|
|
||||||||
|
First published online December 23, 2005; 10.1104/pp.105.070326 Plant Physiology 140:221-234 (2006) © 2006 American Society of Plant Biologists
Transcript Analysis of Early Nodulation Events in Medicago truncatula1,2,[W]Department of Plant Biology (D.P.L., N.S., K.A.T.S., K.A.V.), Department of Plant Pathology (S.P., D.S.), and Microbial and Plant Genomics Institute (D.S., K.A.V.), University of Minnesota, Saint Paul, Minnesota 55108; Biological Research Center of the Hungarian Academy of Sciences, Institute of Genetics, H6726 Szeged, Hungary (G.E.); United States Department of Agriculture, Agricultural Research Service, Plant Science Research Unit, Saint Paul, Minnesota 55108 (D.S.); and The Institute for Genomic Research, Rockville, Maryland 20850 (C.T.)
Within the first 72 h of the interaction between rhizobia and their host plants, nodule primordium induction and infection occur. We predicted that transcription profiling of early stages of the symbiosis between Medicago truncatula roots and Sinorhizobium meliloti would identify regulated plant genes that likely condition key events in nodule initiation. Therefore, using a microarray with about 6,000 cDNAs, we compared transcripts from inoculated and uninoculated roots corresponding to defined stages between 1 and 72 h post inoculation (hpi). Hundreds of genes of both known and unknown function were significantly regulated at these time points. Four stages of the interaction were recognized based on gene expression profiles, and potential marker genes for these stages were identified. Some genes that were regulated differentially during stages I (1 hpi) and II (612 hpi) of the interaction belong to families encoding proteins involved in calcium transport and binding, reactive oxygen metabolism, and cytoskeleton and cell wall functions. Genes involved in cell proliferation were found to be up-regulated during stages III (2448 hpi) and IV (72 hpi). Many genes that are homologs of defense response genes were up-regulated during stage I but down-regulated later, likely facilitating infection thread progression into the root cortex. Additionally, genes putatively involved in signal transduction and transcriptional regulation were found to be differentially regulated in the inoculated roots at each time point. The findings shed light on the complexity of coordinated gene regulation and will be useful for continued dissection of the early steps in symbiosis.
The symbiotic interaction between legume roots and bacteria in the Rhizobiaceae (collectively called rhizobia) leads to the formation of root nodules, where rhizobia fix atmospheric dinitrogen into ammonia for use by the plant. The process of nitrogen fixation has economic importance, plus biological significance for understanding the interaction between plants and bacteria. Use of the model legumes Lotus japonicus and Medicago truncatula (Cook, 1999
Understanding of the plant's genetic control of early events in nodulation is coming into focus. Several key genes, first identified by phenotype, have been cloned that encode proteins required for these early stages, including several protein kinases, putative transcriptional regulators, and proteins that may regulate and/or respond to ion fluxes (Endre et al., 2002
DNA arrays can be used to quantify expression of many genes simultaneously (Schena et al., 1995 Here, we describe results from transcript profiling experiments examining transcript abundance in M. truncatula roots from 1 to 72 hpi with S. meliloti. The cDNA microarray consisted of more than 6,000 cDNA clones from a broad diversity of M. truncatula libraries. A large number of genes were significantly differentially regulated at each time point in inoculated roots compared to uninoculated roots. The root response to S. meliloti was divided into four stages based on transcript abundance profiles. The first two stages are characterized by an apparent induction, then suppression, of defense and disease response genes, and by differential expression of many genes related to signaling and infection induction. Marked induction of genes encoding proteins related to cell proliferation characterized the third and fourth stages. Potential new markers for each of the stages are presented.
Stages of the M. truncatula/S. meliloti Symbiosis Selected for Transcript Profiling
To evaluate early events in response to rhizobia and nodule induction, M. truncatula roots were harvested for microscopic observation at the same time points as for transcript profiling. Swelling of root hair tips was observed 1 hpi, followed by resumption of polar growth, producing an asymmetrical root hair tip by 6 hpi and hair branching by 12 hpi (Fig. 1
). Curled root hairs were visible by 24 hpi, and inner cortical cells started dividing between 24 and 48 hpi. The initiation of infection threads in the tightly curled root hairs was also observed at 48 hpi. At 72 hpi, nodule primordia were observed with infection threads penetrating the cortical cells and entering the primordia. The morphological changes observed in the inoculated roots were comparable to published reports of events in M. truncatula and S. meliloti interactions (Timmers et al., 1999
Hundreds of Genes Are Differentially Regulated in Response to S. meliloti Inoculation
Data for all time points for all genes on the array are listed in Supplemental Table I, which contains mean normalized intensities for inoculated and uninoculated roots, as well as expression ratios of inoculated to uninoculated root intensities. Genes that show statistically significant differences between inoculated and uninoculated roots (herein referred to as significant genes) are flagged. Genes are annotated with the GenBank accession number for an expressed sequence tag (EST) corresponding to the cDNA clone and a gene description based on BLAST analysis of the EST and The Institute for Genomic Research (TIGR) tentative consensus sequence (TC; version 7) containing the EST corresponding to the spotted cDNAs. Additionally, significant genes with fold changes of
To detect significant genes with regulated expression and to eliminate those that have inconsistent expression data among replicated experiments, we employed a statistical method adapted specifically for microarrays, which allows estimation of the false discovery rate (FDR) for multiple testing (Tusher et al., 2001
Multiple Approaches Validate the Results from Microarray Analysis
Several approaches were utilized to validate the microarray results obtained. First, the expression patterns for known markers of early nodulation responses were evaluated (Table II). ENOD40 is an early nodulin that encodes an unusually small peptide and has been reported to be involved in controlling Suc use in nodules (Charon et al., 1997
We also compared transcript abundance of genes that were reported as significantly up-regulated at 24 h after treatment with Nod factor or S. meliloti Rm1021 (Mitra et al., 2004b 2) and six genes down-regulated in response to a 24-h Nod factor treatment. In this study, at the same time point, 66 and 85 genes were found to be significantly up- and down-regulated, respectively, using a similar criterion of 2.0-fold change. As presented in Table II, out of nine TCs common to both our array and that of Mitra et al. (2004b)As a second approach to validate the microarray results and to demonstrate the validity of pooling RNA samples from three independent biological replicates for microarray hybridizations, we selected several significant genes with different fold changes for evaluation of transcript abundance by quantitative real-time reverse transcription (RT)-PCR (qRT-PCR) on RNA samples from three independent biological replicates (Table III). The results showed the same direction of fold change of transcript abundance in all three biological replicates for all tested genes, thus confirming the validity of the microarray results.
