|
|
||||||||
|
Plant Physiology 140:3-11 (2006) © 2006 American Society of Plant Biologists Agroinjection of Tomato Fruits. A Tool for Rapid Functional Analysis of Transgenes Directly in Fruit1Instituto de Biología Molecular y Celular de Plantas, Consejo Superior de Investigaciones Científicas, Universidad Politécnica de Valencia, Camino de Vera s/n, 46022 Valencia, Spain (D.O., S.M., A.G.); and Laboratory of Molecular Recognition and Antibody Technology, Wageningen University, 6700 ES Wageningen, The Netherlands (W.H.W.)
Transient expression of foreign genes in plant tissues is a valuable tool for plant biotechnology. To shorten the time for gene functional analysis in fruits, we developed a transient methodology that could be applied to tomato (Solanum lycopersicum cv Micro Tom) fruits. It was found that injection of Agrobacterium cultures through the fruit stylar apex resulted in complete fruit infiltration. This infiltration method, named fruit agroinjection, rendered high levels of 35S Cauliflower mosaic virus-driven -glucuronidase and yellow fluorescence protein transient expression in the fruit, with higher expression levels around the placenta and moderate levels in the pericarp. Usefulness of fruit agroinjection was assayed in three case studies: (1) the heat shock regulation of an Arabidopsis (Arabidopsis thaliana) promoter, (2) the production of recombinant IgA antibodies as an example of molecular farming, and (3) the virus-induced gene silencing of the carotene biosynthesis pathway. In all three instances, this technology was shown to be efficient as a tool for fast transgene expression in fruits.
The generation of stably transformed transgenic plants to assess gene function is a lengthy manipulative process. As an alternative, foreign gene expression in plants is often performed by transient transformation of cells or tissues. Recently, Agrobacterium-mediated transient gene expression (agroinfiltration) in plant leaves has become the favorite choice in many gene functional analyses (Kapila et al., 1997
Tomato fruit is a model for fleshy fruit development. Currently, several international efforts converge in the genomic characterization of tomato and related solanaceae species, including expressed sequence tags and genome sequencing projects (http://www.sgn.cornell.edu/). In addition, tomato fruits have been proposed as factories for the production of oral vaccines and other immunotherapeutic proteins (Sandhu et al., 2000 We have developed an agroinfiltration-based system (agroinjection), which allows transient expression of foreign genes directly in fruit tissues. We tested agroinjection as an assay tool for transgene studies in three scenarios: (1) the study of promoter activity assisted by reporter genes; (2) the analysis of xenoprotein production in fruits, as exemplified by IgA antibodies; and (3) the study of gene function by virus-induced gene silencing (VIGS).
Infiltration of Tomato Fruit Tissues with Agrobacterium
The versatility of agroinfiltration in N. benthamiana leaves prompted us to test the possibility of establishing a similar approach in tomato fruits. We first tested several methods for mechanically introducing bacteria in the fruit cell apoplast. Progression of the infiltration was monitored with Agrobacterium cultures stained with methylene blue. Needle-free syringe infiltration was found ineffective as well as vacuum-assisted infiltration of intact, detached fruits (data not shown). Sliced or half-cut fruits were effectively infiltrated, but the procedure inflicted severe tissue damage and was therefore discarded. Finally, we tested the injection of infiltration media into the fruit using a syringe with needle. A similar approach for fleshy fruits described earlier in the literature produced only partial fruit infiltration, limiting the possible applications of the technique (Spolaore et al., 2001
Agroinjection as a Transient Expression System
Once infiltration in most fruit tissues was confirmed, we proceeded to test fruit agroinjection as a transient expression system of foreign genes using yellow fluorescence protein (YFP, a yellow version of green fluorescence protein) and
The capacity for modulating transgene expression using agroinjection was tested with a construct containing the Arabidopsis heat shock-regulated promoter HSP70B fused to GUS (Aparicio et al., 2005 We found that the spatial expression patterns observed with agroinjection seem at least partially governed by constraints imposed by the fruit architecture and the ability of the bacteria to reach the different tissues in the fruit. For instance, maximum expression levels are normally observed in the placenta, probably because it constitutes a diffusion barrier in the apoplastic network of the fruit. Consequently, interpretation of the spatial expression patterns obtained by agroinjection should take these considerations into account.
