|
|
||||||||
|
First published online January 13, 2006; 10.1104/pp.105.075838 Plant Physiology 140:1059-1069 (2006) © 2006 American Society of Plant Biologists Interaction between Arabidopsis Brca2 and Its Partners Rad51, Dmc1, and Dss11Institut de Biotechnologie des Plantes, Centre National de la Recherche Scientifique, Unité Mixte de Recherche 8618, Université Paris XI, 91405 Orsay cedex, France
The Arabidopsis (Arabidopsis thaliana) orthologs of Brca2, a protein whose mutations are involved in breast cancer in humans, were previously shown to be essential at meiosis. In an attempt to better understand the Brca2-interacting properties, we examined four partners of the two isoforms of Brca2 identified in Arabidopsis (AtRad51, AtDmc1, and two AtDss1 isoforms). The two Brca2 and the two Dss1 isoforms are named AtBrca2(IV), AtBrca2(V), AtDss1(I), and AtDss1(V) after their chromosomal localization. We first show that both AtBrca2 proteins can interact with either AtRad51 or AtDmc1 in vitro, and that the N-terminal region of AtBrca2 is responsible for these interactions. More specifically, the BRC motifs (so called because iterated in the Brca2 protein) in Brca2 are involved in these interactions: BRC motif number 2 (BRC2) alone can interact with AtDmc1, whereas BRC motif number 4 (BRC4) recognizes AtRad51. The human Rad51 and Dmc1 proteins themselves can interact with either the complete (HsRad51) or a shorter version of AtBrca2 (HsRad51 or HsDmc1) that comprises all four BRC motifs. We also identified two Arabidopsis isoforms of Dss1, another known partner of Brca2 in other organisms. Although all four Brca2 and Dss1 proteins are much conserved, AtBrca2(IV) interacts with only one of these AtDss1 proteins, whereas AtBrca2(V) interacts with both of them. Finally, we show for the first time that an AtBrca2 protein could bind two different partners at the same time: AtRad51 and AtDss1(I), or AtDmc1 and AtDss1(I).
Mutations in the BREAST CANCER 2 (BRCA2) gene are responsible for a hereditary form of breast cancer predisposition in human and are generally associated with genetic instabilities (Wooster et al., 1995
The Brca2 protein thus became subject of intense examination from both a structural and a biochemical point of view, especially in view of its connection with Rad51 and the newly found interactant Dss1 that could be involved in Brca2 stability. Crystallization of Rad51 in the presence of a BRC motif (so called because iterated in the Brca2 protein; Bork et al., 1996
The human BRCA2 gene encodes for a 3,418-amino-acid-long protein, with eight internal iterated BRC motifs that are typical of Brca2 proteins and are responsible for the interaction with Rad51 (Wong et al., 1997
With this work, we establish the ability of the Arabidopsis Brca2 proteins to interact in vitro with not only Rad51 but also Dmc1, a Brca2 partner that was only uncovered in Arabidopsis (Siaud et al., 2004
In a Coimmunoprecipitation Assay, AtBrca2 Interacts with AtRad51 or AtDmc1
A typical feature of the Brca2 proteins is their ability to interact with Rad51, which was previously observed for both Arabidopsis Brca2(IV) and Brca2(V) protein isoforms in a yeast two-hybrid procedure (Siaud et al., 2004
Using the yeast two-hybrid procedure, we previously identified AtDmc1 as a new Brca2-interacting partner. The interaction between the in vitro translated AtBrca2(IV) or (V) and AtDmc1 was similarly confirmed by coimmunoprecipitation. Following incubation of a c-myc-tagged Brca2 protein in the presence of HA-tagged Dmc1 protein, c-myc antibodies retained a complex comprising two proteins that migrated on a SDS-PAGE gel at the sizes predicted for c-myc-AtBrca2 and HA-AtDmc1 (39.5 kD; Fig. 1C, lanes 6 and 8). In a similar assay, AtBrca2(IV)Nter coimmunoprecipitates with AtDmc1, thus restricting the Dmc1-interacting domain of AtBrca2 to its N-terminal region, in which the BRC motifs are located (Fig. 1C, lane 7). Neither AtRad51 nor AtDmc1 interacted with c-myc-AtBrca2(V)Cter, a C-terminal version of AtBrca2(V) in which the BRC motifs region was eliminated (Fig. 1, A and C, lanes 9 and 10). The interactions between AtBrca2 and AtRad51 or between AtBrca2 and AtDmc1 were evidenced in the absence of any other Arabidopsis proteins, and were not affected by a DNase or RNase treatment prior to the incubation step (data not shown).
