|
|
||||||||
|
First published online January 11, 2006; 10.1104/pp.105.072678 Plant Physiology 140:726-733 (2006) © 2006 American Society of Plant Biologists OPEN ACCESS ARTICLE
Evidence for Functional Conservation, Sufficiency, and Proteolytic Processing of the CLAVATA3 CLE Domain1,[W],[OA]Department of Molecular, Cellular and Developmental Biology, University of Michigan, Ann Arbor, Michigan 481091048
Arabidopsis (Arabidopsis thaliana) CLAVATA3 (CLV3) is hypothesized to act as a ligand for the CLV1 receptor kinase in the regulation of stem cell specification at shoot and flower meristems. CLV3 is a secreted protein, with an amino-terminal signal sequence and a conserved C-terminal domain of 15 amino acids, termed the CLE (CLV3/ESR-related) domain, based on its similarity to a largely unstudied protein family broadly present in land plants. We have tested the function of 13 Arabidopsis CLEs in vivo and found a significant variability in the ability of CLEs to replace CLV3, ranging from complete to no complementation. The best rescuing CLE depends on CLV1 for function, while other CLEs act independently of CLV1. Domain-swap experiments indicate that differences in function can be traced to the CLE domain within these proteins. Indeed, when the CLE domain of CLV3 is placed downstream of an unrelated signal sequence, it is capable of fully replacing CLV3 function. Finally, we have detected proteolytic activity in extracts from cauliflower (Brassica oleracea) that process both CLV3 and CLE1 at their C termini. For CLV3, processing appears to occur at the absolutely conserved arginine-70 found at the beginning of the CLE domain. We propose that CLV3 and other CLEs are C-terminally processed to generate an active CLE peptide.
The CLAVATA loci (CLV1, CLV2, and CLV3) encode putative signaling components critical for stem cell specification and organogenesis in Arabidopsis (Arabidopsis thaliana). CLV1 encodes a Leu-rich repeat-containing receptor kinase (Clark et al., 1997
Little is known about the mechanism of CLV signaling. CLV1 and CLV2 are hypothesized to form a heterodimer that acts as the receptor for a CLV3-based ligand (Trotochaud et al., 1999
Resolving these issues is critical for several reasons. First, stem cell maintenance and differentiation are essential for plant development. Second, each member of the CLV pathway is a member of a large gene family: more than 400 receptor-like kinases, 60 receptor-like proteins, and 25 CLV3-related (CLE) proteins are found encoded within the Arabidopsis genome (Cock and McCormick, 2001 Here we report analysis of CLV3 and related CLE proteins in Arabidopsis. We show that many CLEs can replace CLV3 function in vivo, suggesting the importance of the conserved CLE domain common to this family of proteins. Using domain swaps, we provide evidence that the CLE domain of CLV3 alone is sufficient to replace CLV3 function in vivo. We show variability in whether the ability of CLEs in replacing CLV3 function is dependent on CLV1 or other receptor kinases. Finally, we characterize a proteolytic activity from plant extracts that is capable of C-terminal processing of both CLV3 and CLE1 in in vitro reactions. We propose that CLV3 is processed in vivo, releasing the active CLE peptide from a mature CLV3 precursor protein.
Cross-Complementation between CLE Family Members and CLV3
The Arabidopsis genome contains a large number of putative genes that encode proteins with similarity to CLV3 within the CLE domain (Cock and McCormick, 2001
To test the function of this vector, we first placed the CLV3 cDNA into the vector and transformed clv3-1 mutants. clv mutants lead to stem cell accumulation at the flower meristem, eventually giving rise to supernumary floral organs, especially carpels (Clark et al., 1993 Thirteen intronless CLE genes were amplified from Landsberg erecta (Ler) genomic DNA and cloned into the same binary vector containing CLV3 cis-regulating elements (Fig. 1A). Each PCLV3:CLE was transformed into clv3-1, and multiple independent transgenic lines were isolated and analyzed. The majority of CLEs tested were able to rescue the clv3-1 meristem defects to some degree (Fig. 2; Table I). CLE1 and CLE6 were nearly equivalent to CLV3 in terms of ability to rescue clv3-1 (Fig. 2). In descending order, CLE13, CLE19, CLE9, CLE22, CLE12, CLE21, and CLE11 provided only partial rescue of clv3-1, with the mean number of carpels per flower between 3.0 and 4.0 averaged over multiple independent lines. CLE8, CLE14, CLE25, and CLE26 provided little to no rescue of clv3-1. None of the CLEs showed clear evidence of dominant-negative effects.