A semiquantitative approach (SQRT-PCR) was used on pooled RNA samples to verify the expression of additional significant genes in the microarray experiments. Figure 2 shows the results from SQRT-PCR for five different genes representing 17 pairs of data points from microarray experiments. Genes showing significant changes in expression on the microarrays displayed visible differences in the quantities of the amplified products in SQRT-PCR for all pairs of data points. We were able to validate the direction of change of significant genes with fold changes as low as 1.15 in microarray experiments (TC80422, 12 hpi). Overall, the RT-PCR results corresponded to the microarray results in terms of direction of change and again indicated the reproducibility of our microarray results.
The expression of one gene was further analyzed using a promoter-reporter fusion. A cytokinin receptor-like kinase (TC80422) that is similar to CRE1b of Arabidopsis was significantly up-regulated between 6 and 48 hpi, although the fold change by microarray evaluation was never more than 1.37. We fused the putative promoter region of this gene to a GUS reporter gene, and followed GUS activity after S. meliloti inoculation in transgenic hairy roots of M. truncatula (Fig. 3 ). Without inoculation, staining was visible in root tips, and faint staining was occasionally seen in cortical cells (Fig. 3A). After inoculation, strong GUS expression was observed in the zone above the root tip (Fig. 3B) and in patches of cortical cells in mature roots (Fig. 3C); however, no staining was observed in root hairs in the presence or absence of rhizobia (data not shown). Strong expression was observed in lateral root primordia (Fig. 3, DH), which became restricted to the root tip once the lateral roots grew out of the parent root. Strong GUS expression also occurred in nodule primordia, which became restricted to nodule meristems in mature nodules (Fig. 3, IN). Overall, the patterns of CRE1b promoter activity in nodule and lateral root primordia indicated that transcript of the CRE1b homolog might accumulate most strongly in mitotically activated cells. Whether CRE1b is induced by cytokinins needs further investigation.
Potential New Markers for Early Stages of Symbiosis Gene expression profiles at all time points were clustered to identify transcriptional stages of early interactions between M. truncatula and S. meliloti. Figure 4A presents clustering of all significant genes at different time points. Results of cluster analysis of the experiments identified close similarities in transcriptional responses between roots at 6 and 12 hpi, and similarly between roots at 24 and 48 hpi. Therefore, we defined four stages corresponding to transcriptional changes in response to rhizobia: stage I represented gene expression changes observed at 1 hpi; stage II, at 6 to 12 hpi; stage III, at 24 to 48 hpi; and stage IV, at 72 hpi. Interestingly, gene expression changes between 1 and 12 hpi were more dissimilar than those between 24 and 72 hpi. This may reflect more diverse physiological and regulatory changes in the root in the first hours after inoculation than during primordium formation.
Fifty genes were identified as new markers for early stages of symbiosis (Fig. 4B). Because experiments corresponding to 6 and 12 hpi, and 24 and 48 hpi, clustered together (Fig. 4A), common marker genes were identified for these two pairs of time points, designated as stage II and stage III, respectively. The genes selected as markers for a particular stage were selected based on 1.5-fold up-regulation in the inoculated roots, statistical significance, and the lack of high fold induction earlier in the time series for stages II, III, and IV. For stage I, significant up-regulation of 1.5-fold at 1 hpi and no significant up-regulation at later time points were chosen as criteria. By these criteria, among the previous markers identified in Table II, one gene (TC78657, an acyl-activating enzyme homolog) would be a marker for stage I, three (ENOD12, MtN1, and an aquaporin [TC86110]) would be markers for stage II, and the remainder would be markers for stage III. Twenty-six new potential markers were identified for stage I (1 hpi). Similarly, 13 genes were identified as potential markers for stage II (6 and 12 hpi), seven genes for stage III (24 and 48 hpi), and four genes for stage IV (72 hpi; Fig. 4B). The CRE1b homolog was included as a marker even though it had a lower fold induction because it was confirmed as an up-regulated gene by SQRT-PCR and reporter gene expression (Figs. 2 and 3). An RNA-binding protein (TC88112), which has been shown to be exported to the cytoplasm from the nucleus in ENOD40-expressing cells during nodule development (Campalans et al., 2004Genes with known function or that were homologs of genes of known function were divided into functional categories for further data mining. Assignments were based on Gene Ontology categories and suspected or known roles in early interactions between M. truncatula and S. meliloti, based on published accounts. As a caveat, it should be noted that because the assignment to categories for many of the genes is based only upon automated annotation of ESTs, it is therefore subject to error. Nevertheless, this approach is useful for observing patterns in gene expression and advancing hypotheses that may be evaluated by later experimentation. We evaluated the Z score, a standardized difference between observed and expected values, to determine whether up- or down-regulated genes in a functional gene group were found in numbers greater than would be expected by chance. Z scores for various gene groups, evaluating the occurrence of up-regulated genes among group members, are shown in Table IV. TCs included in gene groups used to calculate Z scores in Table IV are given in Supplemental Table VIII. Evaluation of transcriptional profiles for these functional groups revealed many insights about the time course of symbiotic responses. Three prominent patterns were observed, including up-regulation of defense- and stress-related genes during stage I, up-regulation of genes with presumed functions in cytomorphogenesis in stage II, and up-regulation of genes related to cell proliferation and protein synthesis in the later stages, as described below.
