|
|
||||||||
|
First published online August 26, 2005; 10.1104/pp.105.063420 Plant Physiology 139:296-305 (2005) © 2005 American Society of Plant Biologists Loss of Function of OsDCL1 Affects MicroRNA Accumulation and Causes Developmental Defects in Rice1,[w]National Key Laboratory of Plant Genomics and Center for Plant Gene Research, Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, Beijing 100101, China (B.L., P.L., C.L., S.C., C.C., X.C.); Graduate School of the Chinese Academy of Sciences, Beijing 100039, China (B.L., P.L.); and China Agricultural University, Beijing 100094, China (X.L.)
MicroRNAs (miRNAs) and small interfering RNAs (siRNAs) are two types of noncoding RNAs involved in developmental regulation, genome maintenance, and defense in eukaryotes. The activity of Dicer or Dicer-like (DCL) proteins is required for the maturation of miRNAs and siRNAs. In this study, we cloned and sequenced 66 candidate rice (Oryza sativa) miRNAs out of 1,650 small RNA sequences (19 to approximately 25 nt), and they could be further grouped into 21 families, 12 of which are newly identified and three of which, OsmiR528, OsmiR529, and OsmiR530, have been confirmed by northern blot. To study the function of rice DCL proteins (OsDCLs) in the biogenesis of miRNAs and siRNAs, we searched genome databases and identified four OsDCLs. An RNA interference approach was applied to knock down two OsDCLs, OsDCL1 and OsDCL4, respectively. Strong loss of function of OsDCL1IR transformants that expressed inverted repeats of OsDCL1 resulted in developmental arrest at the seedling stage, and weak loss of function of OsDCL1IR transformants caused pleiotropic developmental defects. Moreover, all miRNAs tested were greatly reduced in OsDCL1IR but not OsDCL4IR transformants, indicating that OsDCL1 plays a critical role in miRNA processing in rice. In contrast, the production of siRNA from transgenic inverted repeats and endogenous CentO regions were not affected in either OsDCL1IR or OsDCL4IR transformants, suggesting that the production of miRNAs and siRNAs is via distinct OsDCLs.
Most eukaryotes have two classes of short (2125 nt) noncoding RNAs, microRNAs (miRNAs) and small interfering RNAs (siRNAs), which are involved in RNA-silencing pathways (Baulcombe, 2004
In plants, several components that are involved in miRNA biogenesis and metabolism have been experimentally characterized. In Arabidopsis (Arabidopsis thaliana), miRNA genes are transcribed into long precursors, pri-miRNAs, which are first processed into pre-miRNAs and then into miRNAs by Dicer-like (DCL)1 (Kurihara and Watanabe, 2004
Dicer, a multidomain endonuclease, plays essential roles in RNA-silencing pathways (Tijsterman and Plasterk, 2004 An N-terminal helicase domain, two tandemly repeated RNase III domains, and one or more C-terminal dsRNA-binding domains are highly conserved among all Dicers and DCL proteins. However, the number of DCL proteins varies among different organisms. For example, in mouse (Mus musculus) and human (Homo sapiens), a single Dicer gene is responsible for the generation of both miRNAs and siRNAs, whereas in other organisms, such as flies and plants, multiple DCL proteins exist.
In organisms with multiple DCL genes, these genes may have distinct roles in the RNA-silencing pathways (Kadotani et al., 2004
Arabidopsis has four DCL proteins, and distinct functions have been observed for three of them. DCL1, also named SHORT INTEGUMENTS1/SUSPENSOR1/CARPEL FACTORY (Robinson-Beers et al., 1992
Rice (Oryza sativa), one of the most important crop species in the world, has become the model monocot species for genomic and molecular analysis. Twenty miRNA families have already been identified in rice through computational approaches based on conservation with known miRNAs from Arabidopsis (Llave et al., 2002
Analysis of Small RNAs from Rice
To identify novel miRNAs from rice, we constructed a small RNA library (see "Materials and Methods"). Clones from the above library were sequenced. Nineteen- to 25-nt-long RNA molecules with perfect match to noncoding regions of the rice genome were collected and analyzed. Upstream and downstream genomic sequences of each miRNA candidate (with 20200 nt for each side) were extracted and screened for hairpin-like secondary structure using an m-fold RNA-folding program. Among all sequenced small RNAs, 66 were derived from the stem region of hairpin-structured precursors. Therefore, these small RNAs could be candidate miRNAs according to the current miRNA annotation criteria (Ambros et al., 2003
Rice Has Four DCL Proteins To study the function of OsDCLs in the biogenesis of miRNAs and siRNAs, we searched rice genome databases using the protein sequence of Arabidopsis DCL1. Four putative rice proteins, named OsDCL1 to OsDCL4, were identified from the National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov/) and the Plant Chromatin Database (http://www.chromdb.org). Sequences of these OsDCLs were aligned with selected plant and animal Dicer or DCL proteins to explore their relationships.
