|
|
||||||||
|
First published online October 21, 2005; 10.1104/pp.105.070813 Plant Physiology 139:1451-1459 (2005) © 2005 American Society of Plant Biologists
Three Maize Leaf Ferredoxin:NADPH Oxidoreductases Vary in Subchloroplast Location, Expression, and Interaction with Ferredoxin1,[w]Institute for Protein Research, Osaka University, Suita, Osaka 5650871, Japan (S.O., G.T.H., Y.S., T.T., T.H.); Department of Life Sciences, Graduate School of Arts and Sciences, University of Tokyo, Meguro-Ku, Tokyo 1538902, Japan (G.K.); and Unité de Nutrition Azotée des Plantes, Institut National de la Recherche Agronomique, 78026 Versailles cedex, France (A.S.)
In higher plants, ferredoxin (Fd):NADPH oxidoreductase (FNR) catalyzes reduction of NADP+ in the final step of linear photosynthetic electron transport and is also implicated in cyclic electron flow. We have identified three leaf FNR isoenzymes (LFNR1, LFNR2, and LFNR3) in maize (Zea mays) chloroplasts at approximately equivalent concentrations. Fractionation of chloroplasts showed that, while LFNR3 is an exclusively soluble enzyme, LFNR1 is only found at the thylakoid membrane and LFNR2 has a dual location. LFNR1 and LFNR2 were found to associate with the cytochrome b6f complex following its partial purification. We cloned LFNR3 and produced all three isoenzymes as stable, soluble proteins. Measurement of Fd reduction ability showed no significant differences between these recombinant enzymes. Column chromatography revealed variation between the interaction mechanisms of LFNR1 and LFNR2 with Fd, as detected by differential dependence on specific intermolecular salt bridges and variable sensitivity of interactions to changes in pH. A comparison of LFNR transcripts in leaves of plants grown on variable nitrogen regimes revealed that LFNR1 and LFNR2 transcripts are relatively more abundant under conditions of high demand for NADPH. These results are discussed in terms of the functional differentiation of maize LFNR isoenzymes.
Ferredoxin (Fd):NADPH oxidoreductase (FNR; EC 1.18.1.2) is a flavoenzyme that catalyzes reduction of NADP+ or oxidation of NADPH through electron transfer with Fd. In the final step of photosynthetic electron transport, FNR reduces NADP+, using Fd that has accepted electrons from PSI (Carrillo and Ceccarelli, 2003
It has been reported that FNR in higher plant chloroplasts is localized peripherally on the stromal side of thylakoid membranes through association with an intrinsic protein (Vallejos et al., 1984
In addition to linear electron transport, a photosynthetic proton gradient may also be driven solely by PSI cycling electrons via Fd or NADPH back to the cyt b6f complex (Bendall and Manasse, 1995
Higher plant FNRs are encoded by a small multiple gene family as shown by the recent whole-genome analysis of Arabidopsis (Arabidopsis thaliana; http://www.plantgdb.org/AtGDB) and rice (Oryza sativa; http://cdna01.dna.affrc.go.jp/cDNA), in both of which two leaf-type FNR (LFNR) isoenzymes and two RFNR isoenzymes are annotated. The presence of multiple isoenzymes at the protein level has been reported in several plant species (Green et al., 1991
The reductive assimilation of nitrogen requires abundant reducing equivalents and ATP, and some molecular species of FNRs and Fds are known to respond to changes in nitrogen status. In both Arabidopsis (Wang et al., 2003 Here we report the identification at the cDNA and protein level of a new, third maize LFNR isoenzyme. Comparison of the subplastid location, expression pattern, and Fd interactions of native isoenzymes, combined with analysis of all three as recombinant enzymes following cloning and recombinant expression, indicates that multiple LFNR isoenzymes enable higher plants to respond rapidly to varied reductive demands.
There Are Three Leaf FNR Proteins in Maize Chloroplasts and They Vary in Subchloroplast Location
Antibodies raised against recombinant maize LFNR1 (Onda et al., 2000
Subchloroplast distribution of putative LFNR isoenzymes was investigated by separating stroma and thylakoid membranes and western blotting (Fig. 2). Separation into predominantly stromal and thylakoid fractions was confirmed by distribution of the stromal enzyme Rubisco and the 33-kD PSII protein, which is intrinsic in the thylakoid membrane (Fig. 2A). The three LFNR bands were differentially distributed between the stroma and the thylakoid membranes: Band A is present in both fractions, band B is located only in the stroma, and band C is associated exclusively with the thylakoid membrane. Membrane association of bands A and C was unaffected by washing with 500 mM NaCl, but disrupted by 0.1% Triton X-100 (Fig. 2B).