The CLE Domain Alone Is Sufficient for CLV Signaling In comparing CLV3 and the CLEs, the sequences between the putative signal peptide and the CLE domain, termed the variable domain, are largely unrelated (Supplemental Fig. 1). The fact that a number of the CLEs were able to replace CLV3 function leads us to hypothesize that the CLE domain is the critical domain allowing for the function of these CLEs. To test this idea, we designed a domain-swap experiment to determine whether we could restore function to a nonfunctional CLE. The C-terminal domain from the nonfunctional CLE8 was replaced by the CLV3 C-terminal domain, and the chimeric reading frame was placed into the pCB302-CLE expression vector to generate PCLV3:E8C3. When transformed into clv3-1, this transgene provided nearly complete rescue in multiple independent lines (Fig. 3A), indicating that addition of the CLV3 CLE domain was capable of restoring function.
These results would suggest that the CLE domain is the function region of the protein; however, we could not rule out a role for the variable domain in providing the correct context for the CLE domain. To test whether the CLE variable domain was necessary for CLV3/CLE function, we replaced the signal sequence and variable domain of CLV3 with the first 66 amino acids, including the signal sequence, from the unrelated receptor kinase ERECTA (Torii et al., 1996
CLV1 is the proposed receptor for CLV3. All clv1 missense mutants are dominant-negative alleles, whereas clv1 null alleles, like clv1-11, display weak phenotypes (Diévart et al., 2003 To resolve this issue, we chose three CLEs with differing abilities to replace CLV3 function and tested their function in the absence of CLV1. When CLE1, which provides nearly complete rescue of clv3-1, was assessed in a clv3-1 clv1-11 background, we observed a major, but not complete, reversal of the rescue (Fig. 4). This suggests that CLE1 acts largely, although not exclusively, through CLV1. CLE11-driven rescue was significantly affected by the removal of CLV1 (t test, P < 0.01), but was affected to a lesser degree than CLE1. CLE22, which also provided only partial rescue of clv3-1, was not significantly affected by the removal of CLV1 (t test, P = 0.04), suggesting CLE22 primarily acted through other receptors (Fig. 4).
Proteolytic Processing of CLV3 and CLE1
Given the results presented here that the CLE domain of CLV3 is sufficient for function and recently published data on the ability of a peptide corresponding to the CLV3 CLE domain to alter development in roots (Fiers et al., 2005 We expressed mature CLV3 without the signal peptide as a glutathione S-transferase (GST)-tagged fusion protein in Escherichia coli (GST-mCLV3; Fig. 5A). We then incubated this with cauliflower (Brassica oleracea) protein extracts. We observed proteolytic processing of CLV3, revealing two smaller mass fragments, while GST alone was not processed (Fig. 5A). The smaller GST-mCLV3 forms were detected with anti-GST antibodies, suggesting C-terminal processing. His-tagged mature CLV3 was also processed at the carboxyl end upon incubation with cauliflower extracts (data not shown). Processing occurred in extracts generated in both the presence and absence of triton, suggesting that the processing activity is not membrane associated (Supplemental Fig. 2). No cross-reacting bands were detected in cauliflower extracts alone (Fig. 5A; Supplemental Fig. 2).
To test more rigorously whether processing was carboxy terminal, we repurified, using GST affinity, a large-scale reaction of GST-mCLV3 with cauliflower extracts. As shown in Figure 5B, the repurified proteins contained intact GST-mCLV3 (i), two processed forms (p1 and p2), and the background band observed as a contaminant in the GST-mCLV3 synthesis (b). Individual bands were subjected to in-gel trypsin digestion followed by time-of-flight (TOF)-mass spectrometry (MS) analysis. The amino-terminal MSPILGYWK fragment from GST was definitively identified among tryptic fragments of p1 and p2 (Supplemental Fig. 3). This indicates an intact GST N terminus in p1 and p2 and reveals that cleavage was C terminal. To determine the sites of proteolytic cleavage, our repurified processing mixture (Fig. 5B) was subjected to intact MS analysis (Supplemental Fig. 4). GST-mCLV3 and the two processed forms (but not the nonspecific band) were each represented among singly and doubly charged species as five peaks, presumably as a result of either modification in E. coli or by MS preparation (Supplemental Figs. 3 and 4). By averaging mass differences between corresponding peaks for each protein species, we estimate a mass difference of approximately 3,067 D between full-length GST-mCLV3 and the larger processed form (Fig. 5B, f1). This would place the cleavage for the f1-processed form at Arg-70, which is at the beginning of the CLE domain and is absolutely conserved among predicted CLE proteins (Fig. 6). Our peptide mass fingerprinting of the f1-processed form revealed that the tryptic fragment GLHEELR is present within f1, suggesting that the cleavage occurs to the carboxyl side of this residue (Supplemental Fig. 3).
