Plant Physiol. Illumina
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


First published online January 11, 2006; 10.1104/pp.105.072173

Plant Physiology 140:693-703 (2006)
© 2006 American Society of Plant Biologists

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow All Versions of this Article:
140/2/693    most recent
pp.105.072173v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Web of Science (7)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhiponova, M. K.
Right arrow Articles by Szilák, L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhiponova, M. K.
Right arrow Articles by Szilák, L.
Agricola
Right arrow Articles by Zhiponova, M. K.
Right arrow Articles by Szilák, L.
SYSTEMS BIOLOGY, MOLECULAR BIOLOGY, AND GENE REGULATION

Mitosis-Specific Promoter of the Alfalfa Cyclin-Dependent Kinase Gene (Medsa;CDKB2;1) Is Activated by Wounding and Ethylene in a Non-Cell Division-Dependent Manner1,[W]

Miroslava K. Zhiponova2, Aladár Pettkó-Szandtner2, Éva Stelkovics, Zsuzsanna Neer, Sándor Bottka, Tibor Krenács, Dénes Dudits, Attila Fehér and László Szilák*

Institute of Plant Biology, Biological Research Center, Szeged H–6701, Hungary (M.K.Z., A.P.-S., Z.N., S.B., D.D., A.F.); Laboratory of Tumorpathology and Molecular Diagnostics, Institute for Biotechnology, Bay Zoltan Foundation for Applied Research, Szeged H–6726, Hungary (E.S.); 1st Institute of Pathology and Experimental Cancer Research, Semmelweis University of Medicine, Budapest H–1085, Hungary (T.K.); and Szilak Laboratories, Bioinformatics and Molecule-Design, Szeged H–6723, Hungary (L.S.)


    ABSTRACT
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 
Cyclin-dependent serine/threonine kinases (CDKs) have pivotal roles in regulating the eukaryotic cell cycle. Plants possess a unique class of CDKs (B-type CDKs) with preferential protein accumulation at G2/M-phases; however, their exact functions are still enigmatic. Here we describe the functional characterization of a 360-bp promoter region of the alfalfa (Medicago sativa) CDKB2;1 gene in transgenic plants and cell lines. It is shown that the activity of the analyzed promoter was characteristic for proliferating meristematic regions in planta and specific for cells in the G2/M-phases in synchronized cell cultures. Immunohistochemical analysis of transgenic root sections further confirmed the correlation of the expression of the CDKB2;1 promoter-linked reporter genes with the accumulation of the correspondent kinase. It was found that, in addition to auxin (2,4-dichlorophenoxyacetic acid) treatment, wounding could also induce both the reporter and endogenous genes in transgenic leaf explants. Furthermore, ethylene, known as a wound-response mediator, had a similar effect. The gene activation in response to wounding or ethephon was faster and occurred without the induction of cell cycle progression in contrast to the control auxin treatment. In silico analysis of this promoter indeed revealed the presence of a set of cis-elements, indicating not only cell cycle- but wound- and ethylene-dependent regulation of this CDK gene. Based on the presented data, we discuss the functional significance of the complex regulation of mitosis-specific CDK genes in plants.


In recent years, the general understanding of the cell proliferation and cell cycle control has increased considerably (Inzé, 2005Go). The phosphorylation cascade that moves the cell cycle on is understood quite well, but the regulation of cell cycle-dependent gene expression is still to be elucidated. In the eukaryotic cell cycle, there are two active phases, DNA synthesis (S-phase) and segregation of chromosomes (M-phase), preceded by the regulatory gap phases G1 and G2, respectively. G1/S and G2/M transitions are controlled by cyclin-dependent Ser/Thr kinases (CDKs), which are key regulators of the cell cycle. CDK activities are controlled by various mechanisms, including phosphorylation, dephosphorylation, and binding of regulatory cyclin subunits. Usually, the expression pattern of CDKs is constitutive throughout the cell cycle. Meanwhile, the periodic expression of cyclins provides the characteristic cell cycle phase-specific timing of CDK activities (Morgan, 1997Go). However, plants contain a unique class of CDKs (B-type CDKs [CDKBs]) with periodic gene expression and elevated protein accumulation at G2/M-phases (Fobert et al., 1996Go; Segers et al., 1996Go; Magyar et al., 1997Go; Umeda et al., 1999Go; Sorrell et al., 2001Go; Menges and Murray, 2002Go). The alfalfa (Medicago sativa) Cdc2MsD and Cdc2MsF (according to recent nomenclature, Medsa;CDKB1;1 and Medsa;CDKB2;1, respectively; Joubès et al., 2000Go) belong in this plant-specific CDK class (Magyar et al., 1997Go).

The transcriptional regulation of cell cycle phase-specific genes may involve several mechanisms based on multiple regulatory elements within the promoter regions of the genes. In the case of the mitotic B-type cyclin genes of Catharanthus roseus (Catro;CycB1;1/CYM promoter; Ito et al., 1998Go, 2001Go) and Nicotiana sylvestris (Nicsy;CycB1;1; Tréhin et al., 1997Go, 1999Go), cis-acting promoter elements were sufficient to ensure cell cycle-dependent expression in a heterologous promoter context. The most important cis-elements that are involved in the regulation of the timing of the B-type cyclin transcription are AGACCGTTG in the CYM promoter region, designated as the M-phase-specific activator sequence (MSA; Ito et al., 1998Go), and ACAAACGGTAA in the Nicsy;CycB1;1 promoter(Tréhin et al., 1999Go). Although the consensus sequence is highly similar between the two elements, different Myb transcription factors are supposed to bind them (Tréhin et al., 1999Go; Ito et al., 2001Go; Ito, 2005Go).

The regulation of G2-to-M-phase transition has special significance, considering plant development, because it is linked to the synthesis of the new cell wall and the possibility of endoreduplication. Endoreduplication involves repetitive chromosomal DNA replications without intervening mitosis or cytokinesis, leading to increased ploidy (Larkins et al., 2001Go; Boudolf et al., 2004bGo). The switch between mitotic chromosome segregation and endoreduplication programs is of major relevance in plant development, including cell size determination and endosperm formation (Grafi and Larkins, 1995Go). Controlling of endoreduplication thus represents an important agronomical challenge. Therefore, the understanding of the mechanisms governing S-G2-M-phase progression in plants is in the focus of cell cycle research.

Up to now, just a couple of cell cycle-dependent CDK promoters have been analyzed, to our knowledge, including the promoters of the genes coding for Arath;CDKA;1 (Hemerly et al., 1993Go; Chung and Parish, 1995Go) and Arath;CDKB1;1 (de Almeida Engler et al., 1999Go; Beeckman et al., 2001Go; Himanen et al., 2002Go; Boudolf et al., 2004aGo, 2004bGo; Barrôco et al., 2005Go). The work presented here is focused on isolation and functional characterization of a relatively short (360 bp) upstream region of the gene encoding for the G2/M-specific Medsa;CDKB2;1 kinase. It is shown that the RNA expression pattern of the reporter genes (beta-glucuronidase [GUS] and luciferase [luc]) regulated by a cloned 360-bp promoter fragment of the Medsa;CDKB2;1 gene was perfectly matched with the expression profile of the endogenous gene in synchronously dividing cultured cells. In silico analysis suggested some putative cell cycle-dependent regulatory elements, including MSA and E2Fb. In addition to the cell cycle-related elements, some others involved in the response for wounding and ethylene have been recognized in the promoter region.