Cloning of a New Maize LFNR
Two maize LFNR cDNAs (LFNR1 and LFNR2) had previously been identified (Onda et al., 2000
During previous cloning of LFNR1 and LFNR2 cDNAs (Onda et al., 2000 When aligned, the mature LFNRs have high amino acid sequence homology (LFNR1:LFNR2 = 83%, LFNR1:LFNR3 = 84%, LFNR2:LFNR3 = 92%; Fig. 3A). The phylogenetic tree in Figure 3B indicates that LFNR1 belongs to a genetically distinct group of isoenzymes from LFNR2 and LFNR3, and that these two groups are conserved among other cereals.
The Three Putative LFNR Isoenzymes Correspond to LFNR1, LFNR2, and LFNR3 LFNRs were partially purified from stroma and thylakoid membranes by Fd affinity chromatography (Supplemental Fig. 1). The three putative LFNR bands were either blotted to polyvinylidene difluoride (PVDF) membrane and N-terminal sequenced, or excised, modified, digested, and analyzed by matrix-assisted laser-desorption ionization time-of-flight (MALDI-TOF) mass spectrometry (MS). This analysis demonstrated that band C corresponded to LFNR1, band B corresponded to LFNR3, and band A obtained from both stroma and thylakoid membranes corresponded to LFNR2. The mass of detected peptides is compared to that of predicted digestion products of LFNR1, LFNR2, and LFNR3 in Supplemental Table I. The sequence coverage of LFNR1, LFNR2, and LFNR3 by MS data was 40.3%, 43.9%, and 39.2%, respectively. N-terminal sequences of the mature enzymes are also shown in Supplemental Table I. The cleavage point of transit peptides, derived from this sequencing information, is indicated in the alignment in Figure 3A and reveals that the presequences of LFNR2 and LFNR3 are very similar (61%), and different from those of LFNR1 (22% and 23%, respectively). The molecular masses of mature LFNR1, LFNR2, and LFNR3 are 34.97, 35.57, and 34.7 kD, respectively, as predicted by the Compute pI/Mw tool program at ExPASy (http://ca.expasy.org/tools/pi_tool.html).
FNR is an
Relative Abundance of LFNRs
LFNR1 was recombinantly expressed in Escherichia coli previously (Onda et al., 2000
Catalytic Activity and Differential Interaction with Fd
Fd reduction activity of recombinant LFNR isoenzymes was assayed using an NADPH-dependent cyt c reduction system, and kinetic parameters are shown in Table II. Activity of LFNR2 and LFNR3 was similar and higher than that of LFNR1, the Vmax value of LFNR1 being about two-thirds that of LFNR2 and LFNR3. The x-ray crystal structure of maize LFNR1 and Fd revealed that LFNR1 and Fd interact mainly through electrostatic forces (Kurisu et al., 2001
Variable dependence of LFNRs on salt bridging for complex formation with Fd means that changes in pH may also have a variable effect on the formation of different FNR-Fd complexes, and we therefore compared the Fd binding of maize LFNRs at pH 8 and pH 6.8 (Fig. 6B). While LFNR1 eluted from the Fd column at approximately the same salt concentration, LFNR3-Fd interactions were slightly weakened at high pH and LFNR2 showed a dramatically faster elution.
Assimilation of ammonium places very different reductive demands on the chloroplast than assimilation of nitrate, and different LFNR isoenzymes in Arabidopsis showed variation in relative expression when grown on variable nitrogen regimes (Hanke et al., 2005
Variation in LFNR Isoenzyme Location Following our identification of LFNR3 at cDNA and protein levels, we now know of three different LFNR isoenzymes present at roughly equal concentrations in maize chloroplasts. Our analysis indicates that a primary difference among them is their subplastid location; LFNR1 is restricted to the thylakoid membrane and LFNR3 is a soluble stromal enzyme, while LFNR2 is present in both fractions. Previous failure to detect LFNR3 is probably due to its stromal location, which is not consistent with the current dogma that LFNR principally catalyzes NADP+ photoreduction on the thylakoid membrane. At least one-third of all LFNR, in the form of the LFNR3 isoenzyme, is in fact in the stroma of maize chloroplasts (Table I), although it is not yet clear whether it acts in physiological reduction and/or oxidation of NADP(H).