For the smaller f2-processed form, average peak mass difference from full-length GST-mCLV3 was 6,296 D (Supplemental Fig. 4). This would place the cleavage at Met-41, among a stretch of four Met residues in the variable domain (Supplemental Fig. 1). To determine whether the cauliflower processing activity would use other CLEs as substrates, we generated GST-tagged mature CLE1 (GST-mCLE1) and repeated the assays. As for CLV3, we observed processing of GST-mCLE1 to two smaller mass forms (Fig. 5C). A time course indicated that the two processed forms arose simultaneously and they did not appear to be the result of sequential processing events (Fig. 5C). The Arg-70 residue that appears to be a site of proteolysis for CLV3 incubated with cauliflower extracts is absolutely conserved among predicted CLE proteins. To test the importance of this residue for in vitro proteolysis, we generated both Lys (R63K) and Asn (R63N) substitutions of the corresponding Arg-63 residue in CLE1. When incubated with extracts, we observed no obvious alteration in processing for these substituted forms, indicating that this residue is not absolutely essential for processing in vitro (Fig. 5D). To test the specificity of the processing reaction, we first used a control GST protein. No processing of GST could be detected after a 2-h incubation (Fig. 5A). We also examined the stability of the proteins from the cauliflower extracts in a mock processing reaction. The extracts generated in both the presence and absence of triton showed no apparent general proteolysis or loss of specific proteins, indicating that the extracts do not contain significant amounts of general protease activity (Fig. 5E).
The Role of the CLE Domain
We have characterized the ability of many CLEs to replace CLV3 function in vivo and observed extensive, but variable, functional overlap. This suggested that the CLE domain, which is the only region with similarity among these proteins, is the functional domain. This was supported by the ability to turn nonfunctional CLE8 (nonfunctional in terms of replacing CLV3 in vivo) into a functional protein simply by replacing the CLE domain with that from CLV3. Definitive evidence on the sufficiency of the CLE domain came from the full function of a chimeric protein in which the CLV3 signal sequence and variable domain were replaced with sequences from the unrelated ERECTA receptor kinase, leaving only the C-terminal domain from CLV3. Taken together with recent evidence on the ability of the CLE domain peptide to drive developmental changes when added exogenously to Arabidopsis roots (Fiers et al., 2005 What is the role of the rest of the CLV3 protein? The signal peptide is obviously critical for secretion by targeting CLV3 for translation into the endoplasmic reticulum. The variable domain may simply act to allow for translation/translocation of the CLE domain into the lumen of the endoplasmic reticulum. Despite the sufficiency of the CLE domain, an alignment of the CLE domains of those we tested in clv3-1 cross-complementation reveals that higher sequence similarity to CLV3 does not correlate with being functionally equivalent to CLV3 (Fig. 6). CLE1 and CLE6, which are highly functional (in terms of replacing CLV3), are not particularly similar to CLV3 among CLEs, with five nonconservative differences between CLV3 and CLE1/CLE6 over the 15-amino acid CLE domain. By comparison, the weakly functional CLE11 has only two nonconservative differences with CLV3. Examining the CLE domains as aligned by CLV3-equivalent function does little to suggest which residues might be critical for CLV3 function. One candidate is the Asp at position 11. This is common between CLV3, CLE1, and CLE6 and is an Asn in all partially and nonfunctional CLEs. The only exceptions are the nonfunctional CLEs, CLE25 and CLE26, which both contain an Asp; however, CLE25 and CLE26 contain predicted, but not verified, hydrophobic extensions that might independently disrupt function. Another potential critical site is the acidic residues at positions 1 and/or 2 found in all of the functional and partially functional CLEs and within none of the nonfunctional CLEs.