An open wound caused by mechanical injury is a potential infection site for pathogens; thus, expression of defense genes at the wound site is necessary for the plants to build a barrier against opportunistic microorganisms. The inducible defense genes are regulated by several signal pathways involving jasmonic acid, salicylic acid, and ethylene (Ryals et al., 1996Go; Reymond and Farmer, 1998Go; Wang et al., 2002Go). Among them, the ethylene has the widest spectrum to regulate growth and developmental processes in plants (Abeles et al., 1992Go). It affects the cell division inhibiting the progression through the G2/M transition (Dan et al., 2003Go) in addition to the defense mechanism, which can be classified according to the response time: rapid and long-term answers. The timing, dynamics, and regulation of the expression of 150 genes in mechanically wounded leaves of Arabidopsis (Arabidopsis thaliana) were studied on cDNA microarray (Reymond et al., 2000Go). The long-term reaction involves the possibility of cell proliferation as a defense mechanism during vascular regeneration in the stem and the roots (Nishitani et al., 2002Go).

In this work, experimental evidence is shown that the promoter-driven reporter genes and the endogenous Medsa;CDKB2;1 kinase gene are expressed in highly proliferating regions, but are also activated in consequence of wounding and ethephon in a non-cell cycle-dependent manner.


    RESULTS
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 

Cloning of a 360-bp Length Upstream Region of Medsa;CDKB2;1

Cloning of genomic DNA fragments from tetraploid alfalfa (cv Regen S) upstream of the Medsa;CDKB2;1 coding sequence was carried out with the method of PCR-based genome walking (Siebert et al., 1995Go). The generated genomic DNA fragments were contiguous from the start codon, including the 5'-untranslated region and the approximately 300-bp putative promoter region. Several randomly selected colonies were picked up and analyzed because they contained a couple of deletions or insertions that could not be generated by PCR; therefore, they were divided into three different groups (fpr10, fpr13, and fpr15) according to their sequence similarity. The alignment representing these three groups and the recently published sequence of a corresponding genomic region of Medicago truncatula (AC144481) is shown in Figure 1. The longest (360 bp) cloned fragment, assigned as fpr15, was used for further investigation (GenBank accession no. DQ136188).


Figure 1
View larger version (85K):
[in this window]
[in a new window]
 
Figure 1. Alignment of cloned 5' upstream regions of Medsa;CDKB2;1 gene. Corresponding alfalfa genomic DNA fragments were classified (fpr10, fpr13, and fpr15) and aligned with the homologous M. truncatula (AC144481) genomic sequence. Putative promoter motifs are underlined and indicated: W-box (WRKY-binding site), WUN, E2FB (E2FB transcription factor recognizable element), CCAAT-box, ERE, MSA, TATA-box, P-box (gibberellin-responsive element), and TCA (wound-responsive element). Numbers indicate the distance (bp) from the transcription start (0), and the sense or antisense orientation is shown as (+) or (–), respectively.

 

In Silico Analysis of the Upstream Region of Medsa;CDKB2;1

The cis-elements of the Medsa;CDKB2;1 promoter region were analyzed by two different programs available online: the PLACE database (http://www.dna.affrc.go.jp/htdocs/PLACE/; Higo et al., 1999Go) and PlantCARE (http://intra.psb.ugent.be:8080/PlantCARE/; Lescot et al., 2002Go). The putative cis-elements found are indicated in Figure 1. The central element of the core-promoter with the putative TATA-box is located approximately –50 bp from the transcriptional start. The CAAT-box enhancer element is represented by five potential copies in the fpr15 sequence.

Based on the G2/M-specific expression of the Medsa;CDKB2;1 (Magyar et al., 1997Go), during the analysis special attention was paid to promoter elements that can have a role in the regulation of cell cycle phase specificity. In the fpr15 sequence, there is a compressed MSA-like motif, –89TCCGTTGCACAACGAT, in an almost perfect palindromic orientation. In addition, a putative E2Fb-binding site (–165TTTGCAGC) was also recognized in fpr15 (Fig. 1).

Comparison of the cloned upstream regions of Medsa;CDKB2;1 and the orthologous M. truncatula CDKB2;1 genes confirmed that most, probably all, of the cis-elements necessary to regulate the genes in a cell cycle-dependent manner are present on the relatively short fpr15 fragment (360 bp). The longer M. truncatula genomic sequence does not include other known essential cis-elements in addition to those present in the fpr15 fragment.

The in silico promoter analysis revealed several other potential regulatory elements in the fpr15 sequence that are unrelated to cell cycle regulation. Among these, light-responsive elements seem to dominate the promoter region with more than 10 different transcription factor-binding sites for light (data not shown). In addition, fpr15 contains wound-related elements, like ethylene-responsive element (ERE, –110ATTTGAAA), TCA-box (wound-responsive element, –24/–19/–13/+36TCATTT/C), WRKY-binding site (W-box, –181/–121/+16GATC/T), and five WUN motifs (AATTT). Interestingly, a gibberellin-responsive element (P-box, +8CCTTTTC) was found in the 5'-untranslated region.


The Promoters of B-Type CDKs Have a Defined Order of cis-Elements

The structures of three CDKB promoters were analyzed (Table I). The distances of the elements were calculated from the ATG start codon. The absolute positions of some cis-elements in the promoters of CDKB2;1 genes of alfalfa and Arabidopsis are almost identical, so the arrangement of the E2Fb, WUN, ERE, MSA, TATA, and TCA motifs seems to be fixed. The location of the putative hormonal response elements like gibberellin (P-box) can vary within the entire promoter sequence, but they are definitely part of it. The promoters of the orthologous CDKB2;1 genes share the same basic structure, whereas the Arath;CDKB1;1 gene promoter possesses similar elements found in a different order. In addition, a putative abscisic acid-responsive element (ABRE) is present in the Arabidopsis CDKB promoters, but it was not recognized in alfalfa or M. truncatula.


View this table:
[in this window]
[in a new window]
 
Table I. Locations of the putative regulatory element motifs in the promoter regions of alfalfa and Arabidopsis CDKB genes

The promoter regions of Medsa;CDKB2;1, Arath;CDKB2;1, and Arath;CDKB1;1 were analyzed for ABRE, E2F transcription factor recognizable element (E2F), WUN, ERE, MSA, core promoter element (TATA-box), gibberellin-responsive element (P-box), and wound-responsive element (TCA).

 

Histochemical Analysis of the Reporter Gene Activity Driven by the Medsa;CDKB2;1 Promoter

Transgenic approach was chosen for the in planta characterization of the fpr15 promoter activity. Therefore, transgenic alfalfa and Arabidopsis plants were generated with the plasmid constructs using the fpr15 promoter fragment linked to the GUS (fpr15:GUS) or luc (fpr15:luc) reporter genes. Several independent transgenic lines were tested by PCR and selected for the analysis of the reporter activities.

Transgenic fpr15:luc calli with high cell division activity exhibited a strong signal after addition of luciferin substrate (Fig. 2A). Different organs of fpr15:GUS-transformed alfalfa plants were stained for GUS activity to monitor promoter function (Fig. 2, B–H). GUS expression was preferentially localized to meristematic regions, including the shoot apex (Fig. 2B). In young leaves (Fig. 2C), strong GUS expression was characteristic for the junction between the leaf and petiole, and moderate staining was detected in the region of developing vascular tissues as well. No expression was detected in mature leaves. Figure 2D shows the fpr15-regulated GUS expression at different stages of lateral root development. The staining was strongest in the central cylinder (stele) of the main root, as well as in the pericycle-derived lateral root meristem. In ultrathin cross sections of the root, GUS expression was visible only in the stele and in emerging lateral root meristem but not in the epidermal and cortical layers (Fig. 2E). The fpr15 activity was also detected in flowers. Weak blue staining was characteristic for flower buds (Fig. 2F) but not for open flowers. Anthers showed a patchy distribution of fpr15 activity during microsporogenesis (Fig. 2G). GUS activity was also detected in seed primordia (Fig. 2H).