Induction of Many Putative Defense, Disease, and Stress Response Genes Demarcates Stage I of Transcriptional Responses to Rhizobia at 1 hpi A successful symbiosis is thought to require inhibition of defense responses by the host plant (Mithöfer, 2002
Supplemental Figures 1 and 2 show the fold changes of transcripts in inoculated versus uninoculated roots for homologs of putative disease resistance and stress response genes, respectively. Different subgroups had notable patterns of expression. Chitinase genes were largely up-regulated between 1 and 24 hpi, though expression thereafter was variable. Salzer et al. (2004)
The end products of the isoflavonoid pathway, pterocarpan phytoalexins, have antimicrobial activity, while certain pathway intermediates are potent elicitors of Nod factor biosynthesis in rhizobia (Dixon and Sumner, 2003
Up-Regulation of Genes Governing Cytoskeleton Structure and Cell Wall Composition Correlates with Root Hair Deformation in Stage II Many new cell walls must be synthesized during cell divisions resulting in nodule primordia and during infection thread formation, corresponding to stages III and IV here. From our data, the up-regulation of cell wall genes in the group occurs most prominently at 1 hpi (Table IV), thus preceding infection or primordium formation. Supplemental Figure 5 presents expression profiles of genes related to cell wall organization and modification.
Several groups of genes encoding likely cell wall enzymes were also modulated early during the symbiosis, beginning at stage I.
Induction of Gene Families Involved in Cell Proliferation and Gene Expression Characterizes Stages III and IV
Mitra et al. (2004b)
Interestingly, the changes in transcript abundance observed in stages I and II do not appear to involve a wholesale up-regulation of machinery for protein biosynthesis. By contrast, among genes encoding proteins involved in translation, down-regulated genes were significantly overrepresented in inoculated roots at stage I (Table IV; Supplemental Fig. 7). Inhibition of protein biosynthesis is a metabolic response of plants under stress (Rhodes and Nadolska-Orczyk, 2001
Gene Products Affecting Second Messenger Production and Perception
Another important signaling event happening during early stages of symbiosis is the modulation of the production/accumulation of reactive oxygen species (ROS; Ramu et al., 2002
Several protein kinases have been found to regulate very early steps of nodule formation (Oldroyd et al., 2005
Transcription Factors during Early Symbiotic Interactions
Supplemental Figure 12 presents expression patterns of transcription factors at different time points in the inoculated roots as compared to uninoculated roots. One particularly interesting group of genes was made up WRKY genes. One WRKY homolog (TC86532) was significantly up-regulated in the inoculated roots in stage I (1 hpi), whereas this and many other WRKY members were significantly down-regulated at 6 hpi and later (Supplemental Fig. 12). Many WRKY proteins have a regulatory function in response to pathogen infection and other stresses (Eulgem et al., 2000
We identified hundreds of genes that are differentially expressed in M. truncatula roots from 1 h to 72 h following inoculation with S. meliloti. A clustering of gene expression profiles indicated four identifiable stages of interaction between these two symbiotic partners during this period (Fig. 5 ). These stages correspond to root hair swelling (stage I); root hair branching/deformation (stage II); root hair curling, cortical cell division, infection thread formation, and nodule primordium initiation (stage III); and the development of an infected macroscopic nodule primordium (stage IV). Genes from some groups are preferentially suppressed at some time points while induced at some other time points. Our results indicate an induction of putative defense response genes at 1 hpi but a strong suppression later on, particularly at 48 hpi. If a role in defense is verified for these genes, it may indicate that M. truncatula roots may initially recognize S. meliloti more as a biotic stress than as beneficial symbiont. Similarly, an overall down-regulation of genes involved in translation at 1 hpi may be an indication of plant roots being under stress (such as pathogen attack) at this time point. The induction of a defense response during early interaction between plant roots and beneficial microsymbionts such as arbuscular mycorrhizal fungi has been reported (Volpin et al., 1995
Not surprisingly, putative signal transduction and regulatory genes do not show a consistent pattern of transcriptional regulation during early rhizobial responses. However, genes in these groups that do show significant modulation in expression may be components of signaling cascades in response to Nod factor or other bacterial signals. Ivashuta et al. (2005)
Plant Material and Growth Conditions