Using the clv1-11 null allele to test the requirement of the CLEs for CLV1 indicated differences in receptor specificity, at least on a genetic level. CLE1 function was largely dependent on CLV1, CLE11 less so, and CLE22 not at all. This suggests that these CLEs differ in the receptor targets, with CLE22 utilizing receptors other than CLV1. Interestingly, the PCLV3:CLE22 clv3-1 phenotype was very similar to clv1-11 mutants, suggesting that CLE22 function represents the activity of the as-yet-unidentified CLV1-redundant receptors.
We have recently shown that three CLV1-related receptors, BAM1, BAM2, and BAM3, have similar biochemical functions as CLV1, but very different developmental roles (DeYoung et al., 2006
Several lines of evidence are consistent with processing of CLV3 and other CLEs at the C terminus to release an active peptide. First, the CLE domain is sufficient to carry out CLV3 activity. Second, addition of a peptide corresponding to the CLV3 CLE domain can dramatically alter development of Arabidopsis roots when added exogenously (Fiers et al., 2005 Interestingly, one of the sites utilized by the in vitro processing activity appears to fall at Arg-70 in CLV3, an absolutely conserved residue among CLEs found at the beginning of the CLE domain. This raises the possibility that this activity may represent a key enzyme in the production of an active CLE peptide. The observation that altering this residue does not abolish processing suggests that the protease may recognize a motif upstream or downstream of this site. The significance of the second processing site around Met-41 is unclear. Whether this is carried out by the same enzyme is unknown. CLE1 is also processed at a second site and also contains paired Met residues at approximately the same position as Met-41 in CLV3 (Supplemental Fig. 1). At this point, we cannot rule out that these processing activities are nonspecific proteases present in cauliflower extracts. The fact that both CLV3 and CLE1 are processed in a similar fashion and that neither control proteins nor general cauliflower proteins are processed would suggest some level of specificity, but this is not definitive. A key test would be to determine whether related processing occurs in vivo; however, the likelihood that any processed fragments would be rapidly turned over might make this very difficult to detect. Combined with the effect of the CLV3 CLE peptide on roots, our results would suggest that following CLV3 localization and diffusion may be experimentally quite difficult.
Plant Growth Seeds were sowed on a combination of Metromix 360 (Scott), medium vermiculite, and coarse perlite mixed in a 1:1:1 ratio, supplemented with approximately 1 g Osmocote 14-14-14 fertilizer (Scott) per 3.5-inch pot, and topped with a thin layer of Metromix 360. After 7 d of cold treatment at 4°C, plants were grown at 22°C under constant cool-white fluorescent light.
For CLV3 cis-elements, an approximately 0.6-kb fragment downstream of the CLV3 stop codon was amplified from Columbia plants with primers CLV3T-5' Bam (CGGATCCTAATCTCTTGTTGCTTTAAAT) and CLV3T-3' (TAAGGATAATAATTAGCTCTAGG). This fragment was regarded as a CLV3 terminator and cloned into a binary vector pCB302 (Xiang et al., 1999 An approximately 3.5-kb fragment upstream of the CLV3 start codon from primer CLV3P-5'-Xba (CTCTAGAACCGAAAGAATCGGAACC) to primer CLV3P-3'-MluSmaBam (AGGATCCCGGGACGCGTGAGAGAGATAAAGAGAGAAAT) was amplified from Columbia plants as the CLV3 promoter region. This fragment was inserted into pCB302-C3T to generate pCB302-C3PT. All CLE sequences were amplified from Landsberg erecta (Ler) genomic DNA based on current annotation with attachment of the MluI site to the 5' end and the BamHI site to the 3' end, with the exception of CLE22, where the 3' end was BglII. The CLE open reading frames were then ligated into pCB302-C3PT by the attached restriction sites (pCB302-CLE), integrated between the CLV3 promoter and terminator sequences. The portion of the CLV3 coding sequence corresponding from His-66 to the stop codon was used to replace the portion of CLE8 corresponding from Phe-57 to the stop codon by fusion PCR. The PCR fragment was ligated into pCB302-C3PT through sites MluI and BamHI to generate pCB302-E8C3. ERECTA sequences corresponding to the signal sequence and the following 46 amino acids were amplified, fused to CLV3 coding sequences corresponding from His-66 to the stop codon, and cloned into pCB302-C3PT to generate pCB302-ERC3.
Cauliflower (Brassica oleracea) meristem protein extracts were prepared as described before (Trotochaud et al., 1999 Escherichia coli-purified proteins (His-CLV3, GST-CLV3, or GST-CLE1) were incubated with cauliflower protein extracts or mock (distilled, deionized water or elution buffers for individual tagged proteins) for 2 h at 4°C on a rotor. SDS loading buffers were added to end the reactions, and samples were boiled at 100°C for 5 min before analysis.
