|
|
||||||||
|
First published online September 16, 2005; 10.1104/pp.105.065094 Plant Physiology 139:690-700 (2005) © 2005 American Society of Plant Biologists AtPEX2 and AtPEX10 Are Targeted to Peroxisomes Independently of Known Endoplasmic Reticulum Trafficking Routes1,[w]School of Biological and Molecular Sciences, Oxford Brookes University, Oxford OX3 0BP, United Kingdom (I.A.S., C.H.); and Centre for Plant Sciences, University of Leeds, Leeds LS2 9JT, United Kingdom (A.B.)
Controversy exists in the literature over the involvement of the endoplasmic reticulum (ER) in the delivery of membrane proteins to peroxisomes. In this study, the involvement of the ER in the trafficking of two Arabidopsis (Arabidopsis thaliana) peroxisomal membrane proteins was investigated using confocal laser scanning microscopy of living cells expressing fusions between enhanced yellow fluorescent protein (eYFP) and AtPEX2 and AtPEX10. The fusion proteins were always detected in peroxisomes and cytosol irrespective of the location of the eYFP tag or the level of expression. The cytosolic fluorescence was not due to cleavage of the eYFP reporter from the C-terminal fusion proteins. Blocking known ER transport routes using the fungal metabolite Brefeldin A or expressing dominant negative mutants of Sar1 or RabD2a had no effect on the trafficking of AtPEX2 and AtPEX10 to peroxisomes. We conclude that AtPEX2 and AtPEX10 are inserted into peroxisome membranes directly from the cytosol.
Peroxisomes are eukaryotic organelles that are surrounded by a single membrane and contain no DNA, so acquire all their protein complement by import of cytosolically synthesized proteins. Proteins required for peroxisome biogenesis are termed peroxins and are encoded by genes with the nomenclature PEX (Distel et al., 1996
Much less is understood about the import of membrane proteins. Researchers have used a range of model systems, including various yeasts, mammals, and plants, and often reached contradictory conclusions. In particular, there are currently conflicting views concerning the role of the endoplasmic reticulum (ER) in the biogenesis of peroxisomes, which are summarized in recent reviews (Lazarow, 2003
In contrast, experiments using human fibroblast cell lines have shown that blocking COPI and COPII vesicle transport using BFA and dominant negative mutants of SAR1 (secretion-associated and ras superfamily-related gene 1) did not prevent the correct trafficking of PMPs to peroxisomes, including PEX3 (South et al., 2000
To resolve the issue of whether some PMPs are targeted to the ER and subsequently sorted to peroxisomes as part of their normal biogenetic pathway, it is important to be able to chase a protein from the ER to the peroxisome. This has been done for only one integral membrane protein, Pex2p from Y. lipolytica, which is also apparently glycosylated (Titorenko et al., 1997
To address this question, we investigated the trafficking pathway of Arabidopsis (Arabidopsis thaliana) PEX2 (AtPEX2) and PEX10 (AtPEX10) using time-resolved confocal microscopy on living cells. PEX2 and PEX10 are PMPs that contain a functionally important C3HC4 RING finger domain. In mammals and yeasts, PEX2 and PEX10 are located in peroxisome membranes and are required for import of peroxisome matrix proteins (Kalish et al., 1995 In this study, we have established that Arabidopsis PEX10 and PEX2 can be detected only in cytosol and peroxisomes, and that inhibiting known ER transport routes does not result in accumulation in ER. Our data strongly suggest that Arabidopsis PEX2 and PEX10 are inserted directly from the cytosol into peroxisomes. This is discussed in relation to the possible role of the ER in peroxisome biogenesis.
AtPEX2 and AtPEX10 Fusions to Enhanced Yellow Fluorescent Protein Locate to the Peroxisome in Tobacco Cells Both N- and C-terminal fusions of AtPEX2 and AtPEX10 to enhanced yellow fluorescent protein (eYFP) were expressed under the control of the 35S promoter. All four fusion proteins were located in punctate motile structures and to some extent in the cytosol when expressed transiently in tobacco epidermal cells (Fig. 1, B, E, H and K). A peroxisomal matrix marker, CFP fused to SKL (CFP-SKL; Fig. 1, C, F, I, and L), colocalized with both N- and C-terminal AtPEX2/10 fusions to eYFP (Fig. 1, A, D, G, and J). Additionally, AtPEX2 and AtPEX10 fusions to eYFP were frequently localized to the rim of the peroxisome with the matrix marker inside the peroxisome structure (Fig. 1H, arrowhead; Fig. 4, E and H; Fig. 6, D and G; Supplemental Fig. 1A).