The structural basis for differential location of LFNR isoforms remains unclear. The region of greatest variation between LFNR isoforms is at the N terminus, immediately following the transit peptide cleavage site (Fig. 3A). This is disordered in the crystal structure of maize LFNR1 (Kurisu et al., 2001 Approximately 40% of LFNR2 is present in the stroma, and it is unclear what determines this dual subplastid location and whether there is a dynamic equilibrium between the two locations. One possibility is that this difference may be due to posttranslational modification. There is an interesting difference between the composition of digestion products from stromal and thylakoid species of LFNR2, as detected by MALDI-TOF MS. Peptide279-290 was detected only in stromal LFNR2, whereas peptide193-212 was detected only in thylakoid-associated LFNR2 (Supplemental Table I), indicating that these regions may somehow be related to differential localization. As peptide coverage by MALDI-TOF MS was not complete, it is also possible that some kind of modification, located on an unmeasured peptide fragment, remained undetected.
Recombinant expression of mature LFNR1, LFNR2, and LFNR3 in E. coli generated stable, soluble, and functional proteins whose migration through SDS-PAGE was very similar to that of LFNR1, LFNR2, and LFNR3 extracted from maize leaves (Fig. 5). This suggests that membrane localization is not critical for protein assembly and that if any modification is associated with localizing LFNR at the thylakoid, it is relatively small. FNR interactions with the thylakoid are probably not electrostatic because they were not disrupted by a 2 M NaBr wash (data not shown) or EDTA (Zhang et al., 2001
LFNR1 and LFNR2 were copurified with the cyt b6f complex, although both eluted a little faster than cyt b6f subunits during the final hydrophobic chromatography (Fig. 4). Previous reports from spinach (Zhang et al., 2001
LFNR residues contributing intermolecular salt bridges to the complex with Fd (Kurisu et al., 2001
Despite this variation, the Fd reduction activity of all LFNR isoenzymes was disrupted to roughly the same extent by the D65N/D66N Fd mutation, although LFNR2 did show a slightly greater loss of affinity (Table II). The difference between the effect of the D65N/D66N Fd mutation on the column (a complex between oxidized Fd and LFNR) and during Fd reduction (when LFNR has been reduced by NADPH) indicates that there may be redox state-dependent changes in the mode of interaction between Fd and FNR. Additionally, there may be a discrepancy between the contribution of these salt bridges to formation of the kinetically competent complex (measured as Km), as compared to the initial, nonproductive complex, known to be dominated by ionic forces (Hurley et al., 1999
Variation in Fd binding between LFNRs occurs despite conservation of all residues contributing salt bridges to the LFNR1-Fd complex. The structural basis of such differences remains to be elucidated, but their physiological implications are intriguing and lead us to investigate pH dependency. In high pH conditions, equivalent to those in the stroma of an actively photosynthesizing chloroplast, interaction of Fd with LFNR2 is dramatically weaker as compared to LFNR1, while interaction with LFNR3 is also slightly reduced. In Table I, the total LFNR in maize chloroplasts is 270 µg/mg chlorophyll (around 30 µM if all LFNR were soluble), which is of the same molar order as Fd as measured by Yonekura-Sakakibara et al. (2000)
Continuous growth on different nitrogen regimes revealed isoenzyme-specific differences in LFNR transcripts (Fig. 7). This is consistent with our work on Arabidopsis (Hanke et al., 2005 In this article, we describe the identification of a new, soluble LFNR isoenzyme in maize and present a thorough comparison of the subchloroplast location, physical properties, expression, and Fd interactions of all three maize LFNRs. This analysis leads us to propose that LFNR1 and LFNR2 are the predominantly active isoenzymes in NADP+ reduction during linear and cyclic electron transport, and that electron flow through LFNR2 may be dynamically regulated by the photosynthetic state of the chloroplast. The exact functional differentiation of the three LFNRs remains to be elucidated, in particular the physiological role of soluble LFNR.