Western protein gel blots were performed as described previously (DeYoung et al., 2006
Approximately 100 µg of purified GST-mCLV3 protein was incubated with cauliflower protein extracts for 2 h at room temperature with rotation. After incubation, GST-tagged proteins were repurified with glutathione Sepharose 4B (Amersham) and eluted in 10 mM glutathione, 50 mM Tris-HCl, pH 8.0. Repurified, processed GST-mCLV3 fragments were submitted to the Michigan Proteome Consortium (http://www.proteomeconsortium.org) in liquid for intact MS analysis and in SDS-PAGE gel for peptide mass fingerprinting analysis on each protein band. MS analysis was carried out as follows. Protein solutions were prepared for matrix-assisted laser-desorption (MALDI)-TOF MS analysis by purification on a C4 ZipTip (Millipore). Protein was eluted with three 10-mL aliquots of 60% acetonitrile/0.1% trifluoroacetic acid and spotted in two 1-mL aliquots onto a MALDI target with 1-mL sinapinic acid as matrix (10 mg/mL in 60% acetonitrile/0.1% trifluoroacetic acid). MS spectra of intact proteins were acquired on a DE-STR (Applied Biosystems) operated in linear positive ion mode with an accelerating voltage of 25 kV and a grid voltage of 23.25 kV. The guide wire was 0.1 kV and a delay time was 750 ns. MS spectra were acquired for the mass range 2,00070,000 D. Spectra were summed from a variable number of laser shots using a nitrogen laser operating at 337 nm and 10 Hz. External calibration was performed using carbonic anhydrase I (CAI; m/z 28,740). A three-point calibration was utilized from the +1 and +2 molecular ions of CAI and the CAI dimer. Protein masses are reported as average masses with a mass accuracy better than 200 ppm. Peptide mass fingerprinting was conducted as follows. Each band on the SDS-PAGE gel was subjected to in-gel trypsin digestion followed by MALDI-TOF MS analysis. Tandem MS spectra were acquired on a 4700 proteomics analyzer (Applied Biosystems) operated in positive ion mode with a source voltage of 8.0 kV and a grid voltage of 6.8 kV. Atmosphere was used as the collision gas with a pressure of 6 x 107 Torr and collision energy of 1 kV. Spectra were acquired using 8,000 to 10,000 laser shots from a Nd-YAG laser operating at 354 nm and 200 Hz. For calibration, fragmentation of angiotensin II was used; mass accuracy was better than 50 ppm based on peptide fragment assignments.
We thank Ken Cadigan for providing anti-GST antibodies and Kathleen Noon for assistance in interpreting MS data. Received October 7, 2005; returned for revision November 4, 2005; accepted November 4, 2005.
1 This work was supported by the National Institutes of Health (grant no. 1R01GM6296201A1 to S.E.C.). The author responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors (www.plantphysiol.org) is: Steven E. Clark (clarks{at}umich.edu).
[W] The online version of this article contains Web-only data.
[OA] Open Access articles can be viewed online without a subscription. Article, publication date, and citation information can be found at www.plantphysiol.org/cgi/doi/10.1104/pp.105.072678. * Corresponding author; e-mail clarks{at}umich.edu; fax 7346470884.