Stable transgenic tobacco and Arabidopsis lines expressing either AtPEX2-eYFP or AtPEX10-eYFP were generated to determine whether a similar distribution of the fusion proteins was seen compared to transient expression in epidermal cells. Stable Arabidopsis plants expressing both AtPEX10-eYFP and GFP-SKL also show that AtPEX10 is present in the periphery of peroxisomes (Supplemental Fig. 1, AC). AtPEX10-eYFP is also present in punctate motile structures in stable Arabidopsis (Supplemental Fig. 1D; Supplemental Movie 1) and tobacco (Supplemental Fig. 1E) lines. Transgenic tobacco plants expressing AtPEX2-eYFP displayed lower levels of expression than AtPEX10-eYFP plants. However, more AtPEX2-eYFP was present in the periphery of punctate motile structures the size of peroxisomes than was seen under transient expression (Supplemental Fig. 1, JL). Stable Arabidopsis plants expressing AtPEX2-eYFP show that AtPEX2 is present in the motile punctate structures of the expected size of peroxisomes (Supplemental Fig. 1, FI, arrowhead). With all constructs expressed under both transient and stable transformation, diffuse nonperoxisomal fluorescence was seen to differing extents (Fig. 1; Supplemental Fig. 1). Nonperoxisomal fluorescence, as well as representing the full-length fusion protein, could be due to cleavage of the eYFP from the fusion proteins, leading to accumulation of fluorescent protein in the cytosol. An anti-green fluorescent protein (GFP) antibody, which cross reacts with eYFP, was used to probe leaf extracts derived from stable tobacco transformants (Supplemental Fig. 1) that express AtPEX10-eYFP (Fig. 2A, lane 3) or AtPEX2-eYFP (Fig. 2A, lane 2). Leaf extracts from untransformed tobacco were used as controls (Fig. 2A, lane 1). A band was detected in lane 3 (Fig. 2A), indicated by an arrowhead, which was slightly smaller than the expected size of AtPEX10-eYFP (69.6 kD). However, it is known that membrane proteins often migrate anomalously in SDS-PAGE gels. In lane 2 (Fig. 2A), a slightly smaller band was detected, indicated by an arrow, consistent with the smaller size of AtPEX2-eYFP (65.2 kD). Neither band was seen in the untransformed sample (Fig. 2A, lane 1). Figure 2C shows the Ponceau S-stained blot corresponding to Figure 2A. This confirms that the amount of protein from the wild-type plants was similar to or greater than the amount of protein from the transgenic samples. Thus, the absence of anti-GFP cross-reactive bands around 62 kD in the wild-type sample confirms that the bands of this size seen in the transformed samples are the YFP fusion proteins. Total protein extracts from stable tobacco plants expressing either eYFP-AtPEX10 (Fig. 2B, lane 1) or AtPEX10-eYFP (Fig. 2B, lane 2) were probed with the anti-GFP antibody. eYFP-AtPEX10 is not stable, and both the full-length (Fig. 2B, lane 1, arrowhead) and cleaved eYFP (Fig. 2B, lane 1, diamond) were detected. Crucially, there was no band corresponding to free eYFP at around 28 kD in total protein extracts from AtPEX2-eYFP (Fig. 2A, lane 2) or AtPEX10-eYFP (Fig. 2A, lane 3; Fig. 2B, lane 2). The band around 25 kD detected in all extracts does not represent free eYFP as it was also detected in protein extracts from wild-type plants (Fig. 2A, lane 1). Therefore, both AtPEX10-eYFP and AtPEX2-eYFP are stable fusion proteins and were used for subsequent experiments.
Polyclonal serum was raised against a 26-amino acid peptide corresponding to the amino terminus of AtPEX2. The resulting antibodies were affinity purified using the peptide. Due to the low levels of AtPEX2-eYFP expression in the stable tobacco line, the affinity-purified antibody was used to probe total protein extracts from tobacco plants transiently expressing AtPEX2-eYFP under the control of the enhanced 35S promoter (Fig. 2D, lane 1). Nontransformed tissue was used as a control (Fig. 2D, lane 2). The affinity-purified antibody cross-reacts with a product close to the predicted size for native AtPEX2, 34.6 kD, in both lanes 1 and 2 (Fig. 2D, asterisk) and a band corresponding to the fusion protein, AtPEX2-eYFP, in lane 1 only (Fig. 2D, arrow). To confirm antibody specificity, the affinity-purified antibody was preincubated with peptide to titrate out the antibody. The samples loaded in lanes 3a and 3b (Fig. 2D) are identical, where lane 3a was detected with affinity-purified antibody and lane 3b was detected with affinity-purified antiserum preincubated with peptide. As expected, the level of PEX2 detected in lane 3b (Fig. 2D, asterisk) is significantly less than in lane 3a (Fig. 2D, asterisk). An additional weaker cross-reactivity with a product around 70 kD was also detected. Immunofluorescence on Arabidopsis cell culture using the AtPEX2 affinity-purified antibody results in punctate labeling (Fig. 3A) similar to that observed using antibodies against isocitrate lyase (ICL; Fig. 3B). Additionally, there was no evidence of cytosolic or reticular staining with the anti-PEX2 antibody. Dual labeling resulted in several punctate structures labeling with both anti-PEX2 and anti-ICL antibodies (see inset in Fig. 3C).