Production of xenoproteins in edible fruits has important biotechnological implications particularly for the production of recombinant products with oral therapeutic activity (Walmsley and Arntzen, 2003
We are particularly interested in the production of IgA antibodies in fruits. IgAs are candidates for oral delivered microbicides as they play a role in the passive protection of mucosa against pathogen invasion (Corthesy, 2002
Agrobacterium cultures carrying antibody heavy chains (HCs; HC8 or HC10) and light chains (LCs; LC8 or LC10) under the control of 35S promoter (Fig. 3A
) were agroinjected, either separately or in combination. In the latter case, high cotransformation rates will ensure coexpression of HCs and LCs, rendering assembled IgAs. Antibody expression in fruits was monitored by western blot detecting HCs (top section), LCs (middle section), and complexed IgAs (bottom section; Fig. 3B). Here, it can be observed that LCs do not accumulate when expressed alone (middle section, lanes L8 and L10). Conversely, HCs injected without partner LC render a single specific fragment (
The cotransformation efficiency of the system is remarkable as demonstrated by the mutual stabilization effect found between HCs and LCs of n10 antibody. The differential idiotype stability found in the case of n8 and n10 has also been described for antibodies produced in mammalian systems (Bentley et al., 1998
VIGS has emerged as a powerful tool for functional genomics. A Tobacco rattle virus (TRV)-based system (pTRV1/2) has been proven effective in tomato plants previously (Liu et al., 2002
We conducted two PDS-VIGS strategies. On one hand, we performed direct fruit agroinjection to assess its potential as a shortcut for functional gene analysis. In parallel, we followed systemic VIGS using standard inoculation procedures (Liu et al., 2002 For systemic VIGS, cotyledons and first leaves from six 2-week-old plants were extensively agroinfiltrated with a TRV1/2-tPDS mix. Five of the plants developed silencing symptoms in the leaves. PDS silencing was also evident in fruits as white sectors in several young fruits in four of the plants (Fig. 4A). At maturity, green sectors turned temporally yellow/orange and immediately developed into red, whereas white sectors remained yellow/orange, a clear sign of impaired lycopene accumulation (Fig. 4B). In total, 66% of the fruits from the four fruit-silenced plants (roughly 44% of all fruits in the experiment) showed silencing symptoms (n = 54), with yellow/orange sectors expanding between 10% and 100% of the whole fruit surface. For local VIGS experiments, a total of 140 green fruits at different developmental stages (ranging from 724 DPA) were agroinjected, 71 of them with pTRV1/2-PDS mix and the remaining 69 using a control pTRV1 plasmid. Color changes were recorded, with color evolution divided in standard stages (Green, Breaker, Yellow/Orange, and Red; see Fig. 4C). An additional intermediate stage was defined in our experiments, named as S, corresponding to fruits at the yellow/orange stage showing also some red sectors. Control fruits that were scored as S developed rapidly into red, whereas most (61%) of pTRV1/2-PDS tomatoes remained arrested in S stage. The extension of red sectors in S-arrested tomatoes differed among fruits (ranging from S1 to S4 as depicted in Fig. 4C). Fruits arrested at S stage resembled those obtained with systemic PDS-VIGS (Fig. 4B), and therefore we concluded that they were locally silenced in PDS. Figure 4G shows the color evolution during the 4-week experiment. Only 4% of the TRV1/2-PDS fruits (three out of 71) developed into fully red tomatoes, in contrast with the 80% of the controls that turned red (95% if abscised fruits are excluded). Interestingly, the only three TRV1/2-PDS tomatoes that turned red were in late mature-green stage when injected and probably received the silencing signal too late to arrest lycopene accumulation. The remaining 34% of the fruits abscised prior to reaching maturation. This fraction was composed mainly by very young fruits (between 1 and 2 weeks post anthesis), which apparently could not cope with the injury/stress caused during manipulation. It is worth noticing that, excluding abscised fruits, 95% of the TRV1/2-tPDS tomatoes that remained attached to the plant until the end of the experiment (26 d) showed PDS silencing symptoms (S arrest). Occasionally, nontreated fruits growing in the same truss as agroinjected fruits developed also yellow sectors similar to those found in systemic silenced fruits, indicating systemic transmission of silencing signals from fruit to fruit (data not shown).