Phylogenetic analysis of DCL proteins from different species showed that Dicer-1 in Drosophila, mouse, and human were grouped together (Fig. 2). Dicer-2 from Drosophila was separated from other animal Dicers reflecting its unique function in siRNA processing (Lee et al., 2004
Knock Down of OsDCL1 and OsDCL4 by RNAi To understand the roles of OsDCLs in the RNA-silencing pathways in rice, especially in miRNA biogenesis, we applied the RNAi approach to knock down rice OsDCLs. Phylogenetic analysis showed that among all OsDCLs, OsDCL1 was the closest to DCL1, which is responsible for miRNA processing in Arabidopsis. In order to knock down OsDCLs, we used Pfam (http://pfam.wustl.edu/) to predict the domain structure of OsDCLs (Fig. 3A). OsDCL4 is more similar to OsDCL1 among the four OsDCLs (Figs. 2 and 3A). Therefore, a less conserved region between the DUF283 and PAZ domain of OsDCL1 and OsDCL4 was selected to ensure the specificity of the RNAi experiment (Fig. 3A). dsRNAs were generated under the rice Actin1 promoter (Fig. 3B).
We evaluated whether the RNAi approach resulted in knockdown of OsDCL1 and OsDCL4, respectively. A significant reduction in OsDCL1 expression was observed by reverse transcription (RT)-PCR in loss-of-function transformants of OsDCL1IR compared to that of wild type (Fig. 4A, top section). To rule out the possibility that the RNAi approach also affected other OsDCL genes, we detected the expression of OsDCL2 and OsDCL4 using RT-PCR. As expected, no difference was observed for the expression of OsDCL2 and OsDCL4 between loss of function of OsDCL1IR transformants and wild-type plants (Fig. 4A, middle sections). The Actin gene was used as an internal control in the RT-PCR reactions (Fig. 4A, bottom section). A similar approach was applied to OsDCL4IR transformants, and the expression of OsDCL4, but not OsDCL1 and OsDCL2, was greatly reduced in OsDCL4IR transformants compared to that of control plants (Fig. 4B). These results indicated that OsDCL1 and OsDCL4 had indeed been knocked down specifically by RNAi.
OsDCL1 Is Required for Rice Development In contrast with loss of function of OsDCL4IR transformants that did not show developmental defect at vegetative stage, the regenerated transgenic plants containing OsDCL1 RNAi construct showed various degrees of developmental defects compared to control plants (Fig. 5). Strong loss of function of OsDCL1IR transformants showed overall shoot and root abnormalities such as severe dwarfism and dark green color. These plants often produced rolled leaves and malformed shoots with tortuousness. Root elongation was also greatly reduced in OsDCL1IR transformants (Fig. 5A). During further development, the shoots of strong loss of function of OsDCL1IR transformants were greatly enlarged transversely and rolled leaves wilted and senesced. These plants showed developmental arrest during rooting or at the young seedling stage and eventually died either on sterile medium or in soil (Fig. 5B).
Weak loss of function of OsDCL1IR transformants displayed a dark green color and dwarfism with different leaf and root phenotypes, including narrow, rolled, and outward-folded leaves (Fig. 5C). They also had fewer adventitious roots compared to wild type (Fig. 5C). This is consistent with the exhibition of ago1 in Arabidopsis which regulates adventitious root emergence through mRNA mediate-regulation pathway (Sorin et al., 2005 To further investigate if cellular pattern of adventitious roots had been affected, we made transverse sections at the differentiated region of fresh root tissue. Ectopically developed chloroplasts were found in OsDCL1IR transformants roots; however, the cell number and overall cellular organization of OsDCL1IR transformants roots did not change (Fig. 5, F and G).