AtPEX2 and AtPEX10 Fusions to eYFP Do Not Colocalize with an ER Marker To ascertain whether AtPEX2 or AtPEX10 traffic via the ER, the first step was to determine whether the nonperoxisomal fluorescence colocalizes with an ER marker, GFP-HDEL. The cortical ER network in tobacco leaf epidermal cells forms an extensive network of polygonal tubules surrounded by the cytoplasm (Fig. 4, C, F, I, L, and O). These cells contain large vacuoles that confine the cytoplasm and organelles to the periphery of the cell (Fig. 4B). These spatial constrictions can restrict the cytosol to the region immediately surrounding the ER network (Fig. 4, B and C; see arrow) resulting in a similar yet diffuse pattern of fluorescence, or it can flow freely around other organelles in the cell, which appear in negative contrast (Fig. 4B; see arrowhead). Therefore, to be able to discern between ER and cytosolic location requires careful inspection and interpretation of the images. N- or C-terminal fusions of AtPEX2 (Fig. 4, DI) and AtPEX10 to eYFP (Fig. 4, JO) were transiently expressed in stable tobacco plants expressing GFP-HDEL. The settings used on the microscope could distinguish between fluorescence from eYFP fusions and that from wild-type GFP fused to HDEL. GFP-HDEL labels the well-defined cortical ER network (Fig. 4, F, I, L, and O) and is seen in close association with the peroxisomes containing the fusion protein and the diffuse pool of peroxisomal fusion proteins (Fig. 4, D, G, J, and M). Careful analysis of the peroxisomal fusion proteins expressed in the GFP-HDEL plants showed that they did not colocalize with the ER but rather surrounded it in a diffuse pattern like that of free eYFP (compare Fig. 4, E, H, K, and N, to B). This cytosolic nature was further supported by observations of organelles in negative contrast (Fig. 4, E and N, arrowhead). Similarly, epidermal cells in stable transgenic lines expressing AtPEX2-eYFP or AtPEX10-eYFP do not show ER localization. However, it is possible that the kinetics of trafficking may be such that the steady-state levels of these peroxisomal proteins in the ER are below detection, or that low levels in the ER may be masked by the levels in the cytosol. To address this, the export of proteins from the ER was blocked and the effect on trafficking of the AtPEX2 and AtPEX10 fusion proteins investigated. Comparisons between transient and steady-state expression of AtPEX2-eYFP have shown that higher levels of the fusion protein are present in the peroxisome and less is detected in the cytosol in stably transformed lines. Therefore, subsequent studies relating to AtPEX2 trafficking were carried out using stable tobacco plants expressing AtPEX2-eYFP, since high cytosolic levels detected under transient expression could mask populations of fusion protein, which may locate to the ER upon treatment with BFA or expression of Sar1 H74L and RabD2a N121I. Studies involving AtPEX10-eYFP and a peroxisomal matrix marker, eYFP-SKL, are based on transient expression of these fusion proteins.
Treatment of cells with BFA results in the redistribution of Golgi markers back to the ER (Ritzenthaler et al., 2002 Tobacco epidermal cells transiently expressing a Golgi marker, sialyltransferase fused to CFP (ST-CFP), and a peroxisomal marker were treated with BFA (100 µg/mL) for 30 min. The Golgi marker acts as an internal control as BFA treatment should result in the redistribution of this marker to the ER. Images were taken prior to BFA treatment and then after 30 min incubation in BFA. Figure 5 shows that prior to treatment ST-CFP and the peroxisomal markers, AtPEX2-eYFP (Fig. 5A), AtPEX10-eYFP (Fig. 5B), and a peroxisomal matrix marker eYFP-SKL (Fig. 5C), label punctate structures. ST-CFP (green) and the peroxisomal markers (magenta) do not colocalize and are present in two separate populations of punctate structures, which represent the Golgi and peroxisomes. After 30 min treatment, the peroxisomal markers are still in motile punctate structures (Fig. 5, DI), whereas the Golgi marker ST-CFP has been redistributed to the ER. The peroxisomal markers in merged images (Fig. 5, DF) are shown for clarity in a single-channel image (Fig. 5, GI). The affects of BFA are reversed after 5 h incubation in water (data not shown). The effects of BFA treatment on AtPEX10-eYFP and ST-CFP trafficking are shown in Supplemental Movie 2.