Deleterious side effects of fruit agroinjection appeared mainly in young fruits, both silenced and controls, and consisted in growth arrest, premature ripening, and abscission. To minimize side effects, we restricted the temporal window of treatment to green fruits between 20 and 25 DPA (at the beginning of mature green stage), giving time to silencing signals to take effect on developmental processes occurring from this point (ripening) but minimizing shedding off. Under these conditions, efficiency of PDS silencing was maintained at levels ranging between 87% and 91% in two different experiments (n = 24), with fruit abscission reduced to 4% and 8%, respectively. We also observed that concentration of Agrobacterium cultures could be reduced to optical density = 0.3 without significant changes in the efficiency of silencing (data not shown). It is worth noting that PDS-silenced fruits often showed viviparous seed germination. In fruits silenced systemically, where often PDS-silenced sectors divide the fruit in two clearly defined parts, it was particularly noteworthy that premature seed germination was restricted to the yellow half of the fruit (Fig. 4, E and F). Reduced dormancy has been described before in the abscisic acid (ABA)-deficient sitiens mutant (Groot and Karssen, 1992 Further characterization of the PDS-silenced phenotype was carried out both in agroinjected and systemically silenced fruits. PDS mRNA levels were measured by quantitative PCR in silenced and nonsilenced fruit pericarp. As shown in Figure 5A , a significant reduction on PDS mRNA levels was observed in all silenced samples when compared with control red pericarp from the same age. Yellow/orange tissue from systemic PDS-silenced fruits showed very low levels of mRNA accumulation, indicating a very effective silencing. Slightly lower inhibition levels were found in locally PDS-silenced fruits. Interestingly, red sectors in systemic PDS-silenced tomatoes also showed up to 4 times reduction in PDS mRNA when compared with nonsilenced controls, without effects in tissue color.
Finally, the carotenoid profile of the different samples was also determined (Fig. 5B). As expected, PDS-silenced pericarp produced low levels of lycopene, accumulating instead the PDS substrate phytoene (Fig. 5C). Carotene profiles correlated with PDS mRNA levels except for red pericarp in systemic PDS-silenced fruits, where lycopene accumulates at similar levels than control red tissue despite the lower PDS mRNA levels. This suggests that PDS mRNA levels need to reach a certain threshold in order to trigger lycopene accumulation.
We have analyzed here the potential of agroinjection for transient expression in tomato fruits. As with any invasive methodology, agroinjection carries certain limitations that should be kept in mind in the design of experiments. The massive presence of Agrobacterium cells in the fruit can induce side effects that should be minimized, e.g. reducing culture concentration and/or incubation times when possible. Appropriate control treatments including agroinfiltrated fruits should be included in any experimental design. With the appropriate controls in place, we have shown that agroinjection is a useful tool for fruit biology. It functions as a fast-construct testing methodology, in the study of promoter regulation, as exemplified with pHSP70B::GUS reporter fusion, in the study xenoprotein expression and stability, as shown in the production of IgA antibodies, and, finally, as a shortcut in VIGS functional gene analysis Moreover, agroinjection may be very helpful when assaying fruit gene constructs that may interfere with plant developmental processes.