Medicago truncatula genotype A17 was germinated and grown as described previously (Penmetsa and Cook, 2000
To verify developmental stages of roots harvested for RNA isolation, several roots were harvested at each time point for microscopic observation. Rhizobia in the root were detected using X-GAL staining as described (Boivin et al., 1999
Clones selected for the array were obtained from a wide variety of cDNA libraries that were previously utilized for EST sequencing, and were obtained from the University of Minnesota and the Noble Foundation. Supplemental Table IX contains the percentage representation of various cDNA libraries from which the clones were drawn for the microarray. We utilized the publicly available TCs from the TIGR Medicago Gene Index (http://www.tigr.org/tdb/mtgi/; Quackenbush et al., 2001 The clones selected as described above for this microarray were resequenced to verify clone identity, and new sequences were deposited in GenBank. All cDNA clones used for the array were previously prepared by directionally ligating poly(A+) enriched RNA into a pBluescript SK vector (Stratagene), using the EcoRI and XhoI cloning sites, according to the manufacturer's directions. Primers used for sequencing were SKmod (CTAGAACTAGTGGATCC), used for sequencing the 5' end of the insert, and T7 (GTAATACGACTCACTATAGGGC), used for sequencing the 3' end. To prepare cDNAs for spotting on arrays, the cDNA inserts were PCR amplified using the SKmod and T7 primers. The amplified inserts were then purified and resuspended in 3x SSC or 50% dimethyl sulfoxide for spotting on glass slides coated with SuperAmine substrate (Telechem International). The printing solution was spotted once for each element (EST) on each slide using Gene Machine's Omnigrid Array Spotter in combination with SMP3 pins from Telechem International.
Roots from inoculated plants and from uninoculated plants at comparable ages were collected 1, 6, 12, 24, 48, and 72 hpi. While still frozen, root tips (about 34 mm in length) and shoots (cut at the point where the hypocotyls showed green pigmentation) were removed, and the rest of the root was stored at 80°C before the isolation of RNA. Root samples from three independent biological replicates were collected for the experiment. RNA from frozen root samples was isolated using the RNeasy Plant Mini Kit (Qiagen) following the manufacturer's instructions. RNA concentrations were quantified using a Genova spectrophotometer and stored at 80°C before use. Eleven micrograms of RNA from each of three biological replicates was pooled to make a total of 33 µg for cDNA synthesis with a RT primer for labeling with either Cy3 or Cy5 dye molecules using a 3DNA Array 50 Expression Array Detection Kit for cDNA Microarrays (Genisphere). cDNA was synthesized following instructions from 3DNA Array 50 Expression Array Detection Kit Appendix A (Genisphere). Microarrays for each time point were hybridized to cDNAs from both inoculated and uninoculated wild-type roots, with cDNAs from the two different treatments labeled with different dyes. Each hybridization was repeated a total of six times to sample the technical variability, with three repeats of each dye combination to control for dye effects. The hybridization and washing procedures of the 3DNA Array 50 Expression Array Detection Kit were followed. Briefly, the hybridization mix consisted of 2.5 µL of cDNAs from inoculated and uninoculated roots, 2.5 µL of Cy3 and Cy5 dyes, 2 µL of locked nucleic acids dT blocker, and 9 µL of 2x SDS hybridization buffer. Hybridization was carried out at 62.0°C for 20 to 23 h. Hybridized slides were washed in 2x SSC, 0.2% SDS for 10 min at 55°C, 2x SSC for 10 min at room temperature, and 0.2x SSC for 10 min at room temperature with gentle agitation.
Microarray slides were scanned using an Axon two-laser scanner, and image analysis was performed using GenePix (Axon) software. Background-subtracted mean intensities for both tissues were log transformed and normalized before further analysis. Normalization of the data was performed using a statistical module developed as part of Lab Information System, which includes several scripts and modules written in PERL and R languages. The Lab Information System is not a commercial product. Within-slide normalization was carried out using local linear regression (LOWESS function; Yang et al., 2000
A standardized difference score, or Z score, is a difference between observed and expected values expressed in terms of SDs of observed values (Doniger et al., 2003 Two-dimensional hierarchical clustering was done on data sets that included genes significant at least at one time point. Complete-linkage algorithm was applied to the correlation matrix for both directions as implemented in GeneExpressionist (GeneData). The entire data set has been deposited in Gene Expression Omnibus with a GEO accession number GSE3441.