Because dcl1 loss-of-function alleles resulted in a reduced miRNA population and caused developmental defects in Arabidopsis, we investigated whether OsDCL1IR transformants also caused a reduction of miRNA in rice. We validated the miRNA level in leaves of OsDCL1IR transformants and different tissues of wild-type plants (Fig. 6). Hybridization results showed that all miRNAs accumulation in leaves of OsDCL1IR transformants was abolished or greatly reduced at the tested loci compared to that of wild-type leaves. These loci included OsmiR156, OsmiR159, OsmiR166, OsmiR167, OsmiR168, OsmiR168*, OsmiR396, and OsmiR528 (Fig. 6). In contrast to OsDCL1, loss of function of OsDCL4IR transformants did not display altered miRNA accumulation from both leaf and flower samples (Fig. 7, A and B, top sections). These results suggest OsDCL1 plays an essential role in miRNA accumulation.
Neither OsDCL1 nor OsDCL4 Is Essential for the Production of siRNAs from Inverted Repeats of Transgene and Endogenous CentO Satellites in Rice
RNAi is an evolutionarily conserved process in which double-stranded RNAs are converted into 21- to 25-nt siRNAs that trigger the degradation of homologous mRNAs. In Arabidopsis, it has been shown that different DCL proteins participate in the biogenesis of siRNAs and miRNAs, respectively (Xie et al., 2004
In order to determine if endogenous siRNAs production was also affected in loss of function of OsDCL1IR and OsDCL4IR transformants, we performed northern-blot hybridization using a probe corresponding to CentO satellites, which is similar to 165-bp repeated sequences in Oryza punctata (Zhang et al., 2005
Rice miRNAs have been identified based on the conserved hairpin structure of miRNA precursor. Yet the experimental evidence of OsmiRNA identification is only recently reported (Sunkar et al., 2005
The Dicer family has relatively more genes in higher plants compared to animals. Different functions were found for different DCL proteins that participate in the biogenesis process of different types of small RNAs. In Arabidopsis, DCL1 is responsible for miRNA but not siRNA accumulation. Impaired miRNA production in dcl1 mutants causes pleiotropic developmental defects but does not affect gene silencing (Jacobsen et al., 1999 Similar to Arabidopsis, the rice genome also contains four OsDCLs. In this paper, we demonstrated that OsDCL1 is essential for miRNA processing. Loss of function of OsDCL1IR transformants greatly reduced miRNA accumulation resulting in pleiotropic phenotypes, but these plants did not affect siRNA production either from inverted repeats of transgene or endogenous CentO satellite repeats. The rice OsDCL4 shares the highest homology to OsDCL1, but it did not affect the accumulation of either miRNA or siRNA from transgenic inverted repeats and endogenous CentO satellites DNA. These results indicate OsDCL1 is the ortholog of DCL1 from Arabidopsis. Moreover, the specificity of OsDCL1 for miRNA biogenesis is conserved between monocots and dicots. We were able to detect both 21-nt and 24-nt-long siRNAs in OsDCL1IR and OsDCL4IR transformants suggesting either OsDCL2 or OsDCL3 or both are required for short and long siRNA accumulation in rice. Although from our limited data OsDCL4 did not affect either siRNAs from its own inverted repeat of transgenes or endogenous CentO siRNAs, we cannot rule out the possibility that OsDCL4 is involved in siRNAs biogenesis at specific loci or at certain types of uncharacterized siRNAs. How siRNAs affect rice at the developmental or physiological level is unclear. The exact roles of OsDCL2, OsDCL3, and OsDCL4 are under investigation.
miRNAs play an important role in plant development. In this paper, we showed that weak loss of function of OsDCL1IR transformants cause pleiotropic phenotypes including narrow, rolled, and outward-folded leaves. A similar effect was also observed in miRNA-defective mutants such as dcl1, hen1, ago1, and hyl1 in Arabidopsis (Jacobsen et al., 1999
The RNAi approach has been widely used to study gene functions since dsRNAs have been recognized to trigger mRNA degradation (Fire et al.,1998
Plant Materials and Growth Conditions Rice (Oryza sativa) plants used in this study were japonica cv Nipponbare. Leaves and young panicles were harvested from plants grown in the field before the primary panicle branches grew out from the axils. Roots were collected from 14-d-old seedlings grown in a growth chamber at 25°C with 16 h light and 8 h dark. Callus tissues were induced from embryogenic calli on Murashige and Skoog (with 2 mg/L 2,4-dichlorophenoxyacetic acid) medium for 28 d before harvesting.