While this manuscript was in preparation, Fu and collaborators published a description of virus-induced gene silencing in tomato fruits using several pTRV1/2 delivery methods, which included syringe infiltration of the fruits (Fu et al., 2005
Agrobacterium-Based Transient Transformation Agrobacterium cultures (5 mL) were grown overnight from individual colonies at 28°C in YEB medium plus selective antibiotics, transferred to 50 mL induction medium (0.5% beef extract, 0.1% yeast extract, 0.5% Peptone, 0.5% Suc, 2 mM MgSO4, 20 µM acetosyringone, 10 mM MES, pH 5.6) plus antibiotics, and grown again overnight. Next day, cultures were recovered by centrifugation, resuspended in infiltration medium (10 mM MgCl2, 10 mM MES, 200 µM acetosyringone, pH 5.6; optical density = 1.0 unless stated otherwise), and incubated at room temperature with gentle agitation (20 rpm) for a minimum of 2 h. Cultures were combined when required, collected with a syringe, and injected in the fruits as described below. In methylene blue experiments, cells were incubated for 5 min in infiltration medium containing 0.05% methylene blue, recovered by centrifugation, washed twice with infiltration medium, and agroinjected.
Agroinjection was performed as follows. Tomato fruits (Solanum lycopersicum cv Micro Tom) at different stages of development were infiltrated using a 1-mL syringe with a 0.5-x16-mm needle (BD Pastipak). Needle was introduced 3 to 4 mm in depth into the fruit tissue through the stylar apex, and the infiltration solution was gently injected into the fruit. The total volume of solution injected varied with the size of the fruit, with a maximum of 600 µL in mature green tomatoes. The progress of the process could be followed by a slight change in color in the infiltrated areas. Once the entire fruit surface has been infiltrated, some drops of infiltration solution begin to show running off the hydathodes at the tip of the sepals. Only completely infiltrated fruits were used in the experiments. Tomatoes at developmental stages beyond breaker did not infiltrate completely using this method and therefore were not included in the experiments. For tomato leaf agroinfiltration, needles were removed and Agrobacterium cultures were introduced in the intercellular spaces as described earlier (Liu et al., 2002
For reporter gene analysis, pBIN-YFP/GUS and pHSP70B::GUS plasmids were used. pBIN-YFP/GUS is a pBIN derivative carrying 35S Cauliflower mosaic virus::YFP and 35S Cauliflower mosaic virus::GUS constructs in tandem. Plasmid pHSP70B::GUS contained a 1.98-kb fragment of Arabidopsis (Arabidopsis thaliana) genomic DNA upstream of the ATG codon of the AtHSP70B gene (Sung et al., 2001
For chicken IgA expression, two series of plasmids were used. pBIN-IgL series are pBIN derivatives containing 35S promoter and murine kappa light signal peptide, which incorporate chicken IgL chains n8 and n10 as SalI/XbaI restriction fragments selected from phage display libraries cloned in pCHICK3 phagemid vector (Wieland, 2004
For PDS silencing experiments, previously described pTRV1 and pTRV2-tPDS plasmids were agroinjected (Liu et al., 2002
Histochemical detection of GUS activity was performed as described (Jefferson, 1987 YFP expression was detected under UV light using binocular lens. Confocal images from fresh tissue were taken with a Leika DMIRE2 confocal microscopy. Fruit-expressed chicken IgAs were detected following western-blot standard procedures. Placenta and locular frozen tissues were ground in N2 (l), extracted in 1xphosphate-buffered saline 1:1 (v/w) in the presence of plant protease inhibitor cocktail (Sigma), and cleared by centrifugation. Total protein content was estimated with Bio-Rad Dc protein assay (Bio-Rad). Tomato cleared extracts (10 µg of protein per sample) were separated by SDS-PAGE. For the separation of individual Ig chains, samples were boiled in the presence of Laemmli-running buffer containing 0.1 M dithiothreitol and run in standard 12% acrylamide gels. For the detection of IgA complexes, samples were run in Bio-Rad TX 5% to 12% gradient gels without reducing agent. Gels were transferred to PVDA membranes following standard procedures. LCs and HCs were detected using goat anti-chicken LC and goat anti-chicken IgA alpha-specific antibody, respectively (Bethyl). A rabbit anti-chicken IgY whole-molecule antibody (Sigma) was also used for the detection of IgA complexes. Peroxidase-conjugated secondary antibodies were detected with ECL system (Amersham).