Dominant Negative Inhibitors of ER-to-Golgi Trafficking Do Not Affect the Localization of AtPEX2-eYFP, AtPEX10-eYFP, or a Peroxisomal Matrix Marker
Sar1 and RabD2a (formally known as Rab1b) are small G-proteins involved in ER-to-Golgi transport. Transient expression of NtSar1H74L, a GTP-locked mutant (Andreeva et al., 2000 In cells where ST-CFP (green) was coexpressed with either AtPEX2-eYFP, AtPEX10-eYFP, or eYFP-SKL (magenta), the peroxisome markers were detected in distinct cellular structures (Fig. 6, AC, respectively). Coexpression of the Sar1 H74L mutant had no effect on the localization of the peroxisomal markers but did affect ST-CFP as expected (Fig. 6, DI). For clarity, images in Figure 6, G to I, show the peroxisomal markers in Figure 6, D to F. Peroxisomes containing the fluorescent fusion proteins in cells that coexpress Sar1 H74L are similar in size and display similar movement characteristics to cells not expressing the Sar1 H74L mutant (compare cell marked with arrow in Fig. 6E with the adjacent cell in the same section). Cells coexpressing the RabD2a N121I mutant with the peroxisomal markers (magenta) and ST-CFP (green) are shown in Figure 6, J to O. The ST-CFP Golgi marker control is located in the ER due to the effects of RabD2a N121I, whereas the peroxisomal marker proteins are not affected. Images in Figure 6, M to O, display the peroxisomal marker fusions in the corresponding merged images with ST-CFP in Figure 6, J to L. Peroxisomes containing the fluorescent peroxisomal marker fusions are similar in size and display similar motility to cells not expressing the RabD2a N121I (compare cell marked with arrow in Fig. 6J with adjacent cell in the same section).
Previous work has raised questions concerning the subcellular localization of Arabidopsis PEX10 and the route by which PEX2 is trafficked to peroxisomes, with conflicting data reported for mammals and yeasts. Resolving these issues is important, both in terms of understanding the functions of these particular proteins and in addressing the following questions: Are peroxisomes made de novo, and, if so, how?
Transient expression of eYFP-AtPEX2, AtPEX2-eYFP, eYFP-AtPEX10, and AtPEX10-eYFP in tobacco epidermal cells resulted in colocalization with a peroxisomal matrix marker, CFP-SKL (Fig. 1). Transient expression does not allow for a uniform level of expression across the leaf epidermis, resulting in some cells displaying higher levels of expression than others. In these high-expressing cells, there are cytosolic pools of the fusion proteins. Such cytosolic accumulation of fluorescent proteins is also present in the early stages of expression. This is probably due to saturation of the machinery required for PMP import caused by overexpression of the fusion proteins, competition between these fusions and the native proteins in the cell, and the kinetics of import, which allows for the cytosolic accumulation. Transient expression of AtPEX2-eYFP and eYFP-AtPEX2 resulted in lower levels in the peroxisome and what appeared to be a larger cytosolic pool in comparison to AtPEX10 fusions to eYFP. When AtPEX10-eYFP or AtPEX2-eYFP was expressed in stable transgenic plants, they displayed a similar localization pattern to that seen in transient expression, peroxisomal with some cytosolic fluorescence. Western-blot analysis of total protein extracts from the stable transgenic lines expressing AtPEX10-eYFP and AtPEX2-eYFP confirmed that the cytosolic fluorescence was not due to cleavage of the fusion proteins resulting in free cytosolic eYFP (Fig. 2). To assess whether any of the nonperoxisomal fusion proteins could be located in the ER, the fusions were expressed in a stable tobacco plant expressing an ER marker, GFP-HDEL. Careful characterization of these expression studies showed that the fusion proteins were present in the diffuse pools reminiscent of cytosolic localization and not in well-defined ER strands (Fig. 4). Interestingly, the stable Arabidopsis double transformant expressing AtPEX10-eYFP and GFP-SKL gave indications that the peroxisome population may be heterogeneous. Although most peroxisomes had both markers, some had detectable levels only of either AtPEX10-eYFP or GFP-SKL (Supplemental Fig. 1, AC). Also, in the immunofluorescence studies, native PEX2 appears to be in many more punctuate structures than the matrix enzyme ICL (Fig. 3). These data could suggest heterogeneity of the peroxisome population and warrant further investigation.