RNA was sampled as for microarrays, as described above. To prevent genomic DNA contamination, RNA samples were treated with DNA-free (Ambion). RNA was quantified after DNase treatment, and 4.5 µg of total RNA for each biological replicate of each treatment was used to synthesize cDNA separately. cDNA was synthesized with the First Strand cDNA Synthesis Kit for RT-PCR (AMV; Roche) following the manufacturer's protocol in a 20-µL reaction mix. For qRT-PCR, SYBR Green PCR and RT-PCR Reagents (part no. 4304886) from Applied Biosystems were used as per the manufacturer's instructions with 1 µL of cDNA as template per reaction. The PCR was performed in an ABI Prism 7000 Sequence Detection System from Applied Biosystems with the following regime: 10 min at 95.0°C, 45 cycles of denaturation at 95.0°C for 15 s, and annealing/extension at 60.0°C for 1 min. For each biological replicate, three qRT-PCR reactions were run from a cDNA synthesis. The means from three qRT-PCR reactions are presented for each biological replicate. Secret Agent (TC77416), a constitutively expressed gene, was used as an endogenous control (Kuppusamy et al., 2004
For SQRT-PCR, 1.5 µg of RNA was pooled from each of three biological replicates after DNase treatment to make a total of 4.5 µg RNA for first-strand cDNA synthesis. cDNA was synthesized as above. Each reaction included 200 µM dNTPs, 500 nM of each primer, 1x Taq DNA polymerase buffer, 1.25 units of Taq DNA polymerase (Promega), and 2 µL of cDNA as template. The initial denaturation was for 2 min at 95°C, followed by annealing at 55°C for 30 s and extension for 1.5 min at 72°C. The subsequent cycles had denaturation at 95°C for only 30 s, and the PCR was carried on for 16 additional cycles. RT-PCR on each sample was carried out in duplicates from two independent cDNA syntheses. Secret Agent (TC77416), a constitutively expressed gene, was used as a loading control (Kuppusamy et al., 2004
Promoter-Reporter Construct and Transgenic Hairy Root Production
An approximately 2.5-kb fragment upstream of the predicted cytokinin receptor-like protein CRE1b (M. truncatula genomic clone AC142094.5) was amplified and cloned into the BamHI site of the binary plasmid vector pBI101.1 (Jefferson et al., 1987 Sequence data from this article can be found in the GenBank/EMBL data libraries under accession numbers listed in GEO submission with accession number GSE3441.
We thank Greg May, Stephen Gantt, and Carroll Vance for contributing cDNA clones used in the array. We are also grateful to Arkady Khodursky for the use of his Array Spotter and for his expertise in microarray preparation, and David Marks for allowing us to use his microscope facility. We thank Mark Dickson and Tim Paape for their help in the laboratory work. Received August 24, 2005; returned for revision November 3, 2005; accepted November 9, 2005.
1 This work was supported by the National Science Foundation Plant Genome Project (award no. 0110206) and by the University of Minnesota.
2 Mention of trade names or commercial products in the article is solely for the purpose of providing specific information and does not imply recommendations or endorsement by the U.S. Department of Agriculture. The author responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors (www.plantphysiol.org) is: Kathryn A. VandenBosch (vande102{at}umn.edu).
[W] The online version of this article contains Web-only data. Article, publication date, and citation information can be found at www.plantphysiol.org/cgi/doi/10.1104/pp.105.070326. * Corresponding author; e-mail vande102{at}umn.edu; fax 6126251738.
Ané J-M, Kiss GB, Riley BK, Penmetsa RV, Oldroyd GED, Ayax C, Lévy J, Debellé F, Baek J-M, Kalo P, et al (2004) Medicago truncatula DMI1 required for bacterial and fungal symbioses in legumes. Science 303: 16341637 Asad S, Fang YW, Wycoff KL, Hirsch AM (1994) Isolation and characterization of cDNA and genomic clones of MsENOD40: Transcripts are detected in meristematic cells of alfalfa. Protoplasma 183: 1023[CrossRef] Boisson-Dernier A, Chabaud M, Garcia F, Becard G, Rosenberg C, Barker DG (2001) Agrobacterium rhizogenes-transformed roots of Medicago truncatula for the study of nitrogen-fixing and endomycorrhizal symbiotic associations. Mol Plant-Microbe Interact 14: 695700[Web of Science][Medline] Boivin C, Camut S, Malpica CA, Truchet G, Rosenberg C (1999) Rhizobium meliloti genes encoding catabolism of trigonelline are induced under symbiotic conditions. Plant Cell 2: 11571170 Campalans A, Kondorosi A, Crespi M (2004) ENOD40, a short open reading frame-containing mRNA, induces cytoplasmic localization of nuclear RNA binding protein in Medicago truncatula. Plant Cell 16: 10471059 Cárdenas L, Feijó JA, Kunkel JG, Sanchez F, Holdaway-Clarke T, Hepler PK, Quinto C (1999) Rhizobium Nod factors induce increases in intracellular free calcium and extracellular calcium influxes in bean root hairs. Plant J 19: 347352[CrossRef][Web of Science][Medline] Cárdenas