Figure 2
View larger version (120K):
[in this window]
[in a new window]
 
Figure 2. In planta characterization of the activity of the Medsa;CDKB2;1 promoter. A, In vivo luc assay was carried out on transgenic alfalfa (fpr15:luc) calli. Normal light image (on the left) and luminescent light image produced after luciferin treatment (on the right) are shown. Red arrowheads point to the not transformed control calli treated with luciferin. B to H, Histochemical localization of GUS activity (blue) is shown in fpr15:GUS alfalfa plants: shoot apex (B), young leaf (C), lateral roots in different stages (D), root cross section with lateral root meristem (E), flower buds (F), young anthers (G), and seed primordia (H). Medsa;CDKB2;1 kinase and fpr15-driven luc reporter gene products were detected immunohistochemically on consecutive sections (I and J) with Medsa;CDKB2;1 and luc antibodies, respectively, displaying similar pattern of brown spots (highlighted with red arrowheads). LRM, Lateral root meristem; EP, epidermis; CX, cortex; S, stele.

 
To compare the accumulation of the endogenous CDKB2;1 protein and of fpr15-controlled luc reporter in roots, ultrathin cross sections were generated from young roots of fpr15:luc transgenic alfalfa distantly from the root tip in the maturation zone. Single-labeling immunohistochemistry was performed on consecutive sections with antibodies against Medsa;CDKB2;1 and luc, respectively. In both cases, immunopositivity showed similar patterns inside the stele (Fig. 2, I and J).

The isolated Medsa;CDKB2;1 promoter fragment was also tested in a plant species other than Leguminosae. For this reason, the construct fpr15:GUS was introduced into Arabidopsis plants. Similarly to alfalfa, actively proliferating regions of different organs (shoot apical meristem, expanding leaves, and root apical meristem) of these transformed plants showed GUS signals (Supplemental Fig. 1).


The 360-bp Promoter of CDKB2;1 Is Sufficient to Restrict the Expression of the Reporters to the G2/M Cell Cycle Phase

The histochemical analysis showed that the cloned promoter could provide cell division-dependent expression for the reporter genes, but the correct timing of the promoter activity (i.e. the cycle specificity) remained to be confirmed. The regulation of gene expression was characterized by comparisons between the expression pattern of the endogenous CDKB2;1 and fpr15-driven reporter genes in synchronized cell suspension cultures generated from the proper transgenic plants. Figure 3 shows the results obtained by the synchronization of the cell suspension culture expressing the fpr15:luc construct. Cell cycle progression was synchronized by the S-phase inhibitor hydroxyurea (HU). After releasing the block, samples were taken at 3-h intervals for flow-cytometric analysis and mitotic index determination (Fig. 3A), as well as for RNA isolation. The transcript levels of the genes of interest were compared by northern hybridization-blot assay (Fig. 3B). Transcript levels of Medsa;CDKA;1, a cell cycle-related kinase with constitutive expression during the cell cycle (Hirt et al., 1993Go; Magyar et al., 1997Go), were used as an indicator for the amounts of loaded RNAs. Accumulation of CDKB2;1 transcripts was detected in samples from 12 to 21 h, which correspond to the G2/M-phases (Fig. 3). The level of the fpr15-driven luc gene also exhibited a G2/M-phase-specific expression pattern in good accordance with that of CDKB2;1. This experiment with the synchronized cell culture clearly confirmed that the studied 360-bp DNA sequence element is sufficient for the cell cycle-regulated, G2/M-specific promoter function.


Figure 3
View larger version (66K):
[in this window]
[in a new window]
 
Figure 3. Expression analysis of fpr15:luc and Medsa;CDKB2;1 in a synchronously dividing alfalfa cell culture. Transcript level of Medsa;CDKB2;1, luc, and Medsa;CDKA;1 genes were monitored in an HU-synchronized cell culture initiated from fpr15:luc transgenic alfalfa plants. Samples were taken every 3 h after the release from HU block. BW, Before removing HU; AW, after removing HU. A, Frequency of cells in various cell cycle phases (G1, S, G2, mitosis) was determined by flow cytometry and by counting the mitotic index. B, Total RNA (bottom section) was hybridized with the [32P]-labeled specific DNA probes: CDKB2;1 kinase, luc, and CDKA;1 kinase genes, respectively. The CDKB2;1 promoter regulated genes accumulated in the interval of 12 to 21 h; in contrast, the CDKA;1 expression was constitutive throughout the entire cell cycle.

 

Activation of Medsa;CDKB2;1 by Wounding and Hormones

The wound response of the CDKB2;1 promoter, assumed on the basis of the in silico promoter analysis (see above), was tested on leaf explants. Mature leaves from alfalfa plants grown in greenhouse were detached, wounded by cuttings, and then immediately placed onto solid medium. Similarly, the hormonal response of the CDKB2;1 gene was analyzed by exposing nonwounded leaves to jasmonic acid, salicylic acid, or ethephon (an ethylene precursor), and 2,4-dichlorophenoxyacetic acid (2,4-D), known to induce cell proliferation (Hemerly et al., 1993Go). Samples were taken at different time points (0.5, 1, 3, and 4 d), the expressions of the reporter genes were followed in transgenic plants, and the endogenous CDKB2;1 kinase was monitored in nontransgenic plants by western-blot analysis (Fig. 4, A, C, and D). In the case of wounding, increasing GUS activity was observed from 1 d onward (Fig. 4A), and the accumulation of the endogenous CDKB2;1 protein was changed synchronously with the GUS expression pattern (Fig. 4A). The GUS activity spread symmetrically in the equatorial mesophyll cells of the leaves from the site of the injury (Fig. 4B). GUS expression was hardly seen in the epidermis.


Figure 4
View larger version (74K):
[in this window]
[in a new window]
 
Figure 4. Induction of the Medsa;CDKB2;1 promoter by wounding (A and B), ethephon (C), and 2,4-D (D). Detached leaves were cultivated on B5II solid medium for 0.5, 1, 3, and 4 d following the indicated treatments. A, GUS expression appeared (blue) adjacent to the injury marked with red arrows after GUS assay in fpr15:GUS plant. Western blot confirmed the endogenous CDKB2;1 kinase accumulation in nontransgenic leaves after wounding. B, Cross section of wounded leaf after 4 d of cultivation demonstrates that GUS expression spread farther from the edge of the wound in the equatorial plane of the leaf. Arrowheads show the wounding sites. C, fpr15:luc leaves were placed on solid BII5 medium supplemented with 10 mg/L ethephon, and the luc assay-generated luminescent light was detected at given time points. In parallel experiments, immunoblot assays were executed with anti-Medsa;CDKB2;1 on protein isolated from ethephon-treated, nontransgenic alfalfa leaves, which revealed an increasing amount of CDKB2;1 kinase with elapsed time. D, fpr15:GUS leaves were incubated on BII5 medium, in the presence of 1 mg/L 2,4-D. The accumulation of the endogenous CDKB2;1 protein from the third day in nontransgenic leaves is shown by western blot. E, Cell cycle activity in wounded or hormone-treated leaves of alfalfa was characterized by flow-cytometric analysis after 0.5, 1, 3, and 4 d. The wounded or ethephon-treated samples had no change in relative DNA contents of cells, while 2,4-D-treated leaves exhibited an increased frequency of cells in the S and G2 cell cycle phases. Histograms represent average of three independent measurements. F, fpr15:luc leaves were wounded or 2,4-D treated, and placed onto solid BII5 medium in the presence or absence of HU. On the left side the leaves are shown in normal light, and on the right side the emitted luminescent light was captured upon luc assay carried out on the third day. In the absence of HU, the isolated promoter is active in the wounded or in the 2,4-D-treated leaves. In the presence of HU, the fpr15 remained active only in the case of wounding but was silent in the 2,4-D-treated leaves, indicating that the wound inducibility of the promoter is independent from the cell cycle.