Plant Growth
Maize (Zea mays L. cv Golden Cross Bantam T51) seedlings were grown in vermiculite for 2 weeks with Hoagland nutrients (Arnon and Hoagland, 1940
SDS-PAGE and western blotting using an antibody raised against maize LFNR1 was essentially as described by Onda et al. (2000)
Chloroplasts were isolated from maize leaves essentially as described by Jenkins and Boag (1984)
Fd affinity resin was prepared from recombinant maize wild-type Fd and D65N/D66N mutant Fd as described previously (Hase et al., 1991
LFNRs separated by Fd affinity chromatography were reduced and carboxymethylated essentially as described by Crestfield et al. (1963)
Thirty candidate FNR clones isolated from a maize seedling cDNA library (Onda et al., 2000
Maize leaves (500 g) were homogenized in 1 L of 0.2 M Suc, 25 mM HEPES-NaOH, pH 7.5, 10 mM CaCl2, and 10 mM MgCl2 at 4°C and filtered through two layers of gauze and two layers of miracloth. The partial purification of cyt b6f from this homogenate was then essentially the same as the published protocol for spinach (Zhang and Cramer, 2004
pYOLFNR2 was used as a template for LFNR2 and primer pairs were GGCGCCATGGTATCTACAACAGAAACCGCGGAGGCGGAGCCGGTCAAG and GTCGAAGTCTACTGACATGCGGATCCTTA. The pSO1 vector was used as a template for LFNR3 and primer pairs were GGCGCCATGGTATCTACAACAGAAACCGCGGCGGCGGGGCCGGCGAAG and GTCGAGGTCTACTGACATGCGGATCCTTA. Sense primers contained the initiation Met, codons of 13 amino acids from the mature protein N terminus and an NcoI site. Antisense primers contained a stop codon, codons of four amino acids from the C terminus, and a BamHI site. PCR was carried out for 35 cycles of 15 s at 94°C, 30 s at 55°C for LFNR2 or 65°C for LFNR3, and 60 s at 72°C using KOD-Plus Taq (Toyobo). Products were purified using a MinElute gel extraction kit (Qiagen) after electrophoresis on a 1% agarose gel and digested with NcoI and BamHI (Toyobo). The resulting fragments were inserted into a NcoI- and BamHI-digested pQE-60 vector (Qiagen) using DNA ligation kit version 2.1 (TaKaRa Bio). Plasmids were named pQE-LFNR2 and pQE-LFNR3 and, in essentially the same procedure described by Onda et al. (2000)
Fd reduction activities of LFNRs were measured as described in Onda et al. (2000)
Total RNA was prepared from maize leaves using the RNeasy plant mini kit (Qiagen) and cDNA was synthesized using Omniscript kit (Qiagen). PCR was hot started at 94°C and carried out at 94°C for 15 s, 65°C for 30 s, and 72°C for 2 min using TaKaRa LA Taq (TaKaRa Bio). LFNR1 primers were AAGGCCAAGAAGGAGTCCAAGAAG and ACAACACAAAATGTCAGCTGCAAAA, LFNR2 primers were GAGCCGGTCAAGAAGCTGGAG and TTGCTTGAGCTGAACAATACAATGAA, and LFNR3 primers were CGGCGAAGACGTCCAAGAAG and AGTCGTCAACGGATGGATGGAT. PCR products were visualized by ethidium bromide staining after electrophoresis through a 1% agarose gel. An initial PCR with quantum RNA 18S standards (Ambion) was used to confirm equivalence of the cDNA template. Sequence data from this article can be found in the GenBank/EMBL data libraries under accession numbers AB035644, AB035644, At5g66190, At1g20020, AJ457979, AJ457980, D17790, XM_506676, X12446, U14956, M25528, X07981, AJ250378, and Y14032. Received August 31, 2005; returned for revision August 31, 2005; accepted September 12, 2005.
1 This work was supported by a grant-in-aid (no. 15GSO320) for Creative Scientific Research from the Ministry of Education, Culture, Sports, Science and Technology of Japan and a Joint Research Program between the Japan Society for the Promotion of Science and the Institut National de la Recherche Agronomique, France. The author responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors (www.plantphysiol.org) is: Toshiharu Hase (enzyme{at}protein.osaka-u.ac.jp).
[w] The online version of this article contains Web-only data. Article, publication date, and citation information can be found at www.plantphysiol.org/cgi/doi/10.1104/pp.105.070813. * Corresponding author; e-mail enzyme{at}protein.osaka-u.ac.jp; fax 81668798613.