L, Holdaway-Clarke TL, Sanchez F, Quinto C, Feijo JA, Kunkel JG, Helper PK (2000) Ion changes in legume root hairs responding to Nod factors. Plant Physiol 123: 443452 Catoira R, Galera C, de Billy F, Penmetsa RV, Journet E-P, Maillet F, Rosenberg C, Cook D, Gough C, Dénarié J (2000) Four genes of Medicago truncatula controlling components of a Nod factor transduction pathway. Plant Cell 12: 16471665 Charon C, Johansson C, Kondorosi E, Kondorosi A, Crespi M (1997) enod40 induces dedifferentiation and division of root cortical cells in legumes. Proc Natl Acad Sci USA 94: 89018906 Colebatch G, Kloska S, Trevaskis B, Freund S, Altman T, Udvardi MK (2002) Novel aspects of symbiotic nitrogen fixation uncovered by transcript profiling with cDNA arrays. Mol Plant-Microbe Interact 15: 411420[Web of Science][Medline] Cook D, Dreyer D, Bonnet D, Howell M, Nony E, VandenBosch K (1995) Transient induction of a peroxidase gene in Medicago truncatula precedes infection by Rhizobium meliloti. Plant Cell 7: 4355[Abstract] Cook DR (1999) Medicago truncatulaa model in the making! Curr Opin Plant Biol 2: 301304[CrossRef][Web of Science][Medline] D'Agostino IB, Deruère J, Kieber JJ (2000) Characterization of the response of the Arabidopsis response regulator gene family to cytokinin. Plant Physiol 124: 17061717 Dixon RA, Sumner LW (2003) Legume natural products: understanding and manipulating complex pathways for human and animal health. Plant Physiol 131: 878885 Doniger SW, Salomonis N, Dahlquist KD, Vranizan K, Lawlor SC, Bruce RC (2003) MAPPFinder: using Gene Ontology and GenMAPP to create a global gene-expression profile from microarray data. Genome Biol 4: R7[CrossRef][Medline] Edwards R, Dixon DP, Walbot V (2000) Plant glutathione S-transferases: enzymes with multiple functions in sickness and in health. Trends Plant Sci 5: 193198[CrossRef][Web of Science][Medline] Ehrhardt DW, Wais R, Long SR (1996) Calcium spiking in plant root hairs responding to Rhizobium nodulation signals. Cell 85: 673681[CrossRef][Web of Science][Medline] Endre G, Kereszt A, Kevei Z, Mihacea S, Kaló P, Kiss GB (2002) A receptor kinase gene regulating symbiotic nodule development. Nature 417: 952956 Eulgem T, Rushton PJ, Robatzek S, Somssich IE (2000) The WRKY superfamily of plant transcription factors. Trends Plant Sci 5: 199206[CrossRef][Web of Science][Medline] Fedorova M, van de Mortel J, Matsumoto PA, Cho J, Town CD, VandenBosch KA, Gantt JS, Vance CP (2002) Genome-wide identification of nodule-specific transcripts in the model legume Medicago truncatula. Plant Physiol 130: 519537 Gage DJ (2004) Infection and invasion of roots by symbiotic, nitrogen-fixing rhizobia during nodulation of temperate legumes. Microbiol Mol Biol Rev 68: 280300 Gamas P, de Billy F, Trichet G (1998) Symbiosis-specific expression of two Medicago truncatula nodulin genes, MtN1 and MtN13, encoding products homologous to plant defense proteins. Mol Plant-Microbe Interact 11: 393403[Web of Science][Medline] Gamas P, de Carvalho Niebel F, Lescure N, Cullimore JV (1996) Use of a subtractive hybridization approach to identify new Medicago truncatula genes induced during root nodule development. Mol Plant-Microbe Interact 9: 233242[Web of Science][Medline] Ivashuta S, Liu J, Liu J, Lohar DP, Haridas S, Bucciarelli B, VandenBosch KA, Vance CP, Harrison MJ, Gantt S (2005) RNA interference identifies a calcium-dependent protein kinase involved in Medicago truncatula root development. Plant Cell 17: 29112921 Jefferson RA, Kavanagh TA, Bevan MW (1987) GUS fusions: Journet E-P, El-Gachtouli N, Vernoud V, de Billy F, Pichon M, Dedieu A, Arnould C, Morandi D, Barker D, Gianinazzi-Pearson V (2001) Medicago truncatula ENOD11: a novel RPRP-encoding early nodulin gene expressed during mycorrhization in arbuscule-containing cells. Mol Plant-Microbe Interact 14: 737748[Web of Science][Medline] Journet EP, Pichon M, Dedieu A, de Billy F, Truchet G, Barker DG (1994) Rhizobium meliloti Nod factors elicit cell-specific transcription of the ENOD12 gene in transgenic alfalfa. Plant J 6: 241249[CrossRef][Web of Science][Medline] Kaló P, Gleason C, Edwards A, Marsh J, Mitra R, Hirsch S, Jakab J, Sims S, Long SR, Rogers J, et al (2005) Nodulation signaling in legumes requires NSP2, a member of the GRAS family of transcriptional regulators. Science 308: 17861789 Kerr MK, Martin M, Churchill GA (2000) Analysis of variance for gene expression microarray data. J Comput Biol 7: 819837[CrossRef][Web of Science][Medline] Kondorosi E, Redondo-Neito M, Kondorosi A (2005) Ubiquitin-mediated proteolysis. To be in the right place at the right moment during nodule development. Plant Physiol 137: 11971204 Kuppusamy KT, Endre G, Prabhu R, Penmetsa RV, Veereshlingam H, Cook DR, Dickstein R, VandenBosch KA (2004) LIN, a Medicago truncatula gene required for nodule differentiation and persistence of rhizobial infections. Plant Physiol 136: 36823691 Küster H, Hohnjec N, Krajinski F, Yahyaoui FE, Manthey K, Gouzyg J, Dondrup