Following incubation of AtRad51 and AtDmc1 in various pairwise combinations, we also established that these proteins could interact in vitro in homotypic or heterotypic combinations. These interactions had previously been observed using the yeast two-hybrid procedure but required further examination (Siaud et al., 2004
A yeast two-hybrid assay was performed to investigate the ability of the human Rad51 and Dmc1 proteins to recognize and interact with the Arabidopsis proteins. Interactions were effective between AtRad51 and either HsRad51 or HsDmc1 (Fig. 2B), suggesting enough conservation among species to allow heterologous interactions.
In mammals, the BRC repeats are involved in the interaction of Brca2 with Rad51 (Wong et al., 1997
To further extend our understanding of the Brca2-interacting properties, we examined whether a BRC motif peptide could prevent AtBrca2 from interacting with either Rad51 or Dmc1. In human breast cancer cells, expression of BRC motifs can disrupt the formation of Brca2-Rad51 complexes (Chen et al., 1999
The human BRC3 peptide was thus introduced in the coimmunoprecipitation assays in an attempt to compete out the interaction between AtRad51 or AtDmc1 and AtBrca2. In these experiments, 35S-Met-radiolabeled AtBrca2(IV) was used as a substrate for HA-AtRad51 (or HA-AtDmc1) binding. When AtRad51 was preincubated with no (Fig. 3C, lane 1) or 1 µg (Fig. 3C, lane 2) of the human BRC3 peptide prior to the addition of AtBrca2, we obtained two bands after elution, SDS-PAGE migration, and visualization by autoradiography. These bands corresponded to the AtBrca2(IV) and the HA-tagged AtRad51 predicted sizes. However, when AtRad51 was preincubated with 5 µg of the BRC3 peptide, no AtBrca2 binding could be detected. Only one band at the predicted size for HA-AtRad51 was eluted in this assay, proving that the ability of AtBrca2 to bind AtRad51 was abolished. This amount of BRC3 corresponds to a 10-fold molar excess of peptide over AtRad51 and AtBrca2 (Fig. 3C, lane 3). In human, mutations of BRC3 in key positions prevent its binding with HsRad51 (Davies et al., 2001 We thus examined whether any of the Arabidopsis Brca2 single BRC motifs could bind AtRad51 or AtDmc1 in a yeast two-hybrid assay. As in human, the BRC motifs in AtBrca2 were numbered after their order of occurrence in the Arabidopsis protein (Fig. 3A), which does not mean that their sequence is closer to similarly numbered motifs of the human protein. The two BRC2 motifs are divergent, thus both were tested, while BRC1, BRC3, and BRC4 are identical in AtBrca2(IV) and AtBrca2(V) (Fig. 3B). An interaction was clearly evidenced between BRC2 of AtBrca2(IV) and AtDmc1 (but not AtRad51), or BRC4 and AtRad51. These interactions were eliminated when a Thr-to-Ala amino acid change was introduced at a key position (Fig. 3, B and D). The motifs involved in the fixation of Rad51 (BRC4) or Dmc1 (BRC2) are the minimum sufficient domains we could define for this interaction. When combined with other domains, an interaction is thus also obtained. We examined different combinations of the BRC repeats (Fig. 3D) and evidenced that the BRC1-BRC2 combination binds AtDmc1 and HsRad51. BRC2-BRC3, BRC3-BRC4, and BRC1-BRC2-BRC3 bind AtRad51, AtDmc1, and HsRad51 as well. Autoactivation of the BRC2 + BRC3 + BRC4 combination in the absence of any partner prevents interpretation of data with this particular construct. As previously mentioned, the whole four-motif region of Brca2 (BRC1-BRC2-BRC3-BRC4) is required for the interaction with HsDmc1. Not surprisingly, this last combination also interacts with AtRad51, AtDmc1, and HsRad51 (Fig. 3D).
Two potential Dss1-encoding sequences were identified in the Arabidopsis genome named AtDSS1(I) (At1g64750) and AtDSS1(V) (At5g45010) after their chromosomal localization. Both AtDSS1 genomic DNA sequences comprise two exons and one 550-nt-long intron. Using specific primers, two different AtDSS1 cDNAs were isolated via reverse transcription-PCR that correspond to either the chromosome I (222 nt) or the chromosome V (219 nt) DSS1 cDNAs, thus revealing that both genomic sequences are transcriptionally active. These cDNAs share 90.7% identity and encode, respectively, for 74-amino-acid- (I) and 73-amino-acid-long (V) putative proteins, which are 88% identical to each other and show high conservation with their human, fungus, and yeast counterparts (Fig. 4A ).