Akashi T, Matsumura T, Ideguchi T, Iwakiri K, Kawakatsu T, Taniguchi I, Hase T (1999) Comparison of the electrostatic binding sites on the surface of ferredoxin for two ferredoxin-dependent enzymes, ferredoxin-NADP(+) reductase and sulfite reductase. J Biol Chem 274: 2939929405 Andersen B, Scheller HV, Moller BL (1992) The PSI E subunit of photosystem I binds ferredoxin:NADP+ oxidoreductase. FEBS Lett 311: 169173[CrossRef][Web of Science][Medline] Arnon DI, Hoagland DR (1940) Crop production in artificial solutions and soils with special reference to factors influencing yield and absorption of inorganic nutrient. Soil Sci 50: 463471 Bendall DS, Manasse RS (1995) Cyclic photophosphorylation and electron transport. Biochim Biophys Acta 1229: 2338[CrossRef] Bojko M, Kruk J, Wieckowski S (2003) Plastoquinones are effectively reduced by ferredoxin:NADP+ oxidoreductase in the presence of sodium cholate micelles: significance for cyclic electron transport and chlororespiration. Phytochemistry 64: 10551060[CrossRef][Web of Science][Medline] Bruns CM, Karplus PA (1995) Refined crystal structure of spinach ferredoxin reductase at 1.7Å resolution: oxidized, reduced and 2'-phospho-5'-AMP bound states. J Mol Biol 247: 125145[CrossRef][Web of Science][Medline] Carrillo N, Ceccarelli EA (2003) Open questions in ferredoxin-NADP+ reductase catalytic mechanism. Eur J Biochem 270: 19001915[Web of Science][Medline] Clark RD, Hawkesford MJ, Coughlan SJ, Bennett J, Hind G (1984) Association of ferredoxin-NADP+ oxidoreductase with the chloroplast cytochrome b-f complex. FEBS Lett 174: 137142[CrossRef] Crawford NM (1995) Nitrate: nutrient and signal for plant growth. Plant Cell 7: 859868[CrossRef][Web of Science][Medline]
Crestfield AM, Stanford M, Stein WH (1963) The preparation and enzymatic hydrolysis of reduced and S-carboxymethylated proteins. J Biol Chem 238: 622627
Green LS, Yee BC, Buchanan BB, Kamide K, Sanada Y, Wada K (1991) Ferredoxin and ferredoxin-NADP reductase from photosynthetic and nonphotosynthetic tissues of tomato. Plant Physiol 96: 12071213 Hanke GT, Okutani S, Satomi Y, Takao T, Suzuki A, Hase T (2005) Multiple iso-proteins of FNR in Arabidopsis: evidence for different contributions to chloroplast function and nitrogen assimilation. Plant Cell Environ 28: 11461157[CrossRef]
Hase T, Mizutani S, Mukohata Y (1991) Expression of maize ferredoxin cDNA in Escherichia coli: comparison of photosynthetic and nonphotosynthetic ferredoxin isoenzymes and their chimeric molecule. Plant Physiol 97: 13951401 Hurley JK, Hazzard JT, Martinez-Julvez M, Medina M, Gomez-Moreno C, Tollin G (1999) Electrostatic forces involved in orienting Anabaena ferredoxin during binding to Anabaena ferredoxin:NADP+ reductase: site-specific mutagenesis, transient kinetic measurements, and electrostatic surface potentials. Protein Sci 8: 16141622[Medline] Jenkins CLD, Boag S (1984) Large scale, rapid preparation of functional mesophyll chloroplasts from Zea mays and other C4 species. Plant Sci Lett 39: 1924 Kurisu G, Kusunoki M, Katoh E, Yamazaki T, Teshima K, Onda Y, Kimata-Ariga Y, Hase T (2001) Structure of electron transfer complex between ferredoxin and ferredoxin-NADP+ reductase. Nat Struct Biol 8: 117121[CrossRef][Web of Science][Medline]
Kurisu G, Zhang H, Smith JL, Cramer WA (2003) Structure of the cytochrome b6f complex of oxygenic photosynthesis: tuning the cavity. Science 302: 10091014 Maeda M, Lee YH, Ikegami T, Tamura K, Hoshino M, Yamazaki T, Nakayama M, Hase T, Goto Y (2005) Identification of the N- and C-terminal substrate binding segments of ferredoxin-NADP+ reductase by NMR. Biochemistry 44: 1064410653[CrossRef][Medline]