M, Meyer F, Kalinowski J, Brechenmacher L, et al (2004) Construction and validation of cDNA-based Mt6k-RIT macro- and microarrays to explore root endosymbioses in the model legume Medicago truncatula. J Biotechnol 108: 95113[CrossRef][Web of Science][Medline] Lambeth JD (2004) NOX enzymes and the biology of reactive oxygen. Nat Rev Immunol 4: 181189[CrossRef][Web of Science][Medline] Lamblin A-FJ, Crow JA, Johnson JE, Silverstein KAT, Kunau TM, Kilian A, Benz D, Stromvik M, Endré G, VandenBosch KA, et al (2003) MtDB: a database for personalized data mining of the model legume Medicago truncatula transcriptome. Nucleic Acids Res 31: 196201 Limpens E, Franken C, Smit P, Willemse J, Bisseling T, Geurts R (2003) LysM domain receptor kinases regulating rhizobial Nod factor-induced infection. Science 302: 630633 Liu J, Blaylock LA, Endre G, Cho J, Town CD, VandenBosch KA, Harrison MJ (2003) Transcript profiling coupled with spatial expression analyses reveals genes involved in distinct developmental stages of an arbuscular mycorrhizal symbiosis. Plant Cell 15: 21062123 Liu J, Blaylock LA, Harrison MJ (2004) cDNA arrays as a tool to identify mycorrhiza-regulated genes: identification of mycorrhiza-induced genes that encode or generate signaling molecules implicated in the control of root growth. Can J Bot 82: 11771185[CrossRef] Lohar DP, Schaff JE, Laskey JG, Kieber JJ, Bilyeu KD, Bird DM (2004) Cytokinins play opposite roles in lateral root formation, and nematode and rhizobial symbioses. Plant J 38: 203214[CrossRef][Web of Science][Medline] Lum MR, Hirsch AM (2003) Roots and their symbiotic microbes: strategies to obtain nitrogen and phosphorus in a nutrient-limiting environment. J Plant Growth Regul 21: 368382 Mathesius U (2001) Flavonoids induced in cells undergoing nodule organogenesis in white clover are regulators of auxin breakdown by peroxidase. J Exp Bot 52: 419426 Mathesius U, Schlaman HR, Spaink HP, Sautter C, Rolfe BG, Djordjevic MA (1998) Auxin transport inhibition precedes root nodule formation in white clover roots and is regulated by flavonoids and derivatives of chitin oligosaccharides. Plant J 14: 2334[CrossRef][Web of Science][Medline] Maxwell CA, Harrison MJ, Dixon RA (1993) Molecular characterization and expression of alfalfa isoliquiritigenin 2'-O-methyltransferase, an enzyme specifically involved in the biosynthesis of an inducer of Rhizobium meliloti nodulation genes. Plant J 4: 971981[Medline] Meyers BC, Galbraith DW, Nelson T, Agrawal V (2004) Methods for transcriptional profiling in plants. Be fruitful and replicate. Plant Physiol 135: 637652 Mithöfer A (2002) Suppression of plant defence in rhizobia-legume symbiosis. Trends Plant Sci 7: 440444[CrossRef][Web of Science][Medline] Mitra RM, Gleason CA, Edwards A, Hadfield J, Downie JA, Oldroyd GED, Long SR (2004a) A Ca2+/calmodulin-dependent protein kinase required for symbiotic nodule development: gene identification by transcript-based cloning. Proc Natl Acad Sci USA 101: 47014705 Mitra RM, Shaw SL, Long SR (2004b) Six non-nodulating plant mutants defective for Nod factor-induced transcriptional changes associated with the legume-rhizobia symbiosis. Proc Natl Acad Sci USA 101: 1021710222 Muñoz JA, Coronado C, Perez-Hormaeche J, Kondorosi A, Ratet P, Palomares AJ (1998) MsPG3, a Medicago sativa polygalacturonase gene expressed during the alfalfa Rhizobium meliloti interaction. Proc Natl Acad Sci USA 95: 96879692 Mysore KS, D'Ascenzo MD, He X, Martin GB (2003) Overexpression of the disease resistance gene Pto in tomato induces gene expression changes similar to immune responses in human and fruitfly. Plant Physiol 132: 19011912 Oldroyd GE, Harrison M, Udvardi M (2005) Peace talks and trade deals: keys to long-term harmony in legume-microbe symbioses. Plant Physiol 137: 12051210 Passardi F, Penel C, Dunand C (2004) Performing the paradoxical: how plant peroxidases modify the cell wall. Trends Plant Sci 9: 13601385 Penmetsa VR, Cook DR (1997) A legume ethylene-insensitive mutant hyperinfected by its rhizobial symbionts. Science 275: 527530 Penmetsa RV, Cook DR (2000) Isolation and characterization of diverse developmental mutants in Medicago truncatula. Plant Physiol 123: 13871397 Pichon M, Journet E-P, Dedieu A, de Billy F, Truchet G, Barker DG (1992) Rhizobium meliloti elicits transient expression of the early nodulin gene ENOD12 in the differentiating root epidermis of transgenic alfalfa. Plant Cell 4: 11991211 Quackenbush J, Cho J, Lee D, Liang F, Holt I, Karamycheva S, Parvizi B, Pertea G, Sultana R, White J (2001) The TIGR Gene Indices: analysis of gene transcript sequences in highly sampled eukaryotic species. Nucleic Acids Res 29: 159164 Ramu SK, Peng HM, Cook DR (2002) Nod factor induction of reactive oxygen species production is correlated with expression of the early nodulin gene rip1 in Medicago truncatula. Mol Plant-Microbe Interact 15: 522528[Web of Science][Medline] Rhodes D, Nadolska-Orczyk A (2001) Plant stress physiology. In