Rice panicles and callus cultures were used for small RNA isolation. Total RNA was extracted and enriched for small-sized RNAs using polyethylene glycol precipitation as described previously (Mette et al., 2000
Nineteen- to approximately 25-nt fragments were extracted from all of the sequenced small RNAs and BLASTed against the nucleotide database downloaded from ftp://ftp.ncbi.nlm.nih.gov/blast/db/. Fragments of noncoding RNAs (such as rRNAs, tRNAs, and snoRNA) or those having mismatches to database sequences were discarded as contaminating species. The remaining sequences were regarded as putative small RNAs and subjected to blast analysis against japonica genome sequences downloaded from ftp://ftp.dna.affrc.go.jp/pub/Rice_Seq_DB/. Fragments localized at the genome sequences with upstream 200 bp plus downstream 20 bp and vice versa were extracted as putative precursors, which were analyzed for hairpin structure using the m-fold program (Zuker, 2003
Alignments of full-length Dicer protein sequences were performed using ClustalX version 1.81 with default parameters (Tian et al., 2004
pCam23ACT:OCS, a derivative of pCambia 2300, carrying the rice Actin1 promoter and the OCS terminator, was used for plant transformation. The first-strand cDNA from rice panicle was used as a template and the primer pairs used were as follows: OsDCL1 (CX0020: 5'ccgctcGAGCAGAATGATGAAGGTGAA 3'; CX0021: 5'ATGCTTTTGCGGGATCCCAA3'); OsDCL4 (CX0026: 5'cgcggaTCCCATACCAGAAGATAGGC3'; CX0027: 5'ccgctcGAGGCATGCACAGACACATCT3'). The PCR fragments were sequentially cloned into XhoI/BglII and BamHI/SalI sites of pUCC-RNAi vector to target the gene in both the sense and antisense orientations. The whole-stem loop fragment was further cloned into pCam23ACT:OCS between the rice Actin1 promoter and OCS terminator sequence, yielding the binary OsDCL1 and OsDCL4 RNAi vector. pCam23ACT:OCS plasmid without OsDCL insertion was used as control for transformation.
Rice transformation and regeneration were based on a previously published protocol with some modifications (Hiei et al., 1994
For confirmation of gene expression, leaves were harvested from plants grown in soil and flash frozen in liquid nitrogen. Tissues were stored at 80°C until RNA extraction. Total RNAs were isolated from leaves using Trizol, treated with RNase-free DNase I (Roche), quantified with a GeneQuant (Amersham) spectrophotometer, and visualized on a 1.2%-formaldehyde agarose gel. For the RT-PCR reaction, 2 µg total RNA was reverse transcribed using SuperScript II Reverse Transcriptase (Invitrogen) and equal amounts of RT products were used to perform PCR as described previously (Zilberman et al., 2003
Total RNAs were isolated from rice tissues (panicles, leaves, roots, and callus cultures) and small RNAs were enriched by using polyethylene glycol precipitation as described by Mette et al. (2000)
We greatly thank Dr. Steve Jacobsen at University of California at Los Angeles, and Drs. Mingsheng Chen and Xiujie Wang at Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, for the critical reading of the manuscript. Received March 28, 2005; returned for revision June 8, 2005; accepted June 21, 2005.
1 This work was supported by the National Natural Science Foundation of China (grant nos. 30430410 and 30325015 to X.C.) and the BaiRen and State High-Tech Program (grant to X.C.).
2 These authors contributed equally to the paper.
[w] The online version of this article contains Web-only data. Article, publication date, and citation information can be found at www.plantphysiol.org/cgi/doi/10.1104/pp.105.063420. * Corresponding author; e-mail xfcao{at}genetics.ac.cn; fax 861064873428.
