGGTTGT; RAR1 forward, ATGCGGTGCCAGCGAATA; RAR1 reverse, GGGTTGTCGTCGTCGGTG; SGT1 forward, CAAGCTGGGCAGTTAC; and SGT1 reverse, GCTTTATGCATCGAAGGA. Suppression of Lr21 using the Lr21 (4246-4420) VIGS construct was measured with the following primers: Lr21 forward, AGCCCGGTCATGTGACTA, and Lr21 reverse, GGAGCTGTTGGTTCGTGT. Suppression by Lr21 (3493-3712) was assayed with the following primers: Lr21(2) forward, GAACGAAGATGACGAACAA, and Lr21(2) reverse, ATGAGCCGGTACTAAAGGTC. In all cases, expression of the targeted gene is presented as the expression level in the silenced plant relative to expression of the same gene in plants infected with BSMV:00.
Barley cv Black Hulless and common wheat cv Bobwhite, WI, and WRGC-7 seeds were sown in 4-inch pots containing potting soil and placed under greenhouse conditions: 20°C to 25°C with supplemental light to provide daylengths equal to or greater than 11.5 h and watered as needed. Plants were also grown in a Conviron PGR15 growth chamber (Winnipeg, Canada) equipped with high-intensity discharge lamps, with light intensity ranging between 450 and 700 µmol m2 s1, programmed for 16-h days with 25°C during the day and 20°C at night.
Leaf rust resistance was evaluated on newly emerging leaves 8 d after viral inoculation. BSMV-infected plants were sprayed with P. triticina spores (isolate PRTUS6) using an air compressor and nozzle, then placed in a moist chamber at 15°C overnight. Infection type was documented and photographed 9 to 10 d after rust inoculation.
Upon request, all novel materials described in this publication will be made available in a timely manner for noncommercial research purposes, subject to the requisite permission from any third party owners of all or parts of the material. Obtaining any permissions will be the responsibility of the requestor. The use of any trademarked products does not constitute an endorsement by the U.S. Department of Agriculture, Agricultural Research Service.
We thank the Large Scale Biology Corporation for making available for these studies the BSMV constructs described by Holzberg et al. (2002). S.R.S. thanks Ken Shirasu (Sainsbury Laboratory, Norwich, UK) for sending plasmids containing the barley RAR1 and SGT1 sequences. S.R.S. and A.S.B. acknowledge the assistance with plant growth provided by Lauren Greig. We thank Larry Dunkle, Cliff Weil, and Joe Anderson for reviewing this manuscript, and Andy Jackson and John Lindbo for helpful discussions. Received February 23, 2005; returned for revision May 12, 2005; accepted May 27, 2005.
1 This work was supported by the U.S. Department of Agriculture, Agricultural Research Service Current Research Information System (project 36022122000800D; S.R.S. and A.S.B.), and by the Plant Biotechnology Center at Kansas State University and the Kansas Wheat Commission (funds to L.H. and B.S.G.).
2 These authors contributed equally to the paper. Article, publication date, and citation information can be found at www.plantphysiol.org/cgi/doi/10.1104/pp.105.061861. * Corresponding author; e-mail scofield{at}purdue.edu; fax 7654962926.
Agrios GN (1988) Plant Pathology, Ed 3. Academic Press, San Diego Arumuganathan K, Earle ED (1991) Nuclear DNA content of some important plant species. Plant Mol Biol Rep 9: 208219
Austin MJ, Muskett P, Kahn K, Feys BJ, Jones JD, Parker JE (2002) Regulatory role of SGT1 in early R gene-mediated plant defenses. Science 295: 20772080
Azevedo C, Sadanandom A, Kitagawa K, Freialdenhoven A, Shirasu K, Schulze-Lefert P (2002) The RAR1 interactor SGT1, an essential component of R gene-triggered disease resistance. Science 295: 20732076 Balaji B, Anderson JM (2005) Choosing appropriate endogenous control genes as internal references for quantitative real-time PCR analysis in cereals crops. J Exp Bot (in press) Burch-Smith TM, Anderson JC, Martin GB, Dinesh-Kumar SP (2004) Applications and advantages of virus-induced gene silencing for gene function studies in plants. Plant J 39: 734746[CrossRef][ISI][Medline] Crasta OR, Francki MG, Bucholz DB, Sharma HC, Zhang J, Wang RC, Ohm HW, Anderson JM (2000) Identification and characterization of wheat-wheatgrass translocation lines and localization of barley yellow dwarf virus resistance. Genome 43: 698706[Medline] Denli AM, Hannon GJ (2003) RNAi: an ever-growing puzzle. Trends Biochem Sci 28: 196201[CrossRef][ISI][Medline]
Feuillet C, Travella S, Stein N, Albar L, Nublat A, Keller B (2003) Map-based isolation of the leaf rust disease resistance gene Lr10 from the hexaploid wheat (Triticum aestivum L.) genome. Proc Natl Acad Sci USA 100: 1525315258 Flor HH (1971) Current status of the gene-for-gene concept. Annu Rev Phytopathol 9: 275296[CrossRef][ISI]