Encyclopaedia of Life Sciences. Nature Publishing Group, http://www.els.net Riley BK, Ané JM, Penmetsa RV, Cook DR (2004) Genetic and genomic analysis in model legumes bring Nod-factor signaling to center stage. Curr Opin Plant Biol 7: 408413[CrossRef][Web of Science][Medline] Rohrig H, Schmidt J, Miklashevichs E, Schell J, John M (2002) Soybean ENOD40 encodes two peptides that bind to sucrose synthase. Proc Natl Acad Sci USA 99: 19151920 Rushton PJ, Somssich IE (1998) Transcriptional control of plant genes responsive to pathogens. Curr Opin Plant Biol 1: 311315[CrossRef][Web of Science][Medline] Salzer P, Feddermann N, Wiemken A, Boller T, Staehelin C (2004) Sinorhizobium meliloti-induced chitinase gene expression in Medicago truncatula ecotype R108-1: a comparison between symbiosis-specific class V and defence-related class IV chitinases. Planta 219: 626638[Web of Science][Medline] Sambrook J, Fritsch EF, Maniatis T (1989) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY Schauser L, Roussis A, Stiller J, Stougaard J (1999) A plant regulator controlling development of symbiotic root nodules. Nature 402: 191195[CrossRef][Medline] Schena M, Shalon D, Davis RW, Brown PO (1995) Quantitative monitoring of gene expression patterns with a complementary DNA microarray. Science 270: 467470 Scheres B, van de Wiel C, Zalensky A, Horvath B, Spaink H, van Eck H, Zwartkruis F, Wolters A-M, Gloudemans T, van Kammen A, et al (1990) The ENOD12 gene product is involved in the infection process during the pea-Rhizobium interaction. Cell 60: 281294[CrossRef][Web of Science][Medline] Shaw SL, Long SR (2003a) Nod factor elicits two separable calcium responses in Medicago truncatula root hair cells. Plant Physiol 131: 976984 Shaw SL, Long SR (2003b) Nod factor inhibition of reactive oxygen efflux in a host legume. Plant Physiol 132: 21962204 Smit P, Raedts J, Portyanko V, Debelle F, Gough C, Bisseling T, Geurts R (2005) NSP1 of the GRAS protein family is essential for rhizobial Nod factor-induced transcription. Science 308: 17891791 Stotz HU, Long SR (1999) Expression of the pea (Pisum sativum L.) tubulin gene TubA1 is correlated with cell division activity. Plant Mol Biol 41: 601614[Medline] Stougaard J (2001) Genetics and genomics of root symbiosis. Curr Opin Plant Biol 4: 328335[CrossRef][Web of Science][Medline] Takemoto D, Hardham AR (2004) The cytoskeleton as a regulator and target of biotic interactions in plants. Plant Physiol 136: 38643876 Timmers ACJ, Auriac M-C, Truchet G (1999) Refined analysis of early symbiotic steps of the Rhizobium-Medicago interaction in relationship with microtubular cytoskeleton rearrangements. Development 126: 36173628[Abstract] Tusher VG, Tibshirani R, Chu G (2001) Significance analysis of microarrays applied to the ionizing radiation response. Proc Natl Acad Sci USA 98: 51165121 Vernoud V, Journet EP, Barker D (1999) MtENOD20, a Nod-factor-inducible molecular marker for root cortical cell activation. Mol Plant-Microbe Interact 12: 604614[CrossRef][Web of Science] Volpin H, Phillips DA, Okon Y, Kapulnik Y (1995) Suppression of an isoflavonoid phytoalexin defense response in mycorrhizal alfalfa roots. Plant Physiol 108: 14491454[Abstract] Wais RJ, Galera C, Oldroyd G, Catoira R, Penmetsa RV, Cook D, Gough C, Dénarié J, Long SR (2000) Genetic analysis of calcium spiking responses in nodulation mutants of Medicago truncatula. Proc Natl Acad Sci USA 97: 1340713412 Walker SA, Viprey V, Downie JA (2000) Dissection of nodulation signaling using pea mutants defective for calcium spiking induced by Nod factors and chitin oligomers. Proc Natl Acad Sci USA 97: 1341313418 Williamson JD, Stoop JM, Massel MO, Conkling MA, Pharr DM (1995) Sequence analysis of a mannitol dehydrogenase cDNA from plants reveals a function for the pathogenesis-related protein ELI3. Proc Natl Acad Sci USA 92: 71487152 Yahyaoui FE, Küster H, Amor BB, Hohnjec N, Pühler A, Becker A, Gouzy J, Vernié T, Gough C, Niebel A, Godiard L, et al (2004) Expression profiling in Medicago truncatula identifies more than 750 genes differentially expressed during nodulation, including many potential regulators of the symbiotic program. Plant Physiol 136: 31593176 Yang IV, Chen E, Hasseman JP, Liang W, Frank BC, Wang S, Sharov V, Saeed AI, White J, Li J, et al (2002) Within the fold: assessing differential expression measures and reproducibility in microarray assays. Genome Biol 3: RESEARCH0062[Medline] Yang YH, Buckley MJ, Dudoit S, Speed TP (2000) Comparison of methods for image analysis on cDNA microarray data. In Technical Report 2000. Statistics Department, University of California, Berkeley, CA Zucchero JC, Caspi M, Dunn K (2001) ngl9: a third MADS box gene expressed in alfalfa root nodules. Mol Plant-Microbe Interact 14: 14631467[Web of Science][Medline] This article has been cited by other articles:
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ASPB Publications | PLANT PHYSIOLOGY® | THE PLANT CELL | |
|---|---|---|---|