Adai A, Johnson C, Mlotshwa S, Archer-Evans S, Manocha V, Vance V, Sundaresan V (2005) Computational prediction of miRNAs in Arabidopsis thaliana. Genome Res 15: 7891
Ambros V, Bartel B, Bartel DP, Burge CB, Carrington JC, Chen X, Dreyfuss G, Eddy SR, Griffiths-Jones S, Marshall M, et al (2003) A uniform system for microRNA annotation. RNA 9: 277279
Bartel B, Bartel DP (2003) MicroRNAs: at the root of plant development? Plant Physiol 132: 709717 Bartel DP (2004) MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 116: 281297[CrossRef][Web of Science][Medline] Baulcombe D (2004) RNA silencing in plants. Nature 431: 356363[CrossRef][Medline] Boutet S, Vazquez F, Liu J, Beclin C, Fagard M, Gratias A, Morel JB, Crete P, Chen X, Vaucheret H (2003) Arabidopsis HEN1: a genetic link between endogenous miRNA controlling development and siRNA controlling transgene silencing and virus resistance. Curr Biol 13: 843848[CrossRef][Web of Science][Medline] Cao X, Jacobsen SE (2002) Locus-specific control of asymmetric and CpNpG methylation by the DRM and CMT3 methyltransferase genes. Proc Natl Acad Sci USA (Suppl 4) 99: 1649116498
Chan SW, Zilberman D, Xie Z, Johansen LK, Carrington JC, Jacobsen SE (2004) RNA silencing genes control de novo DNA methylation. Science 303: 1336 Denli AM, Tops BB, Plasterk RH, Ketting RF, Hannon GJ (2004) Processing of primary microRNAs by the microprocessor complex. Nature 432: 231235[CrossRef][Medline]
Doench JG, Petersen CP, Sharp PA (2003) siRNAs can function as miRNAs. Genes Dev 17: 438442
Elbashir SM, Lendeckel W, Tuschl T (2001) RNA interference is mediated by 21- and 22-nucleotide RNAs. Genes Dev 15: 188200 Emery JF, Floyd SK, Alvarez J, Eshed Y, Hawker NP, Izhaki A, Baum SF, Bowman JL (2003) Radial patterning of Arabidopsis shoots by class III HD-ZIP and KANADI genes. Curr Biol 13: 17681774[CrossRef][Web of Science][Medline] Fire A, Xu S, Montgomery MK, Kostas SA, Driver SE, Mello CC (1998) Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature 391: 806811[CrossRef][Medline]
Griffiths-Jones S (2004) The microRNA registry. Nucleic Acids Res (Database Issue) 32: D109D111 Hamilton A, Voinnet O, Chappell L, Baulcombe D (2002) Two classes of short interfering RNA in RNA silencing. EMBO J 21: 46714679[CrossRef][Web of Science][Medline]
Hamilton AJ, Baulcombe DC (1999) A species of small antisense RNA in posttranscriptional gene silencing in plants. Science 286: 950952
Han MH, Goud S, Song L, Fedoroff N (2004) The Arabidopsis double-stranded RNA-binding protein HYL1 plays a role in microRNA-mediated gene regulation. Proc Natl Acad Sci USA 101: 10931098 Hannon GJ (2002) RNA interference. Nature 418: 244251[CrossRef][Medline]
Herr AJ, Jensen MB, Dalmay T, Baulcombe DC (2005) RNA polymerase IV directs silencing of endogenous DNA. Science 308: 118120 Hiei Y, Ohta S, Komari T, Kumashiro T (1994) Efficient transformation of rice (Oryza sativa L.) mediated by Agrobacterium and sequence analysis of the boundaries of the T-DNA. Plant J 6: 271282[CrossRef][Web of Science][Medline]
Hutvagner G, Zamore PD (2002) A microRNA in a multiple-turnover RNAi enzyme complex. Science 297: 20562060 Jacobsen SE, Running MP, Meyerowitz EM (1999) Disruption of an RNA helicase/RNAse III gene in Arabidopsis causes unregulated cell division in floral meristems. Development 126: 52315243[Abstract] Jones-Rhoades MW, Bartel DP (2004) Computational identification of plant microRNAs and their targets, including a stress-induced miRNA. Mol Cell 14: 787799[CrossRef][Web of Science][Medline] Juarez MT, Kui JS, Thomas J, Heller BA, Timmermans MC (2004) microRNA-mediated repression of rolled leaf1 specifies maize leaf polarity. Nature 428: 8488[CrossRef][Medline]