 
The inducible defense genes can be regulated mostly via jasmonic acid-, salicylic acid-, and ethylene-related signal pathways (Reymond and Farmer, 1998Go; Wang et al., 2002Go). Therefore, we tested these possible activating hormones, if they could turn the CDKB2;1 promoter on in detached leaves. The jasmonic acid had no effect at all, and the salicylic acid could hardly activate the promoter (data not shown); however, the effect of ethephon, which was assumed by the in silico analysis, was more pronounced (Fig. 4C). Luc activity was measured and quantified in detached leaves treated with ethephon (Fig. 4C). The emitted light was significant from the first day and became stronger by time. The level of the endogenous CDKB2;1 protein was determined by western blot in ethephon-treated leaf explants from nontransgenic greenhouse plants (Fig. 4C). The CDKB2;1 protein was detectable 1 d after the treatment and showed a similar accumulation pattern as in the case of wounded leaves.

These experiments were performed in parallel with 2,4-D-treated leaf explants (Fig. 4D). The GUS activity staining of the leaf explants showed that the CDKB2;1 promoter is activated after 3 d (Fig. 4D). Western-blot assay on 2,4-D-treated nontransgenic leaves confirmed this result; the CDKB2;1 kinase appeared on the third day, but its level became highly elevated from the fourth day (Fig. 4D).

For the analysis of the effects of wounding and hormone treatments on activation of cell cycle, nuclei were isolated for flow cytometry. Figure 4E shows that there was no change in the DNA content of the wounded or ethephon-treated leaf cells during the examined period similarly to the negative control (not wounded leaves cultivated on hormone-free medium). However, in the 2,4-D-treated leaf explants, increased frequency of S- and G2-phase cells indicated that cell cycle was activated after 3 d of treatment. After 10 d, the 2,4-D-treated leaf explants indeed started to produce calli (Fig. 2A).

Taken together, these data suggested that the expression of CDKB2;1 can be controlled, not only in relation to the cell cycle but also independently of it, by wounding. To further confirm this phenomenon, wounded or 2,4-D-treated leaves of fpr15:luc transgenic plants were placed onto HU-containing or control media for 3 d. HU, an inhibitor of S-phase progression, was expected to block only the 2,4-D-induced, cell cycle-dependent, but not the wound-induced, cell cycle-independent, expression of the fpr15-driven reporter. Figure 4F shows the luciferin-treated leaves after the 3-d treatment. The luc gene was switched on in wounded as well as in 2,4-D-treated leaves incubated in the absence of HU. The presence of HU, however, selectively blocked the luc expression in 2,4-D-treated leaves but did not affect the wound-induced expression of the reporter, which indicated that it is indeed independent of cell division.

Other hormones, such as kinetin, abscisic acid, and gibberellin, did not show any significant influence on the activity of CDKB2;1 promoter in leaf explants (data not shown).

Because of the lack of any indication of cell proliferation in the wounded and ethephon-treated leaves, we could conclude that there must be an independent regulation of the Medsa;CDKB2;1 gene for wounding and cell division, and the mitosis-inhibitor ethylene could be a putative mediator of the wound response.


    DISCUSSION
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 
In the eukaryotic cell cycle, the active phases (DNA synthesis [S-phase] and chromosome segregation [M-phase]) are separated by two regulatory gap phases, G1 and G2. The cell cycle phase boundaries, controlled by a family of CDKs, serve as key checkpoints in the progression of the cell cycle (Stals and Inzé, 2001Go; Vandepoele et al., 2002Go; De Veylder et al., 2003Go; Dewitte and Murray, 2003Go; Inzé, 2005Go). It has been shown that in plants, as in other eukaryotes, the transition from G1- to S-phase, which is triggered by A-type CDKs (Mironov et al., 1999Go; Boniotti and Gutiérrez, 2001Go; Nakagami et al., 2002Go), is mediated by the activated E2F/DP transcription factors (Harbour and Dean, 2000Go; Müller et al., 2001Go). The regulation of the mitotic entry (from G2 to M) is unique in plants, as it is governed by a specific class of CDKs (designated as plant CDKBs) with cell cycle-dependent expression (Fobert et al., 1996Go; Segers et al., 1996Go; Magyar et al., 1997Go; Umeda et al., 1999Go; Mészáros et al., 2000Go; Sorrell et al., 2001Go; Menges and Murray, 2002Go). Understanding the regulation of G2/M transition is exceptionally important in plants because at this point cell cycle progression can diverge toward mitosis or endoreduplication.

To study the transcriptional regulation of plant genes coding for CDKBs, a 360-bp promoter fragment (fpr15) of alfalfa CDKB2;1 was cloned and linked to GUS (fpr15:GUS) or luc (fpr15:luc) reporter genes and characterized in both transgenic alfalfa and Arabidopsis plants to unravel the propensity of the promoter.


360-bp-Long Promoter Is Sufficient to Ensure Cell Division-Dependent and Cell Cycle Phase-Specific Expression of Reporter Genes

Transgenic plants and cultured cell suspensions carrying the reporter gene constructs produced similar expression patterns of the fpr15-driven reporters to the endogenous Medsa;CDKB2;1 kinase. The GUS/luc activity was restricted to the actively dividing regions of intact plants (root and shoot meristems, petiole-to-leaf junctions, etc.) where the accumulation of the CDKB2;1 kinase can be expected (Fig. 2; Supplemental Fig. 1). The observed in planta Medsa;CDKB2;1 expression pattern is characteristic for the proliferating region, as shown in the case of the in situ hybridization of the CDKB1;1 (Fobert et al., 1996Go; Segers et al., 1996Go) and CDKB2;1 (Fobert et al., 1996Go; Kono et al., 2003Go) genes also coding for CDKB proteins in other species.

We demonstrated with synchronized cell cultures that the 360-bp-long promoter is sufficient to restrict gene expression activity to the G2/M cell cycle phases. It was found that the transcript levels of the reporter gene and the endogenous Medsa;CDKB2;1 changed simultaneously with a maximum level during the G2/M-phases, verified by flow-cytometric analysis and by determination of the mitotic index. This observation was confirmed by reverse transcription-PCR experiments, as well, on independent transgenic lines (data not shown). It can be concluded therefore that the cloned 360-bp-long upstream region of the Medsa;CDKB2;1 gene has promoter activity that is characteristic for the proliferating cells with G2/M cell cycle phase specificity.

Immunohistochemical approach was chosen to show that the fpr15-driven reporter activity was localized into the same area as the Medsa;CDKB2;1 protein in roots. Consecutive cross sections made in the maturation zone of young roots were reacted with antibodies against Medsa;CDKB2;1 and luc, respectively, revealing very similar immunolocalization patterns in a small group of cells (Fig. 2, I and J). Further investigations are needed to determine the biological significance of this specific expression pattern.

Taken together, the expression pattern of fpr15-driven reporter genes was in good correlation with that of the endogenous Medsa;CDKB2;1 gene.


In Silico Analysis of the Medsa;CDKB2;1 Promoter Revealed a Characteristic Structure of Similar Promoters

The regulation of G2/M-phase-specific genes may be altered in animal and plant cells. In plants, cell cycle-specific transcription factors of the Myb family were identified to enhance the promoter activity of these types of genes (Tréhin et al., 1999Go; Ito et al., 2001Go; Ito, 2005Go). It should be mentioned that in the cases where the MSA or MSA-like sequences were found to be regulating cell cycle specificity, at least three MSA repeats were required (Ito et al., 1998Go; Tréhin et al., 1999Go). The online promoter-analyzing search engines could recognize only one compressed palindromic MSA-like site (TCCGTTGCACAACGAT) in the fpr15; thus, we can assume that it might not be sufficient to provide cell cycle specificity alone.