The trafficking of AtPEX2, AtPEX10, and the peroxisomal matrix marker were not effected by inhibiting COPI-mediated (BFA treatment) or COPII-mediated (Sar1 H74L mutant) vesicle trafficking. The trafficking was also not affected by coexpression of a mutant form of RabD2a. It is currently not known whether plant RabD2a is involved in the COPII-mediated trafficking pathway or an independent trafficking route. The effects of Sar1 H74L and RabD2a N121I were detected after 24 to 48 h expression, and the effects of BFA were seen after 30 min. In tobacco BY2 cells,
In conclusion, transient and steady-state expression studies in tobacco epidermal cells show that AtPEX2 and AtPEX10 fusions to eYFP are localized to the peroxisome and to a certain extent in the cytosol. At no point have we detected AtPEX2 or AtPEX10 in the ER, even when ER export routes were blocked. Immunofluorescence studies of wild-type Arabidopsis cell culture confirmed the location of AtPEX2 in peroxisomes and did not highlight any additional pools in the cytosol or ER. The simplest interpretation of the data presented here is that AtPEX2 and AtPEX10 are imported into peroxisomes directly from the cytosol. Fusion of eYFP to either terminus does not affect trafficking; therefore the targeting signals are capable of functioning internally. A similar situation pertains in the 22-kD PMP (PMP22) of Arabidopsis, where a comprehensive mutagenesis study identified four distinct internal regions within PMP22 that functioned cooperatively to bring about direct insertion from the cytosol (Murphy et al., 2003
Our results are in complete agreement with similar studies in mammalian cells where neither BFA nor inhibitors of COPI- and COPII-mediated transport affected the trafficking of PEX2, PEX3, and PEX16 (South et al., 2000
The last five amino acids of PEX10 (-YHSDF) can act as an ER retrieval motif when fused at the C terminus of an ER-targeted reporter protein (McCartney et al., 2004
Although the data presented here do not support a role for the ER in the sorting of AtPEX2 and AtPEX10, the argument for the involvement of the ER in peroxisome biogenesis remains open. In plants there is good evidence for non-COPII-mediated sorting of proteins from the ER to protein storage vacuoles (Hara-Nishimura et al., 1998
In plants the best candidate for sorting to peroxisomes via ER is APX (APX3; Mullen et al., 1999
Growth and Transformation of Arabidopsis and Tobacco Plants
Arabidopsis (Arabidopsis thaliana ecotype Columbia) plants were grown (Sparkes et al., 2003 Stable tobacco plants were generated as follows: Three days after infiltration, tobacco leaves were removed, placed in sterilization solution (1:1 hyperchlorite solution:water, 0.01% [v/v] Tween 20) for 5 min, washed three times in sterile distilled water, cut into small pieces using sterile forceps, and placed on shooting media (2.15 g/L Murashige and Skoog salts, 0.8% agar, 3% [w/v] Suc, 0.1 mg/L indole butyric acid [Sigma Aldrich, 1 mg /mL stock], 0.8 mg/L 6-benzylaminopurine [Sigma Aldrich, 1 mg /mL stock], 0.1 mg/L carbenicillin [Melford], 0.2 mg/L Ticarcillin/Clavulanic acid [Ducheva]) and selection for binary vector (hygromycin, 30 µg/mL). The leaf discs were left for 3 to 4 weeks for shooting to occur, and shoots were removed using sterile technique and placed on rooting media (same as shooting media without 6-benzylaminopurine and selection for binary vector, and 0.5 mg/L indole butyric acid) for approximately 10 d. After this time, plantlets were transferred to larger growth containers for screening.
Standard molecular cloning procedures were used (Sambrook and Russell, 2001 Gateway homologous recombination technology (Invitrogen) was used to clone the remaining constructs described herein.
AtPEX2 was amplified from expressed sequence tag N96573 using Pfx polymerase. Two AtPEX2 clones were amplified, one with a stop codon (forward primer 5' GGGGACAAGTTTGTACAAAAAAGCAGGCTGGGGACAAGTTTGTACAAAAAAGCAGGCTTCCCGCCAATGACGCCGTCTACGCCTGCAGAC 3', reverse primer 5' GGGGACCACTTTGTACAAGAAAGCTGGGTGGGGACCACTTTGTACAAGAAAGCTGGGTTCATTTGCCACTTGAAACACCTTCCC 3') and the other without (forward primer same as above, reverse primer 5' GGGGACCACTTTGTACAAGAAAGCTGGGTGGGGACCACTTTGTACAAGAAAGCTGGGTCTTTGCCACTTGAAACACCTTCCCGTTG 3'), for the subsequent generation of C- and N-terminal fusions to eYFP. These clones were recombined into the entry vector pDONOR 207, and then recombined into the plant binary destination vectors 35S-Cassette B-eYFP-Nos::pCAMBIA 1300 (Sparkes et al., 2003
The point mutation in AtPEX10, resulting in an E357K substitution (Sparkes et al., 2003
Fresh leaf tissue (0.2 g) was excised, placed in a 1.5 mL Eppendorf tube, frozen, and ground in liquid nitrogen using an Eppendorf grinder. The sample was placed on ice, 1 mL of extraction buffer (0.2 M NaOH, 2%
A polyclonal antibody was raised in rabbits to a 26-amino acid peptide (MTPSTPADDAWIRSYQRLLPESQSLC) corresponding to the amino terminus of AtPEX2 (Genosphere). The peptide was covalently coupled to Sulfolink coupling gel (Pierce Biotechnology) and used to affinity purify the antibody according to manufacturer's instructions. Sample buffer was 50 mM Tris-HCl, pH 7.5, 150 mM NaCl, and elution buffer was 1 mM EGTA 0.3 M Glycine-HCl, pH 2.7. Western blots were incubated in Ponceau S stain for 5 min. Blots were subsequently washed with phosphate-buffered saline containing 0.1% Tween (v/v; PBST), blocked in PBST 5% (w/v) milk for 1 h, and incubated either in affinity-purified AtPEX2 antibody (1:500 dilution) or a polyclonal raised against GFP (1:2,000 dilution, Molecular Probes) in 2% milk PBST for 16 h. Blots were subsequently washed five times for 5 min in PBST, incubated for 1 h in alkaline phosphatase-conjugated secondary antibody (1:1,000 dilution, DAKO), and washed again. Detection was performed using the 5-bromo-4-chloro-3-indolyl phosphate/nitroblue tetrazolium color development substrate according to manufacturer's instructions (Promega). AtPEX2 26-amino acid peptide was resuspended in distilled water (1 mg/mL) and 0.4 mg was incubated at 37°C with the affinity-purified AtPEX2 peptide antibody (1:5 dilution) in 2% milk PBST for 30 min. After this time the antibody solution was diluted to a final 1:500 antibody dilution and used as previously described.