Kadotani N, Nakayashiki H, Tosa Y, Mayama S (2004) One of the two Dicer-like proteins in the filamentous fungi Magnaporthe oryzae genome is responsible for hairpin RNA-triggered RNA silencing and related small interfering RNA accumulation. J Biol Chem 279: 4446744474 Kidner CA, Martienssen RA (2004) Spatially restricted microRNA directs leaf polarity through ARGONAUTE1. Nature 428: 8184[CrossRef][Medline] Kidner CA, Martienssen RA (2005) The developmental role of microRNA in plants. Curr Opin Plant Biol 8: 3844[CrossRef][Web of Science][Medline]
Kikuchi S, Satoh K, Nagata T, Kawagashira N, Doi K, Kishimoto N, Yazaki J, Ishikawa M, Yamada H, Ooka H, et al (2003) Collection, mapping, and annotation of over 28,000 cDNA clones from japonica rice. Science 301: 376379
Kurihara Y, Watanabe Y (2004) Arabidopsis micro-RNA biogenesis through Dicer-like 1 protein functions. Proc Natl Acad Sci USA 101: 1275312758 Lee Y, Ahn C, Han J, Choi H, Kim J, Yim J, Lee J, Provost P, Radmark O, Kim S, et al (2003) The nuclear RNase III Drosha initiates microRNA processing. Nature 425: 415419[CrossRef][Medline] Lee YS, Nakahara K, Pham JW, Kim K, He Z, Sontheimer EJ, Carthew RW (2004) Distinct roles for Drosophila Dicer-1 and Dicer-2 in the siRNA/miRNA silencing pathways. Cell 117: 6981[CrossRef][Web of Science][Medline] Lippman Z, Gendrel AV, Black M, Vaughn MW, Dedhia N, McCombie WR, Lavine K, Mittal V, May B, Kasschau KD, et al (2004) Role of transposable elements in heterochromatin and epigenetic control. Nature 430: 471476[CrossRef][Medline]
Llave C, Kasschau KD, Rector MA, Carrington JC (2002) Endogenous and silencing-associated small RNAs in plants. Plant Cell 14: 16051619 Mallory AC, Reinhart BJ, Jones-Rhoades MW, Tang G, Zamore PD, Barton MK, Bartel DP (2004) MicroRNA control of PHABULOSA in leaf development: importance of pairing to the microRNA 5' region. EMBO J 23: 33563364[CrossRef][Web of Science][Medline]
McElver J, Tzafrir I, Aux G, Rogers R, Ashby C, Smith K, Thomas C, Schetter A, Zhou Q, Cushman MA, et al (2001) Insertional mutagenesis of genes required for seed development in Arabidopsis thaliana. Genetics 159: 17511763 Mette MF, Aufsatz W, van der Winden J, Matzke MA, Matzke AJ (2000) Transcriptional silencing and promoter methylation triggered by double-stranded RNA. EMBO J 19: 51945201[CrossRef][Web of Science][Medline] Onodera Y, Haag JR, Ream T, Nunes PC, Pontes O, Pikaard CS (2005) Plant nuclear RNA polymerase IV mediates siRNA and DNA methylation-dependent heterochromatin formation. Cell 120: 613622[CrossRef][Web of Science][Medline]
Park MY, Wu G, Gonzalez-Sulser A, Vaucheret H, Poethig RS (2005) Nuclear processing and export of microRNAs in Arabidopsis. Proc Natl Acad Sci USA 102: 36913696 Park W, Li J, Song R, Messing J, Chen X (2002) CARPEL FACTORY, a Dicer homolog, and HEN1, a novel protein, act in microRNA metabolism in Arabidopsis thaliana. Curr Biol 12: 14841495[CrossRef][Web of Science][Medline] Pham JW, Pellino JL, Lee YS, Carthew RW, Sontheimer EJ (2004) A Dicer-2-dependent 80s complex cleaves targeted mRNAs during RNAi in Drosophila. Cell 117: 8394[CrossRef][Web of Science][Medline]
Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP (2002) MicroRNAs in plants. Genes Dev 16: 16161626