The AtDSS1 coding sequences were fused in frame to the AD and BD of the yeast two-hybrid vectors pGADT7 and pGBKT7. Potential interactions were examined between the two AtBrca2 and AtDss1 coding sequences following their introduction in pairwise combinations into the same yeast reporter strains. The assay indicated potential interactions between AtBrca2(V) and AtDss1(I) or AtDss1(V), and also between AtBrca2(IV) and AtDss1(I). No interaction was observed between AtBrca2(IV) and AtDss1(V), or between Nter-AtBrca2(IV) and AtDss1(I) or AtDss1(V) (Fig. 4B). We analyzed the in vitro interactions between the corresponding proteins in a coimmunoprecipitation assay (Fig. 4C). When coimmunoprecipitation was realized with c-myc-AtBrca2(V) and HA-AtDss1(I) or (V) in the presence of anti-c-myc antibodies (Fig. 4C, lanes 1 and 2), two bands were eluted, one at the predicted size for c-myc-AtBrca2(V) and one at 11 kD [either HA-AtDss1(I) or (V)]. When we immunoprecipitated c-myc-AtBrca2(IV) and HA-AtDss1(I) in the presence of anti-c-myc antibodies, we eluted two bands around 129 and 11 kD (Fig. 4C, lane 5), whereas we obtained only one band around 129 kD when we immunoprecipitated c-myc-AtBrca2(IV) and HA-AtDss1(V) in the presence of anti-c-myc antibodies (Fig. 4C, lane 6). When the assay was performed with c-myc-AtBrca2(IV)Nter and HA-AtDss1(I) or (V) in the presence of anti-c-myc antibodies, only one band at 88 kD [c-myc-AtBrca2(IV)Nter] was obtained (Fig. 4C, lanes 3 and 4). These results indicate that AtBrca2(V) is able to interact with both AtDss1(I) and (V), whereas AtBrca2(IV) only interacts with AtDss1(V) in vitro. The Nter-truncated version of AtBrca2(IV) is unable to interact with AtDss1(V), indicating that amino acids that are key to binding Dss1 must be present beyond amino acid 784 in AtBrca2.
A coimmunoprecipitation assay was performed after incubating together all three in vitro-translated proteins: AtBrca2(V), HA-AtRad51, and AtDss1(I). HA antibodies were used to bind the interacting complex. SDS-PAGE analysis of the reaction products indicated three well defined bands that migrated at the expected sizes for AtBrca2(V), HA-tagged AtRad51, and AtDss1(I) (Fig. 5 , lane 1). Since the AtRad51 protein alone had proven unable to bind AtDss1(I) (Fig. 5, lane 3), AtBrca2(V) and AtDss1(I) were thus both retained by HA-AtRad51 binding in this particular assay. Following the same experimental strategy, we also obtained evidence that AtBrca2(V) is able to bind both AtDmc1 and AtDss1(I) (Fig. 5, lane 2). AtDss1 and AtDmc1 cannot directly interact (as shown in Fig. 5, lane 4). Our results establish that AtBrca2(V) can interact with both Rad51 and Dss1(I) or both Dmc1 and Dss1(I) in a tripartite complex.
This tripartite interaction is not observed in the presence of the truncated AtBrca2(V)Cter form. When HA-AtRad51, c-myc-AtDss1(I), and c-myc-AtBrca2(V)Cter were immunoprecipitated using anti-HA-antibodies, only one band around 37 kD was eluted (Fig. 5, lane 7). Similar results were obtained with HA-Dmc1, c-myc-AtDss1(I), and c-myc-AtBrca2(V)Cter (Fig. 5, lane 8). We previously observed that AtBrca2(V)Cter can bind AtDss1(I) or (V) (Fig. 5, lanes 5 and 6), thus indicating that this truncated version of AtBrca2 is still partially functional. These experiments clearly show that AtRad51 or AtDmc1 cannot directly interact with AtDss1, but that a three-partner complex can exist in the presence of a full-length AtBrca2 protein.