Matthijs HCP, Coughlan SJ, Hind G (1986) Removal ferredoxin-NADP+ oxidoreductase from thylakoid membranes, rebinding to depleted membranes, and identification of the binding site. J Biol Chem 261: 1215412158 Munekage Y, Hashimoto M, Miyake C, Tomizawa K, Endo T, Tasaka M, Shikanai T (2004) Cyclic electron flow around photosystem I is essential for photosynthesis. Nature 429: 579582[CrossRef][Medline] Neuhaus HE, Emes MJ (2000) Nonphotosynthetic metabolism in plastids. Annu Rev Plant Physiol Plant Mol Biol 51: 111140[CrossRef][Web of Science]
Onda Y, Matsumura T, Kimata-Ariga Y, Sakakibara H, Sugiyama T, Hase T (2000) Differential interaction of maize root ferredoxin:NADP+ oxidoreductase with photosynthetic and nonphotosynthetic ferredoxin isoenzymes. Plant Physiol 123: 10371045 Quiles MJ, Garcia A, Cuello J (2000) Separation by blue-native PAGE and identification of the whole NAD(P)H dehydrogenase complex from barley stroma thylakoids. Plant Physiol Biochem 38: 225232[CrossRef] Ritchie SW, Redinbaugh MG, Shiraishi N, Vrba JM, Campbell WH (1994) Identification of a maize root transcript expressed in the primary response to nitrate: characterization of a cDNA with homology to ferredoxin-NADP+ oxidoreductase. Plant Mol Biol 26: 679690[CrossRef][Web of Science][Medline] Sakakibara H (2003) Differential response of genes for ferredoxin and ferredoxin:NADP+ oxidoreductase to nitrate and light in maize leaves. J Plant Physiol 160: 6570[CrossRef][Web of Science][Medline] Stitt M (1999) Nitrate regulation of metabolism and growth. Curr Opin Plant Biol 2: 178186[CrossRef][Web of Science][Medline] Stroebel D, Choquet Y, Popot JL, Picot D (2003) An atypical haem in the cytochrome b(6)f complex. Nature 426: 413418[CrossRef][Medline] Suzuki A, Rioual S, Lemarchand S, Godfroy N, Roux Y, Boutin JP, Rothstein S (2001) Regulation by light and metabolites of ferredoxin-dependent glutamate synthase in maize. Physiol Plant 112: 524530[CrossRef][Medline] Thomas PE, Ryan D, Levin W (1976) An improved staining procedure for the detection of the peroxidase activity of cytochrome P-450 on sodium dodecyl sulfate polyacrylamide gels. Anal Biochem 75: 168176[CrossRef][Web of Science][Medline]
Vallejos RH, Ceccarelli E, Chan R (1984) Evidence for the existence of a thylakoid intrinsic protein that binds ferredoxin-NADP+ oxidoreductase. J Biol Chem 259: 80488051
Wang R, Okamoto M, Xing X, Crawford NM (2003) Microarray analysis of the nitrate response in Arabidopsis roots and shoots reveals over 1,000 rapidly responding genes and new linkages to glucose, trehalose-6-phosphate, iron, and sulfate metabolism. Plant Physiol 132: 556567 Winter H, Robinson DG, Heldt HW (1994) Subcellular volumes and metabolite concentrations in spinach leaves. Planta 193: 530535[CrossRef][Web of Science]
Yonekura-Sakakibara K, Onda Y, Ashikari T, Tanaka Y, Kusumi Y, Hase T (2000) Analysis of the reductant supply systems for ferredoxin-dependent sulfite reductase in photosynthetic and nonphotosynthetic organs in maize. Plant Physiol 122: 887894 Zhang H, Cramer WA (2004) Purification and crystallization of the cytochrome b6f complex in oxygenic photosynthesis. Methods Mol Biol 274: 6778[Medline]
Zhang H, Whitelegge JP, Cramer WA (2001) Ferredoxin:NADP+ oxidoreductase is a subunit of the chloroplast cytochrome b6f complex. J Biol Chem 276: 3815938165 This article has been cited by other articles:
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ASPB Publications | PLANT PHYSIOLOGY® | THE PLANT CELL | |
|---|---|---|---|