Arabidopsis cell culture was harvested 4 d after subculture, fixed, permeabilized, and stained according to Saint-Jore et al. (2002)
Confocal imaging was performed using a Zeiss inverted LSM510 laser scanning microscope with an argon laser, a helium neon laser, and 100x, 63x, and 40x oil immersion objective.
For imaging coexpression of wild-type GFP and eYFP, excitation lines 458 nm for GFP and 514 nm for eYFP were used alternately with line switching in multitracking mode of the microscope (Brandizzi et al., 2002a Postacquisition image processing was done using the LSM 5 browser software (Zeiss) and Adobe Photoshop elements or creative suite premium.
Upon request, all novel materials described in this publication will be made available in a timely manner for noncommercial research purposes, subject to the requisite permission from any third party owners of all or parts of the material. Obtaining permission will be the responsibility of the requester. Sequence data from this article can be found in the GenBank/EMBL data libraries under accession numbers AJ276134 (PEX10), AAG52254 (PEX2), AF210431 (Sar1), D01027, and U89959 (RabD2a).
We thank Barbara Johnson, Anne Kearns, Jan Evins, and Fiona Moulton for production and maintenance of plant lines, Dr. Steve Slocombe for constructing 35S-eYFP-Cassette A-Nos::pCAMBIA 1300, Laura-Anne Brown for the pDONOR 201::AtPEX10 construct, Dr. Ian Moore for the RabD2a N121I construct, Dr. Jaideep Mathur for eYFP-SKL::pCAMBIA 1300, and Dr. John Runions for help with image preparation. Received May 10, 2005; returned for revision July 4, 2005; accepted July 18, 2005.
1 This work was supported by the Biotechnology and Biology Research Council (grant nos. C19029 and C19030 to A.B. and C.H.).
[w] The online version of this article contains Web-only data. Article, publication date, and citation information can be found at www.plantphysiol.org/cgi/doi/10.1104/pp.105.065094. * Corresponding author; isparkes{at}brookes.ac.uk; fax 441865483955.
Andreeva AV, Zheng H, Saint-Jore CM, Kutuzov MA, Evans DE, Hawes CR (2000) Organization of transport from endoplasmic reticulum to Golgi in higher plants. Biochem Soc Trans 28: 505512[Web of Science][Medline]
Batoko H, Zheng H-Q, Hawes C, Moore I (2000) A Rab1 GTPase is required for transport between the endoplasmic reticulum and Golgi apparatus and for normal Golgi movement in plants. Plant Cell 12: 22012218 Brandizzi F, Fricker M, Hawes C (2002a) A greener world: the revolution in plant bioimaging. Nat Rev Mol Cell Biol 3: 520530[CrossRef][Web of Science][Medline]
Brandizzi F, Snapp EL, Roberts AG, Lippincott-Schwartz J, Hawes C (2002b) Membrane protein transport between the endoplasmic reticulum and the Golgi in tobacco leaves is energy dependent but cytoskeleton independent: evidence from selective photobleaching. Plant Cell 14: 12931309 Clough SJ, Bent AF (1998) Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J 16: 735743[CrossRef][Web of Science][Medline] Corpas FJ, Barroso JB, del Rio LA (2001) Peroxisomes as a source of reactive oxygen species and nitric oxide signal molecules in plant cells. Trends Plant Sci 6: 145150[CrossRef][Web of Science][Medline]
Distel B, Erdmann R, Gould SJ, Blobel G, Crane DI, Cregg JM, Dodt G, Fujiki Y, Goodman JM, Just WW, et al (1996) Unified nomenclature for peroxisome biogenesis factors. J Cell Biol 135: 13
Faber KN, Haan GJ, Baerends RJS, Kram AM, Veenhuis M (2002) Normal peroxisome development from vesicles induced by truncated Hansenula polymorpha Pex3p. J Biol Chem 277: 1102611033 Flynn CR, Heinze M, Schumann U, Gietl C, Trelease RN (2005) Compartmentalization of the plant peroxin, AtPex10p, within subdomain(s) of ER. Plant Sci 168: 635652[CrossRef]
Geuze HJ, Murk JL, Stroobants AK, Griffith JM, Kleijmeer MJ, Koster AJ, Verkleij AJ, Distel B, Tabak HF (2003) Involvement of the endoplasmic reticulum in peroxisome formation. Mol Biol Cell 14: 29002907