The in silico analysis also revealed a putative E2Fb-binding site in the fpr15 sequence. More and more evidence supports the involvement of E2F transcription factors in the G2/M-phase progression in addition to their basic role in the regulation of G1/S-phase-specific genes (Ishida et al., 2001Go; Ren et al., 2002Go; Boudolf et al., 2004bGo; Magyar et al., 2005Go).

In the cell cycle-specific regulation of human cdc2 and cyclin B1 genes, Myb, E2F, CCAAT-, and cell cycle homology region-binding factors together coordinate the proper timing of expression (Zhu et al., 2004Go). These factors may define a special promoter organization, where the order and distance of their binding sites are also important. We found almost all of the key gene regulatory elements in the fpr15 sequence (targeted by E2F, CCAAT, and Myb factors), which were important in the regulation of G2/M-specific expression in human cells. Furthermore, the alignment of the promoters of Arath;CDKB2;1, and Medsa;CDKB2;1 showed an almost identical arrangement of the E2Fb, WUN, ERE, MSA, TATA, and TCA motifs without any significant overall nucleotide sequence similarity. In the Arath;CDKB1;1 gene promoter, the same elements could be found only with a slight variation in their order.


Medsa;CDKB2;1 Is Responsive to Wounding and Hormones

According to the response speed of the tissues for mechanical injury, the wound answer can be classified to short and long term. The short-term answer starts by minutes after wounding, and the long-term response has effect after 12 h or even later as a consequence of mechanical injury (Reymond et al., 2000Go; Nishitani et al., 2002Go; Delessert et al., 2004Go). In plants, members of several transcription factor families have been implicated in the regulation of defense-related genes, including Myb, TCA-binding, and WRKY transcription factors and ERE-binding protein (Rushton and Somssich, 1998Go; Eulgem, 2005Go). The mechanical injury on leaf explants of fpr15:GUS transgenic plants clearly induced GUS expression that was localized to juxtaposed regions of the injury and slowly spread in the equatorial plane of the leaf cross section. GUS activity was increased by time from 24 h onward, indicating a long-term response. Based on the similar pattern of accumulation of the endogenous Medsa;CDKB2;1 protein in the wounded leaves, it can be assumed that the examined CDKB indeed participates in the long-term wound response.

Although the fpr15 activity was induced by the mechanical injury, proliferating cells could not be detected in the wounded leaves by flow cytometry. This means that the wounding could induce the activity of the promoter via a cell proliferation independent pathway. This observation was confirmed by the fact that HU treatment on wounded leaves did not inhibit the isolated promoter activity. In contrast, the accumulation of the CDKB2;1 kinase in the presence of 2,4-D was likely a consequence of the entry to the cell cycle; it started only at the time when the cells already entered into the cell division cycle, which happened later (from the third day) in comparison to the wound response (from the first day), and the promoter activity could be blocked with HU (Fig. 4F).

It was indeed shown that the cell cycle-related A-type Arabidopsis CDK kinase expressed constitutively during the cycle could also be induced by wounding without cell division. The authors concluded that the expression of this gene by wounding was a consequence of an increased competence for cell proliferation (Hemerly et al., 1993Go), which we could not confirm in the case of Medsa;CDKB2;1. However, wound inducibility in a non-cell cycle-dependent manner seems to be a common feature of the plant CDK kinases, which is most probably manifested via their special promoter. Indeed, in silico analysis showed that the promoters of the alfalfa and Arabidopsis CDKB genes contain similar wound-related regulatory elements.

The wound response can be activated by various pathways involving jasmonic acid, salicylic acid, and ethylene (Creelman and Mullet, 1997Go; Durner et al., 1997Go; Reymond and Farmer, 1998Go; Wang et al., 2002Go). We tested these inducible defense signal pathways that can affect the promoter activity. Jasmonic acid had no significant effect, the salicylic acid could activate weakly the GUS expression (data not shown), while ethephon could turn on the promoter in a similar manner as the mechanical injury could. These data supported the in silico analysis, which predicted putative EREs in the fpr15 sequence.

The fact that the ethephon has positive effect for the regulation of the CDKB2;1 kinase is intriguing. The ethylene, which is a very promiscuous hormone (Zhong and Burns, 2003Go), was considered to inhibit the progression of G2/M-phase. It promotes the DNA synthesis but retains the cells before the mitosis, opening a path toward endoreduplication in cucumber (Cucumis sativus) hypocotyl epidermis. However, the removal of ethylene potentates the cells for further division (Dan et al., 2003Go; Kazama et al., 2004Go).

The accumulation of Medsa;CDKB2;1 kinase due to G2/M progression or by ethephon treatment considered as a G2/M-phase inhibitor emphasizes the multifunctional role of this kinase. To reach the full kinase activity, the CDK kinases need their cyclin partners. Indeed, the ethylene treatment could also stimulate mitotic cyclin expressions in rice (Oryza sativa) stem cuttings (Lorbiecke and Sauter, 1999Go). However, the exact role of the Medsa;CDKB2;1 kinase remains enigmatic.

Although our knowledge is continuously increasing on the regulation of the core cell cycle machinery, we hardly know molecular mechanisms that link the cell cycle to external and developmental signals. If cell cycle-related proteins are involved in processes unrelated to cell division, as indicated by the presented observations, there are additional levels of complexity to be unraveled by further experimentation.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 

Cloning of the Promoter of Medsa;CDKB2;1

Genomic DNA fragments, upstream of CDKB2;1, were isolated from tetraploid alfalfa (Medicago sativa L. cv Regen S) with the GenomWalker kit (BD Biosciences, CLONTECH). The fpr15 fragment was cloned into pCambia3301 as a replacement of the cauliflower mosaic virus 35S promoter region (fpr15pC3301 or fpr15:GUS). In the fpr15pC3301 construct, the GUS reporter was replaced with the luc gene, resulting in fpr15pC3305 (fpr15:luc) plasmid. The resulting plasmids were introduced into Agrobacterium tumefaciens (LBA4404).


Plant Transformation of Alfalfa and Arabidopsis

Agrobacterium-mediated transformation of alfalfa leaf discs was performed according to Barbulova et al. (2002b)Go. Transformed regenerants were generated via indirect somatic embryogenesis on selective (4 mg/L phosphinotrycin [PPT]) modified B5 (B5II) solid medium (Iantcheva et al., 2001Go) supplemented with 1 mg/L 2,4-D and 0.2 mg/L kinetin. Embryogenic calli were regenerated into plants on basic Murashige and Skoog medium in the presence of PPT (Barbulova et al., 2002aGo).

A. tumefaciens-transformed Arabidopsis (Arabidopsis thaliana, Columbia-0) lines were generated by in planta transformation using vacuum infiltration (Bechtold and Pelletier, 1998Go). Seeds from infiltrated plants were germinated on selective (4 mg/L PPT) 0.5x Murashige and Skoog basic medium.


GUS Assay: Plant Staining, Sections, and Immunohistochemistry

GUS staining was carried out by the method described by Jefferson et al. (1987)Go. Images of GUS-stained plants were taken with a Leica MZFL III microscope and Leica DC 300F camera (Leica Microsystems). For sectioning, GUS-stained plants were fixed in 4% formaldehyde at 4°C overnight and embedded in glycol methacrylate resin (Technovit 7100) according to the manufacturer's instructions. Five-micrometer sections were generated using a glass knife. Nomarski images were taken with an Axioscop2 MOT microscope and an AxioCam HR camera (Zeiss).