Robinson-Beers K, Pruitt RE, Gasser CS (1992) Ovule development in wild-type Arabidopsis and two female-sterile mutants. Plant Cell 4: 12371249 Schauer SE, Jacobsen SE, Meinke DW, Ray A (2002) DICER-LIKE1: blind men and elephants in Arabidopsis development. Trends Plant Sci 7: 487491[CrossRef][Web of Science][Medline]
Sorin C, Bussell JD, Camus I, Ljung K, Kowalczyk M, Geiss G, McKhann H, Garcion C, Vaucheret H, Sandberg G, et al (2005) Auxin and light control of adventitious rooting in Arabidopsis require ARGONAUTE1. Plant Cell 17: 13431359
Sunkar R, Girke T, Jain PK, Zhu JK (2005) Cloning and characterization of microRNAs from rice. Plant Cell 17: 13971411
Sunkar R, Zhu JK (2004) Novel and stress-regulated microRNAs and other small RNAs from Arabidopsis. Plant Cell 16: 20012019 Tang G (2005) siRNA and miRNA: an insight into RISCs. Trends Biochem Sci 30: 106114[CrossRef][Web of Science][Medline]
Tang G, Reinhart BJ, Bartel DP, Zamore PD (2003) A biochemical framework for RNA silencing in plants. Genes Dev 17: 4963 Tian C, Wan P, Sun S, Li J, Chen M (2004) Genome-wide analysis of the GRAS gene family in rice and Arabidopsis. Plant Mol Biol 54: 519532[CrossRef][Web of Science][Medline] Tijsterman M, Plasterk RH (2004) Dicers at RISC: the mechanism of RNAi. Cell 117: 13[CrossRef][Web of Science][Medline] Tomari Y, Du T, Haley B, Schwarz DS, Bennett R, Cook HA, Koppetsch BS, Theurkauf WE, Zamore PD (2004a) RISC assembly defects in the Drosophila RNAi mutant armitage. Cell 116: 831841[CrossRef][Web of Science][Medline]
Tomari Y, Matranga C, Haley B, Martinez N, Zamore PD (2004b) A protein sensor for siRNA asymmetry. Science 306: 13771380
Vaucheret H, Vazquez F, Crete P, Bartel DP (2004) The action of ARGONAUTE1 in the miRNA pathway and its regulation by the miRNA pathway are crucial for plant development. Genes Dev 18: 11871197 Vazquez F, Gasciolli V, Crete P, Vaucheret H (2004) The nuclear dsRNA binding protein HYL1 is required for microRNA accumulation and plant development, but not posttranscriptional transgene silencing. Curr Biol 14: 346351[CrossRef][Web of Science][Medline] Wang XJ, Reyes JL, Chua NH, Gaasterland T (2004) Prediction and identification of Arabidopsis thaliana microRNAs and their mRNA targets. Genome Biol 5: R65[CrossRef][Medline] Xie Z, Johansen LK, Gustafson AM, Kasschau KD, Lellis AD, Zilberman D, Jacobsen SE, Carrington JC (2004) Genetic and functional diversification of small RNA pathways in plants. PLoS Biol 2: E104[CrossRef][Medline]
Yu B, Yang Z, Li J, Minakhina S, Yang M, Padgett RW, Steward R, Chen X (2005) Methylation as a crucial step in plant microRNA biogenesis. Science 307: 932935
Zeng Y, Yi R, Cullen BR (2003) MicroRNAs and small interfering RNAs can inhibit mRNA expression by similar mechanisms. Proc Natl Acad Sci USA 100: 97799784
Zhang W, Yi C, Bao W, Liu B, Cui J, Yu H, Cao X, Gu M, Liu M, Cheng Z (2005) The transcribed 165-bp CentO satellite is the major functional centromeric element in the wild rice species Oryza punctata. Plant Physiol 139: 306315
Zilberman D, Cao X, Jacobsen SE (2003) ARGONAUTE4 control of locus-specific siRNA accumulation and DNA and histone methylation. Science 299: 716719
Zuker M (2003) Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res 31: 34063415 This article has been cited by other articles:
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ASPB Publications | PLANT PHYSIOLOGY® | THE PLANT CELL | |
|---|---|---|---|