Gill BS, Appels R, Botha-Oberholster AM, Buell CR, Bennetzen JL, Chalhoub B, Chumley F, Dvorak J, Iwanaga M, Keller B, et al (2004) A workshop report on wheat genome sequencing: International Genome Research on Wheat Consortium. Genetics 168: 10871096 Guo HS, Fei JF, Xie Q, Chua NH (2003) A chemical-regulated inducible RNAi system in plants. Plant J 34: 383392[CrossRef][ISI][Medline] Holzberg S, Brosio P, Gross C, Pogue GP (2002) Barley stripe mosaic virus-induced gene silencing in a monocot plant. Plant J 30: 315327[CrossRef][ISI][Medline]
Huang L, Brooks SA, Li W, Fellers JP, Trick HN, Gill BS (2003) Map-based cloning of leaf rust resistance gene Lr21 from the large and polyploid genome of bread wheat. Genetics 164: 655664 Hubert DA, Tornero P, Belkhadir Y, Krishna P, Takahashi A, Shirasu K, Dangl JL (2003) Cytosolic HSP90 associates with and modulates the Arabidopsis RPM1 disease resistance protein. EMBO J 22: 56795689[CrossRef][ISI][Medline] Lacomme C, Hrubikova K, Hein I (2003) Enhancement of virus-induced gene silencing through viral-based production of inverted-repeats. Plant J 34: 543553[CrossRef][ISI][Medline]
Liu Y, Burch-Smith T, Schiff M, Feng S, Dinesh-Kumar SP (2004) Molecular chaperone Hsp90 associates with resistance protein N and its signaling proteins SGT1 and Rar1 to modulate an innate immune response in plants. J Biol Chem 279: 21012108 Lu R, Malcuit I, Moffett P, Ruiz MT, Peart J, Wu AJ, Rathjen JP, Bendahmane A, Day L, Baulcombe DC (2003a) High throughput virus-induced gene silencing implicates heat shock protein 90 in plant disease resistance. EMBO J 22: 56905699[CrossRef][ISI][Medline] Lu R, Martin-Hernandez AM, Peart JR, Malcuit I, Baulcombe DC (2003b) Virus-induced gene silencing in plants. Methods 30: 296303[CrossRef][ISI][Medline] McElroy D, Louwerse JD, McElroy SM, Lemaux PG (1997) Development of a simple transient assay for Ac/Ds activity in cells of intact barley tissue. Plant J 11: 157165[CrossRef][Medline] McKinney HH (1965) Biological Characteristics of Barley Stripe-Mosaic Virus Strains and Their Evolution. Agricultural Research Service, U.S. Department of Agriculture, Washington, DC Muskett P, Parker J (2003) Role of SGT1 in the regulation of plant R gene signalling. Microbes Infect 5: 969976[CrossRef][ISI][Medline]
Peart JR, Lu R, Sadanandom A, Malcuit I, Moffet P, Brice DC, Schauser L, Jaggard DA, Xiao S, Coleman MJ, Dow M, Jones JD, Shirasu K, Baulcombe DC (2002) Proc Natl Acad Sci USA 99: 1086510869 Petty IT, Hunter BG, Wei N, Jackson AO (1989) Infectious barley stripe mosaic virus RNA transcribed in vitro from full-length genomic cDNA clones. Virology 171: 342349[CrossRef][Medline]
Pfaffl MW (2001) A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res 29: e45 Picard D (2002) Heat-shock protein 90, a chaperone for folding and regulation. Cell Mol Life Sci 59: 16401648[CrossRef][ISI][Medline] Pogue GP, Lindbo JA, Dawson WO, Turpen TH, editors (1998) Tobamovirus Transient Expression Vectors: Tools for Plant Biology and High-Level Expression of Foreign Proteins in Plants. Kluwer Academic Publishers, Dordrecht, The Netherlands Sears ER (1954) The aneuploids of common wheat. Mo Agric Exp Stn Res Bull 572: 158 Shirasu K, Lahaye T, Tan MW, Zhou F, Azevedo C, Schulze-Lefert P (1999) A novel class of eukaryotic zinc-binding proteins is required for disease resistance signaling in barley and development in C. elegans. Cell 99: 355366[CrossRef][ISI][Medline] Sisler WW, Timian RG (1956) Inheritance of the barley stripe mosaic virus resistance of Modjo (C.I. 3212) and C.I. 3212-1. Plant Dis Rep 40: 11061107
Tai TH, Dahlbeck D, Clark ET, Gajiwala P, Pasion R, Whalen MC, Stall RE, Staskawicz BJ (1999) Expression of the Bs2 pepper gene confers resistance to bacterial spot disease in tomato. Proc Natl Acad Sci USA 96: 1415314158
Takahashi A, Casais C, Ichimura K, Shirasu K (2003) HSP90 interacts with RAR1 and SGT1 and is essential for RPS2-mediated disease resistance in Arabidopsis. Proc Natl Acad Sci USA 100: 1177711782 Thomas CL, Jones L, Baulcombe DC, Maule AJ (2001) Size constraints for targeting post-transcriptional gene silencing and for RNA-directed methylation in Nicotiana benthamiana using a potato virus X vector. Plant J 25: 417425[CrossRef][ISI][Medline]
Tor M, Gordon P, Cuzick A, Eulgem T, Sinapidou E, Mert-Turk F, Can C, Dangl JL, Holub EB (2002) Arabidopsis SGT1b is required for defense signaling conferred by several downy mildew resistance genes. Plant Cell 14: 9931003 Yahiaoui N, Srichumpa P, Dudler R, Keller B (2004) Genome analysis at different ploidy levels allows cloning of the powdery mildew resistance gene Pm3b from hexaploid wheat. Plant J 37: 528538[CrossRef][ISI][Medline] Zhang Y, Dorey S, Swiderski M, Jones JD (2004) Expression of RPS4 in tobacco induces an AvrRps4-independent HR that requires EDS1, SGT1 and HSP90. Plant J 40: 213224[CrossRef][ISI][Medline] This article has been cited by other articles:
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||