For immunohistochemistry, glycol methacrylate sections (5 µm) were subjected to wet heat-induced antigen retrieval in citrate buffer (pH 2.5; Krenacs et al., 1999Go). Rabbit primary antibodies (1:500 diluted anti-luc [Sigma] and 1:1,000 diluted anti-Medsa;CDKB2;1 [Magyar et al., 1997Go]) were applied on separate sections (60 min, room temperature). For visualization of immunoreactions, goat anti-rabbit secondary antibodies conjugated with horseradish peroxidase and diaminobenzidine substrate (EnVision, Dako Cytomation) were used.


Luc Activity

The activity of the luc enzyme was detected after addition of 1 or 2 mM luciferin substrate (Biosynth). Light excitation was detected with a CCD camera system (Visilux Imager, Visitron Systems GmbH). Bioluminescence images were processed using the Metaview 4.5r6 software (Universal Imaging Corporation).


Synchronized Cell Culture

Two-week-old callus tissue from transformed alfalfa plants was used for the generation of cell suspensions according to Bögre et al. (1988)Go in the presence of 1 mg/L 2,4-D and 0.5 mg/L kinetin in B5II liquid medium containing the selective agent PPT. The cell suspensions were subcultured once a week.

Synchronization of the cell division in exponentially growing cell suspension cultures by 10 mM HU (Sigma) was done according to Ayaydin et al. (2000)Go. Samples for flow-cytometric analysis, mitotic index, and RNA isolation were collected and analyzed as described earlier (Ayaydin et al., 2000Go).


RNA Isolation and Northern Assay

Total RNA was isolated using TRIzol reagent (GIBCO) according to the manufacturer's instructions. Twenty micrograms of total RNA were loaded into denaturing agarose gels for northern hybridization that was carried out according to standard procedures (Sambrook et al., 1989Go). Hybridization of the filters was performed in Church-Gilbert solution (1 mM EDTA, 0.25 M NaHPO4, 7% SDS) at 65°C. Radiolabeled probes were synthesized by random priming (Megaprime DNA labeling systems; Amersham). The used PCR primer sequences for probe generation were as follows: for Medsa;CDKB2;1, forward (f) CTTCATGAAGATGATGAA and reverse (r) CTAAAGATGGGTCTTGTCCA; for Medsa;CDKA;1, (f) CGGGTACACCGAATGAGGAA and (r) GGCTGATTTAAAATCAGGCAATG; and for luc, (f) AACGGATTACCAGGGATTTCAG and (r) 5'-AGACTTCAGGCGGTCAACGA. Images were taken by Phosphor Imager 445 SI (Molecular Dynamics) and analyzed by the Image Quant NT 5.0 software.


Wounding and Hormonal Treatment of Leaf Explants, and Western Blotting

Mature leaves from greenhouse plants were detached, sterilized, wounded randomly by cutting with a blade, and cultivated on solid B5II medium with or without 2,4-D (1 mg/L or 4,5 µM) or ethephon (10 mg/L or 0.7 µM) hormones (stated, where applied). Samples were taken on 0.5, 1, 3, and 4 d after the treatment. For western blotting, samples from nontransgenic alfalfa plants were used and processed according to Magyar et al. (1997)Go. The reaction was visualized using Super Signal West Pico chemiluminescent substrate (PIERCE).

Sequence data from this article can be found in the GenBank/EMBL data libraries under the following accession numbers: DQ136188, promoter region of Medsa;CDKB2;1 (fpr15); X97317, Medsa;CDKB2;1; M58365, Medsa;CDKA;1; AC144481 bacterial artificial chromosome clone containing the 5' promoter region of Medicago truncatula CDKB2;1; D10851 (At3g54180), Arath;CDKB1;1; and AJ297936 (At1g76540), Arath;CDKB2;1.


    ACKNOWLEDGMENTS
 
We are grateful for the useful scientific advice and help of Ariana Perhald, Krisztina Otvös, and Manuela Jurka. We also thank Katalin Török and Róza Nagy for excellent technical assistance.

Received September 30, 2005; returned for revision November 16, 2005; accepted December 11, 2005.


    FOOTNOTES
 
1 This work was supported by the Hungarian National Research Foundation (Országos Tudományos Kutatás: Alap, grant nos. T037910 and T042672); the Center of Excellence UNESCO, Richter Geodon Centenáriumi and Domus Hungarica Scientiarium et Artium, Hungarian Academy of Sciences and Ministry of Education (scholarships to M.K.Z.); and the János Bólyai research fellowship (to A.F.). Back

2 These authors contributed equally to the paper. Back

The author responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors (www.plantphysiol.org) is: László Szilák (laszlo.szilak{at}freemail.hu).

[W] The online version of this article contains Web-only data. Back

Article, publication date, and citation information can be found at www.plantphysiol.org/cgi/doi/10.1104/pp.105.072173.

* Corresponding author; e-mail laszlo.szilak{at}freemail.hu; fax 36–62–433434.


    LITERATURE CITED
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 
Abeles FB, Morgan PW, Saltveit ME (1992) Ethylene in Plant Biology, Ed 2. Academic Press, San Diego

Ayaydin F, Vissi E, Mészáros T, Miskolczi P, Kovács I, Fehér A, Dombrádi V, Erdödi F, Gergely P, Dudits D (2000) Inhibition of serine/threonine-specific protein phosphatases causes premature activation of cdc2MsF kinase at G2/M transition and early mitotic microtubule organisation in alfalfa. Plant J 23: 85–96[CrossRef][Web of Science][Medline]

Barbulova A, Iantcheva A, Zhiponova M, Vlahova M, Atanassov A (2002a) Establishment of embryogenic potential of economically important Bulgarian alfalfa cultivars (Medicago sativa L.). Biotechnol and Biotechnol Eq 16: 55–63

Barbulova A, Iantcheva A, Zhiponova M, Vlahova M, Atanassov A (2002b) Agrobacterium-mediated transformation for engineering of herbicide-resistance in alfalfa (Medicago sativa L.). Biotechnol and Biotechnol Eq 16: 21–27

Barrôco RM, Van Poucke K, Bergervoet JHW, De Veylder L, Groot SPC, Inzé D, Engler G (2005) The role of the cell cycle machinery in resumption of postembryonic development. Plant Physiol 137: 127–140[Abstract/Free Full Text]

Bechtold N, Pelletier G (1998) In planta Agrobacterium-mediated transformation of adult Arabidopsis thaliana plants by vacuum infiltration. Methods Mol Biol 82: 259–266[Medline]

Beeckman T, Burssens S, Inzé D (2001) The peri-cell-cycle in Arabidopsis. J Exp Bot 52: 403–411[Abstract/Free Full Text]

Bögre L, Oláh Z, Dudits D (1988) Ca2+-dependent protein kinase from alfalfa (Medicago varia): partial purification and auto-phosphorylation. Plant Sci 58: 135–144

Boniotti MB, Gutiérrez C (2001) A cell-cycle-regulated kinase activity phosphorylates plant retinoblastoma protein and contains, in Arabidopsis, a CDKA/cyclin D complex. Plant J 28: 341–350[CrossRef][Web of Science][Medline]

Boudolf V, Barrôco R, de Almeida Engler J, Verkest A, Beeckman T, Naudts M, Inzé D, De Veylder L (2004a) B1-type cyclin-dependent kinases are essential for the formation of stomatal complexes in Arabidopsis thaliana. Plant Cell 16: 945–955[Abstract/Free Full Text]