Relative abundance of PDS mRNA in pericarp samples was determined by quantitative reverse transcription-PCR. RNA samples from tomato pericarp were prepared with RNAeasy plant mini kit using on-column RNAse-free DNAse Set treatment (Qiagen), and copied to cDNA with Superscript II reverse transcriptase (Invitrogen). Primers PDSF1 (TCATCAACCTTCCGTGCTTC) and PDSR1 (AACATCCCTTGCCTCCAGC) rendering a 141-bp amplicon were mixed with SYBER GREEN PCR master mix (Applied Biosystems) in appropriated proportions. A tomato actin amplicon was used as internal standard for quantifications. Samples were amplified in triplicate with ABI PRISM 7000 sequence detection system and analyzed with ABI PRISM 7000 SDS software.
For carotene content analysis, tomato pericarp samples (200 mg) from silenced and nonsilenced fruits were ground in N2 (l), extracted, and analyzed as described (Fraser et al., 2000
We thank M.D. Gomez for her help with microscopy techniques and Dr. M.J. Rodrigo for her assistance in carotene measurements. VIGS vectors were supplied by Dr. Dinesh-Kumar (Yale University), and HSP70B:GUS construct was kindly provided by Prof. Maule (John Innes Center, UK). Received July 11, 2005; returned for revision October 11, 2005; accepted October 25, 2005.
1 This work was supported by Generalitat Valenciana (project no. GV04B28) and the Spanish Ministry of Science and Education (Ramón y Cajal Program). The author responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors (www.plantphysiol.org) is: Antonio Granell (agranell{at}ibmcp.upv.es). www.plantphysiol.org/cgi/doi/10.1104/pp.105.068221. * Corresponding author; e-mail agranell{at}ibmcp.upv.es; fax 34963877859.
Aparicio F, Thomas CL, Lederer C, Niu Y, Wang DW, Maule AJ (2005) Virus induction of heat shock protein 70 reflects a general response to protein accumulation in the plant cytosol. Plant Physiol 138: 529536 Bentley KJ, Gewert R, Harris WJ (1998) Differential efficiency of expression of humanized antibodies in transient transfected mammalian cells. Hybridoma 17: 559567[Medline] Chen JC, Jiang CZ, Gookin TE, Hunter DA, Clark DG, Reid MS (2004) Chalcone synthase as a reporter in virus-induced gene silencing studies of flower senescence. Plant Mol Biol 55: 521530[CrossRef][Web of Science][Medline] Corthesy B (2002) Recombinant immunoglobulin A: powerful tools for fundamental and applied research. Trends Biotechnol 20: 6571[CrossRef][Medline] D'Aoust MA, Lerouge P, Busse U (2004) Efficient and reliable production of pharmaceuticals in alfalfa. In R Fischer, S Schillberg, eds, Molecular Farming. Wiley-VCH Verlag GmbH & Co., Weinheim, Germany Fraser PD, Pinto MES, Holloway DE, Bramley PM (2000) Application of high-performance liquid chromatography with photodiode array detection to the metabolic profiling of plant isoprenoids. Plant J 24: 551558[CrossRef][Medline] Fray RG, Grierson D (1993) Identification and genetic-analysis of normal and mutant phytoene synthase genes of tomato by sequencing, complementation and co-suppression. Plant Mol Biol 22: 589602[CrossRef][Web of Science][Medline] Fu D-Q, Zhu B-Z, Zhu H-L, Jiang W-B, Luo Y-B (2005) Virus-induced gene silencing in tomato fruits. Plant J 31: 299308 Goodin MM, Dietzgen RG, Schichnes D, Ruzin S, Jackson AO (2002) pGD vectors: versatile tools for the expression of green and red fluorescent protein fusions in agroinfiltrated plant leaves. Plant J 31: 375383[CrossRef][Web of Science][Medline] Groot SPC, Karssen CM (1992) Dormancy and germination of abscisic acid-deficient tomato seeds: studies with the sitiens