Hara-Nishimura I, Shimada T, Hatano K, Takeuchi Y, Nishimura M (1998) Transport of storage proteins to protein storage vacuoles is mediated by large precursor-accumulating vesicles. Plant Cell 10: 825836
Hofgen R, Willmitzer L (1988) Storage of competent cells for Agrobacterium transformation. Nucleic Acids Res 16: 9877
Hu JP, Aguirre M, Peto C, Alonso J, Ecker J, Chory J (2002) A role for peroxisomes in photomorphogenesis and development of Arabidopsis. Science 297: 405409 Hunt JE, Trelease RN (2004) Sorting pathway and molecular targeting signals for the Arabidopsis peroxin 3. Biochem Biophys Res Commun 314: 586596[CrossRef][Web of Science][Medline] Jefferson RA, Kavanagh TA, Bevan MW (1987) Gus fusions: beta-glucoronidase as a sensitive and versatile gene fusion marker in higher plants. EMBO J 6: 39013907[Web of Science][Medline] Kalish JE, Theda C, Morrell J, Berg JM, Gould SJ (1995) Formation of peroxisome lumen is abolished by loss of Pichia pastoris Pas7p, a zinc-binding integral membrane protein of the peroxisome. Mol Cell Biol 15: 64066419[Abstract]
Kotzer AM, Brandizzi F, Neumann U, Paris N, Moore I, Hawes C (2004) AtRabF2b (Ara7) acts on the vacuolar trafficking pathway in tobacco leaf epidermal cells. J Cell Sci 117: 63776389 Lazarow PB (2003) Peroxisome biogenesis: advances and conundrums. Curr Opin Cell Biol 15: 489497[CrossRef][Web of Science][Medline]
Lin Y, Cluette-Brown JE, Goodman HM (2004) The peroxisome deficient Arabidopsis mutant sse1 exhibits impaired fatty acid synthesis. Plant Physiol 135: 814827
Lin Y, Sun L, Nguyen LV, Rachubinski RA, Goodman HM (1999) The pex16p homolog SSE1 and storage organelle formation in Arabidopsis seeds. Science 284: 328330
Lisenbee CS, Heinze M, Trelease RN (2003a) Peroxisomal ascorbate peroxidase resides within a subdomain of rough endoplasmic reticulum in wild-type Arabidopsis cells. Plant Physiol 132: 870882 Lisenbee CS, Karnik SK, Trelease RN (2003b) Overexpression and mislocalization of a tail-anchored GFP redefines the identity of peroxisomal ER. Traffic 4: 491501[CrossRef][Web of Science][Medline] Maier AG, Schulreich S, Bremser M, Clayton C (2000) Binding of coatomer by the PEX11 C-terminus is not required for function. FEBS Lett 484: 8286[CrossRef][Web of Science][Medline] McCartney AW, Dyer JM, Dhanoa PK, Kim PK, Andrews DW, McNew JA, Mullen RT (2004) Membrane-bound fatty acid desaturases are inserted co-translationally into the ER and contain different ER retrieval motifs at their carboxy termini. Plant J 37: 156173[CrossRef][Web of Science][Medline]
Mullen RT, Lisenbee CS, Miernyk JA, Trelease RN (1999) Peroxisomal membrane ascorbate peroxidase is sorted to a membranous network that resembles a subdomain of the endoplasmic reticulum. Plant Cell 11: 21672185
Murphy MA, Phillipson BA, Baker A, Mullen RT (2003) Characterization of the targeting signal of the Arabidopsis 22-kD integral peroxisomal membrane protein. Plant Physiol 133: 813828
Nito K, Yamaguchi K, Kondo M, Hayashi M, Nishimura M (2001) Pumpkin peroxisomal ascorbate peroxidase is localized on peroxisomal membranes and unknown membranous structures. Plant Cell Physiol 42: 2027
Okumoto K, Itoh R, Shimozawa N, Suzuki Y, Tamura S, Kondo N, Fujiki Y (1998) Mutations in PEX10 is the cause of Zellweger peroxisome deficiency syndrome of complementation group B. Hum Mol Genet 7: 13991405
Passreiter M, Anton M, Lay D, Frank R, Harter C, Wieland FT, Gorgas K, Just WW (1998) Peroxisome biogenesis: involvement of ARF and coatomer. J Cell Biol 141: 373383 Platta H, Girzalsky W, Erdmann R (2004) Ubiquitination of the peroxisomal import receptor Pex5p. Biochem J 384: 3745[CrossRef][Medline] Purdue PE, Lazarow PB (2001) Peroxisome biogenesis. Annu Rev Cell Dev Biol 17: 701752[CrossRef][Web of Science][Medline]