Boudolf V, Vlieghe K, Beemster G, Magyar Z, Acosta JAT, Maes S, Van Der Schueren E, Inzé D, De Veylder L (2004b) The plant-specific cyclin-dependent kinase CDKB1;1 and transcription factor E2Fa-DPa control the balance of mitotically dividing and endoreduplicating cells in Arabidopsis. Plant Cell 16: 2683–2692[Abstract/Free Full Text]

Chung SK, Parish RW (1995) Studies on the promoter of the Arabidopsis thaliana cdc2a gene. FEBS Lett 362: 215–219[CrossRef][Web of Science][Medline]

Creelman RA, Mullet JL (1997) Biosynthesis and action of jasmonates in plants. Annu Rev Plant Physiol Plant Mol Biol 48: 355–381[CrossRef][Web of Science][Medline]

Dan H, Imaseki H, Wasteneys GO, Kazama H (2003) Ethylene stimulates endoreduplication but inhibits cytokinesis in cucumber hypocotyl epidermis. Plant Physiol 133: 1726–1731[Abstract/Free Full Text]

de Almeida Engler J, De Vleesschauwer V, Burssens S, Celenza JL Jr, Inzé D, Van Montagu M, Engler G, Gheysen G (1999) Molecular markers and cell cycle inhibitors show the importance of cell cycle progression in nematode-induced galls and syncytia. Plant Cell 11: 793–807[Abstract/Free Full Text]

De Veylder L, Joubès J, Inzé D (2003) Plant cell cycle transitions. Curr Opin Plant Biol 6: 536–543[CrossRef][Web of Science][Medline]

Delessert C, Wilson IW, Van Der Straeten D, Dennis ES, Dolferus R (2004) Spatial and temporal analysis of the local response to wounding in Arabidopsis leaves. Plant Mol Biol 55: 165–181[CrossRef][Web of Science][Medline]

Dewitte W, Murray JAH (2003) The plant cell cycle. Annu Rev Plant Biol 54: 235–264[CrossRef][Medline]

Durner J, Shah J, Klessig DF (1997) Salicylic acid and disease resistance in plants. Trends Plant Sci 2: 266–274[CrossRef]

Eulgem T (2005) Regulation of the Arabidopsis defense transcriptome. Trends Plant Sci 10: 71–78[CrossRef][Web of Science][Medline]

Fobert PR, Gaudin V, Lunness P, Coen ES, Doonan JH (1996) Distinct classes of cdc2-related genes are differentially expressed during the cell division cycle in plants. Plant Cell 8: 1465–1476[Abstract]

Grafi G, Larkins BA (1995) Endoreduplication in maize endosperm: involvement of M-phase promoting factor inhibition and induction of S phase-related kinases. Science 269: 1262–1264[Abstract/Free Full Text]

Harbour JW, Dean DC (2000) The Rb/E2F pathway: expanding roles and emerging paradigms. Genes Dev 14: 2393–2409[Free Full Text]

Hemerly AS, Ferreira P, de Almeida Engler J, Van Montagu M, Engler G, Inzé D (1993) cdc2a expression in Arabidopsis is linked with competence for cell division. Plant Cell 5: 1711–1723[Abstract]

Higo K, Ugawa Y, Iwamoto M, Korenaga T (1999) Plant cis-acting regulatory DNA elements (PLACE) database. Nucleic Acids Res 27: 297–300[Abstract/Free Full Text]

Himanen K, Boucheron E, Vanneste S, de Almeida Engler J, Inzé D, Beeckman T (2002) Auxin-mediated cell cycle activation during early lateral root initiation. Plant Cell 14: 2339–2351[Abstract/Free Full Text]

Hirt H, Páy A, Bögre L, Meskiene I, Herberle-Bors E (1993) cdc2MsB, a cognate cdc2 gene from alfalfa, complements the G1/S but not the G2/M transition of budding yeast cdc28 mutants. Plant J 4: 61–69[CrossRef][Web of Science][Medline]

Iantcheva A, Vlahova M, Trinh TH, Brown SC, Slater A, Elliott MC, Atanassov A (2001) Assessment of polysomaty, embryo formation and regeneration in liquid media for various species of diploid annual Medicago. Plant Sci 160: 621–627[Medline]

Inzé D (2005) Green light for the cell cycle. EMBO J 24: 657–662[CrossRef][Web of Science][Medline]

Ishida S, Huang E, Zuzan H, Spang R, Leone G, West M, Nevins JR (2001) Role for E2F in control of both DNA replication and mitotic functions as revealed from DNA microarray analysis. Mol Cell Biol 21: 4684–4699[Abstract/Free Full Text]

Ito M (2005) Conservation and diversification of three-repeat Myb transcription factors in plants. J Plant Res 118: 61–69[CrossRef][Web of Science][Medline]

Ito M, Araki S, Matsunaga S, Itoh T, Nishihama R, Machida Y, Doonan J, Watanabe A (2001) G2/M-phase-specific transcription during the plant cell cycle is mediated by c-Myb-like transcription factors. Plant Cell 13: 1891–1905[Abstract/Free Full Text]

Ito M, Iwase M, Kodama H, Lavisse P, Komamine A, Nishihama R, Machida Y, Watanabe A (1998) A novel cis-acting element in promoters of plant B-type cyclin genes activates M phase-specific transcription. Plant Cell 10: 331–341[Abstract/Free Full Text]

Jefferson RA, Kavanagh TA, Bevan MW (1987) GUS fusions: beta-glucuronidase as a sensitive and versatile gene fusion marker in higher plants. EMBO J 6: 3901–3907[Web of Science][Medline]

Joubès J, Chevalier C, Dudits D, Herberle-Bors E, Inzé D, Umeda M, Renaudin J-P (2000) CDK-related protein kinases in plants. Plant Mol Biol 43: 607–620[CrossRef][Web of Science][Medline]

Kazama H, Dan H, Imaseki H, Wasteneys GO (2004) Transient exposure to ethylene stimulates cell division and alters the fate and polarity of hypocotyl epidermal cells. Plant Physiol 134: 1614–1623[Abstract/Free Full Text]

Kono A, Umeda-Hara C, Lee J, Ito M, Uchimiya H, Umeda M (2003) Arabidopsis D-type cyclin CYCD4;1 is a novel cyclin partner of B2-type cyclin-dependent kinase. Plant Physiol 132: 1315–1321[Abstract/Free Full Text]

Krenacs L, Krenacs T, Raffeld M (1999) Antigen retrieval for immunohistochemical reactions in routinely processed paraffin sections. In LC Javois, ed, Immunocytochemical Methods and Protocols, Ed 2, Vol 115. Humana Press, Totowa, NJ, pp 85–94

Larkins BA, Dilkes BP, Dante RA, Coelho CM, Woo Y, Liu Y (2001) Investigating the hows and whys of DNA endoreduplication. J Exp Bot 52: 183–192[Abstract/Free Full Text]

Lescot M, Déhais P, Thijs G, Marchal K, Moreau Y, Van de Peer Y, Rouzé P, Rombauts S (2002) PlantCARE, a database of plant cis-acting regulatory elements and a portal to tools for in silico analysis of promoter sequences. Nucleic Acids Res 30: 325–327[Abstract/Free Full Text]

Lorbiecke R, Sauter M (1999) Adventitious root growth and cell-cycle induction in deepwater rice. Plant Physiol 119: 21–29[Abstract/Free Full Text]

Magyar Z, De Veylder L, Atanassova A, Bakó L, Inzé D, Bögre L (2005) The role of the Arabidopsis E2FB transcription factor in regulating auxin-dependent cell division. Plant Cell 17: 2527–2541[Abstract/Free Full Text]