Brand U, Fletcher JC, Hobe M, Meyerowitz EM, Simon R (2000) Dependence of stem cell fate in Arabidopsis on a feedback loop regulated by CLV3 activity. Science 289: 617619 Casamitjana-Martinez E, Hofhuis HF, Xu J, Liu CM, Heidstra R, Scheres B (2003) Root-specific CLE19 overexpression and the sol1/2 suppressors implicate a CLV-like pathway in the control of Arabidopsis root meristem maintenance. Curr Biol 13: 14351441[CrossRef][ISI][Medline] Clark SE, Running MP, Meyerowitz EM (1993) CLAVATA1, a regulator of meristem and flower development in Arabidopsis. Development 119: 397418[Abstract] Clark SE, Running MP, Meyerowitz EM (1995) CLAVATA3 is a specific regulator of shoot and floral meristem development affecting the same processes as CLAVATA1. Development 121: 20572067[Abstract] Clark SE, Williams RW, Meyerowitz EM (1997) The CLAVATA1 gene encodes a putative receptor kinase that controls shoot and floral meristem size in Arabidopsis. Cell 89: 575585[CrossRef][ISI][Medline] Cock JM, McCormick S (2001) A large family of genes that share homology with CLAVATA3. Plant Physiol 126: 939942 DeYoung BJ, Bickle KL, Schrage KJ, Muskett PR, Patel K, Clark SE (2006) The CLAVATA1-related BAM1, BAM2, and BAM3 receptor kinase-like proteins are required for meristem function in Arabidopsis. Plant J 45: 116[CrossRef][ISI][Medline] DeYoung BJ, Clark SE (2001) Signaling through the CLAVATA1 receptor complex. Plant Mol Biol 46: 505513[CrossRef][ISI][Medline] Diévart A, Dalal M, Tax FE, Lacey AD, Huttly A, Li J, Clark SE (2003) CLAVATA1 dominant-negative alleles reveal functional overlap between multiple receptor kinases that regulate meristem and organ development. Plant Cell 15: 11981211 Fiers M, Golemiec E, Xu J, van der Geest L, Heidstra R, Stiekema W, Liu CM (2005) The 14-amino acid CLV3, CLE19, and CLE40 peptides trigger consumption of the root meristem in Arabidopsis through a CLAVATA2-dependent pathway. Plant Cell 17: 25422553 Fletcher JC, Brand U, Running MP, Simon R, Meyerowitz EM (1999) Signaling of cell fate decisions by CLAVATA3 in Arabidopsis shoot meristems. Science 283: 19111914 Jeong S, Trotochaud AE, Clark SE (1999) The Arabidopsis CLAVATA2 gene encodes a receptor-like protein required for the stability of the CLAVATA1 receptor-like kinase. Plant Cell 11: 19251934 Kayes JM, Clark SE (1998) CLAVATA2, a regulator of meristem and organ development in Arabidopsis. Development 125: 38433851[Abstract] Laux T, Mayer KF, Berger J, Jurgens G (1996) The WUSCHEL gene is required for shoot and floral meristem integrity in Arabidopsis. Development 122: 8796[Abstract] Lenhard M, Laux T (2003) Stem cell homeostasis in the Arabidopsis shoot meristem is regulated by intercellular movement of CLAVATA3 and its sequestration by CLAVATA1. Development 130: 31633173 Rojo E, Sharma VK, Kovaleva V, Raikhel NV, Fletcher JC (2002) CLV3 is localized to the extracellular space, where it activates the Arabidopsis CLAVATA stem cell signaling pathway. Plant Cell 14: 969977 Schoof H, Lenhard M, Haecker A, Mayer KF, Jurgens G, Laux T (2000) The stem cell population of Arabidopsis shoot meristems in maintained by a regulatory loop between the CLAVATA and WUSCHEL genes. Cell 100: 635644[CrossRef][ISI][Medline] Sharma VK, Ramirez J, Fletcher JC (2003) The Arabidopsis CLV3-like (CLE) genes are expressed in diverse tissues and encode secreted proteins. Plant Mol Biol 51: 415425[CrossRef][ISI][Medline] Shiu SH, Bleecker AB (2001) Receptor-like kinases from Arabidopsis form a monophyletic gene family related to animal receptor kinases. Proc Natl Acad Sci USA 98: 1076310768 Torii KU, Mitsukawa N, Oosumi T, Matsuura Y, Yokoyama R, Whittier RF, Komeda Y (1996) The Arabidopsis ERECTA gene encodes a putative receptor protein kinase with extracellular leucine-rich repeats. Plant Cell 8: 735746[Abstract] Trotochaud AE, Hao T, Guang W, Yang Z, Clark SE (1999) The CLAVATA1 receptor-like kinase requires CLAVATA3 for its assembly into a signaling complex that includes KAPP and a Rho-related protein. Plant Cell 11: 393405 Xiang C, Han P, Lutziger I, Wang K, Oliver DJ (1999) A mini binary vector series for plant transformation. Plant Mol Biol 40: 711717[CrossRef][ISI][Medline] Yu LP, Simon EJ, Trotochaud AE, Clark SE (2000) POLTERGEIST functions to regulate meristem development downstream of the CLAVATA loci. Development 127: 16611670[Abstract] This article has been cited by other articles:
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ASPB Publications | PLANT PHYSIOLOGY | THE PLANT CELL | |
|---|---|---|---|