Ritzenthaler C, Nebenfuhr A, Movafeghi A, Stussi-Garaud C, Behnia L, Pimpl P, Staehelin LA, Robinson DG (2002) Reevaluation of the effects of Brefeldin A on plant cells using tobacco Bright Yellow 2 cells expressing Golgi-targeted green fluorescent protein and COPI antisera. Plant Cell 14: 237261 Saint-Jore CM, Evins J, Batoko H, Brandizzi F, Moore I, Hawes C (2002) Redistribution of membrane proteins between the Golgi apparatus and endoplasmic reticulum in plants is reversible and not dependent on cytoskeletal networks. Plant J 29: 661678[CrossRef][Web of Science][Medline] Salomons FA, van der Klei I, Kram AM, Harder W, Veenhuis M (1997) Brefeldin A interferes with peroxisomal protein sorting in the yeast Hansenula polymorpha. FEBS Lett 411: 133139[CrossRef][Medline] Sambrook J, Russell DW (2001) Molecular Cloning: A Laboratory Manual, Ed 3. Cold Spring Harbor Laboratory Press, New York
Schumann U, Wanner G, Veenhuis M, Schmid M, Gietl C (2003) AthPEX10, a nuclear gene essential for peroxisome and storage organelle formation during Arabidopsis embryogenesis. Proc Natl Acad Sci USA 100: 96269631
South ST, Baumgart E, Gould SJ (2001) Inactivation of the endoplasmic reticulum protein translocation factor, Sec61p, or its homolog, Ssh1p, does not affect peroxisome biogenesis. Proc Natl Acad Sci USA 98: 1202712031
South ST, Sacksteder KA, Li XL, Liu YF, Gould SJ (2000) Inhibitors of COPI and COPII do not block PEX3-mediated peroxisome synthesis. J Cell Biol 149: 13451359 Sparkes IA, Baker A (2002) Peroxisome biogenesis and protein import in plants, animals and yeasts: enigma and variations? (review). Mol Membr Biol 19: 171185[CrossRef][Web of Science][Medline]
Sparkes IA, Brandizzi F, Slocombe SP, El-Shami M, Hawes C, Baker A (2003) An Arabidopsis pex10 null mutant is embryo lethal, implicating peroxisomes in an essential role during plant embryogenesis. Plant Physiol 133: 18091819 Tabak HF, Murk JL, Braakman I, Geuze HJ (2003) Peroxisomes start their life in the endoplasmic reticulum. Traffic 4: 512518[Web of Science][Medline]
Theodoulou FL, Job K, Slocombe SP, Footitt S, Holdsworth M, Baker A, Larson TR, Graham IA (2005) Jasmonic acid levels are reduced in COMATOSE ATP-binding cassette transporter mutants: implications for transport of jasmonate precursors into peroxisomes. Plant Physiol 137: 835840 Titorenko VI, Ogrydziak DM, Rachubinski RA (1997) Four distinct secretory pathways serve protein secretion, cell surface growth, and peroxisome biogenesis in the yeast Yarrowia lipolytica. Mol Cell Biol 17: 52105226[Abstract]
Titorenko VI, Rachubinski RA (1998) Mutants of the yeast Yarrowia lipolytica defective in protein exit from the endoplasmic reticulum are also defective in peroxisome biogenesis. Mol Cell Biol 18: 27892803 Titorenko VI, Rachubinski RA (2001a) Dynamics of peroxisome assembly and function. Trends Cell Biol 11: 2229[CrossRef][Web of Science][Medline] Titorenko VI, Rachubinski RA (2001b) The life cycle of the peroxisome. Nat Rev Mol Cell Biol 2: 357368[CrossRef][Web of Science][Medline]
Tormakangas K, Hadlington JL, Pimpl P, Hilmer S, Brandizzi F, Teeri TH, Denecke J (2001) A vacuolar sorting domain may also influence the way in which proteins leave the endoplamic reticulum. Plant Cell 13: 20212032
Voorn-Brouwer T, Kragt A, Tabak HF, Distel B (2001) Peroxisomal membrane proteins are properly targeted to peroxisomes in the absence of COPI- and COPII-mediated vesicular transport. J Cell Sci 114: 21992204
Zolman BK, Monroe-Augustus M, Thompson B, Hawes JW, Krukenberg KA, Matsuda SPT, Bartel B (2001) chy1, an Arabidopsis mutant with impaired beta-oxidation, is defective in a peroxisomal beta-hydroxyisobutyryl-CoA hydrolase. J Biol Chem 276: 3103731046 This article has been cited by other articles:
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ASPB Publications | PLANT PHYSIOLOGY® | THE PLANT CELL | |
|---|---|---|---|