mutant. Plant Physiol 99: 952958 Jani D, Meena LS, Rizwan-ul-Haq QM, Singh Y, Sharma AK, Tyagi AK (2002) Expression of cholera toxin B subunit in transgenic tomato plants. Transgenic Res 11: 447454[Medline] Jefferson RA (1987) Assaying chimeric genes in plants: the GUS gene fusion system. Plant Mol Biol Rep 5: 387405 Kapila J, DeRycke R, VanMontagu M, Angenon G (1997) An Agrobacterium-mediated transient gene expression system for intact leaves. Plant Sci 122: 101108[CrossRef] Liu YL, Schiff M, Dinesh-Kumar SP (2002) Virus-induced gene silencing in tomato. Plant J 31: 777786[CrossRef][Web of Science][Medline] Ma Y, Lin SQ, Gao Y, Li M, Luo WX, Zhang J, Xia NS (2003) Expression of ORF2 partial gene of hepatitis E virus in tomatoes and immunoactivity of expression products. World J Gastroenterol 9: 22112215[Medline] Marillonnet S, Thoeringer C, Kandzia R, Klimyuk V, Gleba Y (2005) Systemic Agrobacterium tumefaciens-mediated transfection of viral replicons for efficient transient expression in plants. Nat Biotechnol 23: 718723[CrossRef][Web of Science][Medline] Ratcliff F, Martin-Hernandez AM, Baulcombe DC (2001) Tobacco rattle virus as a vector for analysis of gene function by silencing. Plant J 25: 237245[CrossRef][Web of Science][Medline] Rodriguez-Concepcion M, Ahumada I, Diez-Juez E, Sauret-Gueto S, Lois LM, Gallego F, Carretero-Paulet L, Campos N, Boronat A (2001) 1-Deoxy-D-xylulose 5-phosphate reductoisomerase and plastid isoprenoid biosynthesis during tomato fruit ripening. Plant J 27: 213222[CrossRef][Web of Science][Medline] Sandhu JS, Krasnyanski SF, Domier LL, Korban SS, Osadjan MD, Buetow DE (2000) Oral immunization of mice with transgenic tomato fruit expressing respiratory syncytial virus-F protein induces a systemic immune response. Transgenic Res 9: 127135[CrossRef][Web of Science][Medline] Sharp JM, Doran PM (2001) Characterization of monoclonal antibody fragments produced by plant cells. Biotechnol Bioeng 73: 338346[Medline] Spolaore S, Trainotti L, Casadoro G (2001) A simple protocol for transient gene expression in ripe fleshy fruit mediated by Agrobacterium. J Exp Bot 52: 845850 Sung DY, Vierling E, Guy CL (2001) Comprehensive expression profile analysis of the Arabidopsis hsp70 gene family. Plant Physiol 126: 789800 Walmsley AM, Alvarez ML, Jin Y, Kirk DD, Lee SM, Pinkhasov J, Rigano MM, Arntzen CJ, Mason HS (2003) Expression of the B subunit of Escherichia coli heat-labile enterotoxin as a fusion protein in transgenic tomato. Plant Cell Rep 21: 10201026[Medline] Walmsley AM, Arntzen CJ (2003) Plant cell factories and mucosal vaccines. Curr Opin Biotechnol 14: 145150[CrossRef][Web of Science][Medline] Wieland W (2004) From phage display to plant expression: fulfilling prerequisites for chicken oral immunotherapy against coccidiosis. PhD thesis. Wageningen University, Wageningen, The Netherlands Wieland W, Orzaez D, Lammers A, Schots A (2006) Display and selection of chicken IgA phage fragments. Vet Immunol Immunopathol doi/10.1016/j.vetimm.2005.09.012 (in press) Wroblewski T, Tomczak A, Michelmore R (2005) Optimization of Agrobacterium-mediated transient assays of gene expression in lettuce, tomato and Arabidopsis. Plant Biotechnol J 3: 259273 Yang YN, Li RG, Qi M (2000) In vivo analysis of plant promoters and transcription factors by agroinfiltration of tobacco leaves. Plant J 22: 543551[CrossRef][Web of Science][Medline] This article has been cited by other articles:
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ASPB Publications | PLANT PHYSIOLOGY® | THE PLANT CELL | |
|---|---|---|---|