Magyar Z, Mészáros T, Miskolczi P, Deák M, Fehér A, Brown S, Kondorosi É, Athanasiadis A, Pongor S, Bilgin M, et al (1997) Cell cycle phase specificity of putative cyclin-dependent kinase variants in synchronized alfalfa cells. Plant Cell 9: 223–235[Medline]

Menges M, Murray JAH (2002) Synchronous Arabidopsis suspension cultures for analysis of cell-cycle gene activity. Plant J 30: 203–212[CrossRef][Web of Science][Medline]

Mészáros T, Miskolczi P, Ayaydin F, Pettkó-Szandtner A, Peres A, Magyar Z, Horváth GV, Bakó L, Fehér A, Dudits D (2000) Multiple cyclin-dependent kinase complexes and phosphatases control G2/M progression in alfalfa cells. Plant Mol Biol 43: 595–605[CrossRef][Web of Science][Medline]

Mironov V, De Veylder L, Van Montagu M, Inzé D (1999) Cyclin-dependent kinases and cell division in plants: the nexus. Plant Cell 11: 509–521[Free Full Text]

Morgan DO (1997) Cyclin-dependent kinases: engines, clocks, and microprocessors. Annu Rev Cell Dev Biol 13: 261–291[CrossRef][Web of Science][Medline]

Müller H, Bracken AP, Vernell R, Moroni MC, Christians F, Grassilli E, Prosperini E, Vigo E, Oliner JD, Helin K (2001) E2Fs regulate the expression of genes involved in differentiation, development, proliferation, and apoptosis. Genes Dev 15: 267–285[Abstract/Free Full Text]

Nakagami H, Kawamura K, Sugisaka K, Sekine M, Shinmyo A (2002) Phosphorylation of retinoblastoma-related protein by the cyclin D/cyclin-dependent kinase complex is activated at the G1/S-phase transition in tobacco. Plant Cell 14: 1847–1857[Abstract/Free Full Text]

Nishitani C, Demura T, Fukuda H (2002) Analysis of early processes in wound-induced vascular regeneration using TED3 and ZeHB3 as molecular markers. Plant Cell Physiol 43: 79–90[Abstract/Free Full Text]

Ren B, Cam H, Takahashi Y, Volkert T, Terragni J, Young RA, Dynlacht BD (2002) E2F integrates cell cycle progression with DNA repair, replication, and G2/M checkpoints. Genes Dev 16: 245–256[Abstract/Free Full Text]

Reymond P, Farmer EE (1998) Jasmonate and salicylate as global signals for defense gene expression. Curr Opin Plant Biol 1: 404–411[CrossRef][Web of Science][Medline]

Reymond P, Weber H, Damond M, Farmer EE (2000) Differential gene expression in response to mechanical wounding and insect feeding in Arabidopsis. Plant Cell 12: 707–719[Abstract/Free Full Text]

Rushton PJ, Somssich IE (1998) Transcriptional control of plant genes responsive to pathogens. Curr Opin Plant Biol 1: 311–315[CrossRef][Web of Science][Medline]

Ryals JA, Neuenschwander UH, Willits MG, Molina A, Steiner H-Y, Hunt MD (1996) Systemic acquired resistance. Plant Cell 8: 1809–1819[CrossRef][Web of Science][Medline]

Sambrook J, Fritsch EF, Maniatis T (1989) Molecular Cloning: A Laboratory Manual, Ed 2. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY

Segers G, Gadisseur I, Bergounioux C, de Almeida Engler J, Jacqmard A, Van Montagu M, Inzé D (1996) The Arabidopsis cyclin-dependent kinase gene cdc2bAt is preferentially expressed during S and G2 phases of the cell cycle. Plant J 10: 601–612[CrossRef][Web of Science][Medline]

Siebert PD, Chenchik A, Kellogg DE, Lukyanov KA, Lukyanov SA (1995) An improved PCR method for walking in uncloned genomic DNA. Nucleic Acids Res 23: 1087–1088[Free Full Text]

Sorrell DA, Menges M, Healy JMS, Deveaux Y, Amano C, Su Y, Nakagami H, Shinmyo A, Doonan JH, Sekine M, et al (2001) Cell cycle regulation of cyclin-dependent kinases in tobacco cultivar Bright Yellow-2 cells. Plant Physiol 126: 1214–1223[Abstract/Free Full Text]

Stals H, Inzé D (2001) When plant cells decide to divide. Trends Plant Sci 6: 359–364[CrossRef][Web of Science][Medline]

Tréhin C, Ahn I-O, Perennes C, Couteau F, Lalanne E, Bergounioux C (1997) Cloning of upstream sequences responsible for cell cycle regulation of the Nicotiana sylvestris CycB1;1 gene. Plant Mol Biol 35: 667–672[CrossRef][Medline]

Tréhin C, Glab N, Perennes C, Planchais S, Bergounioux B (1999) M phase-specific activation of the Nicotiana sylvestris cyclin B1 promoter involves multiple regulatory elements. Plant J 17: 263–273[CrossRef]

Umeda M, Umeda-Hara C, Yamaguchi M, Hashimoto J, Uchimiya H (1999) Differential expression of genes for cyclin-dependent protein kinases in rice plants. Plant Physiol 119: 31–40[Abstract/Free Full Text]

Vandepoele K, Raes J, De Veylder L, Rouzé P, Rombauts S, Inzé D (2002) Genome-wide analysis of core cell cycle genes in Arabidopsis. Plant Cell 14: 903–916[Abstract/Free Full Text]

Wang KL-C, Li H, Ecker JR (2002) Ethylene biosynthesis and signaling networks. Plant Cell (Suppl) 14: S131–S151

Zhong GV, Burns JK (2003) Profiling ethylene-regulated gene expression in Arabidopsis thaliana by microarray analysis. Plant Mol Biol 53: 117–131[CrossRef][Web of Science][Medline]

Zhu W, Giangrande PH, Nevins JR (2004) E2Fs link the control of G1/S and G2/M transcription. EMBO J 23: 4615–4626[CrossRef][Web of Science][Medline]




This article has been cited by other articles:


Home page
Plant Physiol.Home page
K. Kato, I. Galis, S. Suzuki, S. Araki, T. Demura, M.-C. Criqui, T. Potuschak, P. Genschik, H. Fukuda, K. Matsuoka, et al.
Preferential Up-Regulation of G2/M Phase-Specific Genes by Overexpression of the Hyperactive Form of NtmybA2 Lacking Its Negative Regulation Domain in Tobacco BY-2 Cells
Plant Physiology, April 1, 2009; 149(4): 1945 - 1957.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
S. C. Popescu, G. V. Popescu, S. Bachan, Z. Zhang, M. Seay, M. Gerstein, M. Snyder, and S. P. Dinesh-Kumar
Differential binding of calmodulin-related proteins to their targets revealed through high-density Arabidopsis protein microarrays
PNAS, March 13, 2007; 104(11): 4730 - 4735.
[Abstract] [Full Text] [PDF]


Home page
Plant Cell PhysiolHome page
S. Adachi, H. Uchimiya, and M. Umeda
Expression of B2-Type Cyclin-Dependent Kinase is Controlled by Protein Degradation in Arabidopsis thaliana
Plant Cell Physiol., December 1, 2006; 47(12): 1683 - 1686.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow All Versions of this Article:
140/2/693    most recent
pp.105.072173v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Web of Science (7)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhiponova, M. K.
Right arrow Articles by Szilák, L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhiponova, M. K.
Right arrow Articles by Szilák, L.
Agricola
Right arrow Articles by Zhiponova, M. K.
Right arrow Articles by Szilák, L.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
ASPB Publications PLANT PHYSIOLOGY® THE PLANT CELL
Copyright © 2006 by the American Society of Plant Biologists