In this work, we have examined in vitro the interactions of the Arabidopsis Brca2 proteins with four of their key partners: Rad51, Dmc1, and Dss1 (two isoforms). We first confirmed that AtBrca2 is able to bind AtRad51 and AtDmc1 efficiently in vitro. The interaction between AtBrca2 and AtDmc1, in particular, which has never been described in any other species than Arabidopsis, had only been observed in a yeast two-hybrid assay and thus remained to be established at the protein level (Siaud et al., 2004
In a yeast two-hybrid assay, we could establish that Brca2 binds to AtDmc1 via the same four-BRC-motifs-containing region that is involved in AtRad51 binding. While we determined that the BRC3 motif of human Brca2 was able to compete the binding of AtRad51 to AtBrca2 and that, like in human, a single mutation at a key position of HsBRC3 suffices to prevent this effect, the Brca2/Dmc1 interaction was not similarly affected. It was only after the examination of every single Arabidopsis BRC motif in a genetic assay that we could determine that the BRC2 motif of AtBrca2(IV) is specifically involved in an interaction with AtDmc1 but not with AtRad51. Our data thus establish that this activity of the BRC motifs, i.e. binding of recombination proteins, is altogether largely conserved, since a human motif can be responsible for destabilizing the interaction between the two Arabidopsis Brca2 and Rad51 proteins, but also specific, since the same AtBrca2 BRC motif that interacts with AtDmc1 does not recognize AtRad51. The C-terminal region of the human Brca2 protein was also recently shown to bind Rad51 in a manner that is regulated through cyclin-dependent kinase (CDK)-dependent phosphorylation (Esashi et al., 2005
In human, while BRC3 interacts specifically with HsRad51, no interaction could be detected between BRC3 and Dmc1 or any of the Rad51-like proteins (Xrcc2, Xrcc3, Rad51B, Rad51C, and Rad51D; Davies et al., 2001
We examined the interaction between AtBrca2 and another of its essential partners, Dss1. Key Dss1-interacting domains were defined in the C-terminal region of the human Brca2 that are found mostly conserved in the AtBrca2 proteins (Yang et al., 2002
Finally, although the ability of Brca2 to associate with either Rad51 or Dss1 has been documented in different organisms and is clearly conserved in Arabidopsis, we also establish that AtBrca2 can exist in a three-partner complex, interacting simultaneously with AtRad51 and AtDss1, or with AtDmc1 and AtDss1. This result indicates that AtBrca2, AtRad51 or AtDmc1, and AtDss1 could interact in vivo to form a ternary complex, whether it be transitory or not, in which AtBrca2 is either stabilized or activated by Dss1 (as shown in Kojic et al., 2005
Dss1 and BRC Repeats cDNA Cloning
One microgram of total RNA extracted from a 2-d freshly subcultured cell suspension of Arabidopsis (Arabidopsis thaliana) was reverse transcribed by the MMLV reverse transcriptase with oligo(dT) primers and in the presence of dNTPs in a final volume of 20 µL. PCR was performed, using Dss1(I)- or (V)-specific primers (I-Nter ATCGTGAATTCATGGCGGCAGAACCGAAGGCAGCG; I-Cter GCTTAGTCGACTTATTTCTTGTCAGTACCATTCTC; V-Nter ATCGTGAATTCATGGCGGCAGAACCCAAGGCAGCT; V-Cter GCTTAGTCGACTCATTTCTTCTCACTAGCATTC) with Pfx DNA polymerase (Invitrogen). PCR products were cloned in frame with the BD and AD domains of pGBKT7 (EcoRI and SmaI sites) and pGADT7 (EcoRI and SalI sites; CLONTECH). The BRC motifs, in single or multiple combinations, were isolated by performing PCR reactions with different sets of primers using BRCA2(IV) or BRCA2(V) cDNAs as a matrix (Siaud et al., 2004
PCR products previously described were cloned in frame with the DB and AD of pGBT9 (EcoRI and PstI sites) and verified by sequencing. HsRad51 and HsDmc1 were provided by S. West (Masson et al., 1999
The BRCA2(IV), BRCA2(V), and AtBRCA2(IV)Nter cDNA sequences in plasmids pGAD424 and pGBT9 (CLONTECH) were used as matrix to in vitro transcribe and translate the relevant proteins. Primer pairs were designed to PCR amplify a fragment containing the expression domain of the vectors, adding a HA tag (pGAD-HA-up AAAATTGTAATACGACTCACTATAGGGCGAGCCGCCACCATGTACCCATACGACGTTCCAGATTACGCTCCACCAAACCCAAAAAAAGAG and pGAD-HA-do ACTTGCGGGGTTTTTCAGTATCTACGAT) or a c-myc tag (pGBT9-c-myc-up AAAATTGTAATACGACTCACTATAGGGCGAGCCGCCACCATGGAGGAGCAGAAGCTGATCTCAGAGGAGGACCTGGGTCAAAGACAGTTGACTGTATCG and pGBT9-c-myc-do TACCTGAGAAAGCAACCTGACCTACAGG) 3' to the cDNAs. Primer was designed to amplify BRCA2 cDNA from the 1,070th bp to the end, to delete the N-terminal region containing the BRC domains (pGBT9-cmyc C-ter: AAAATTGTAATACGACTCACTATAGGGCGAGCCGCCACCATGGAGGAGCAGAAGCTGATCTCAGAGGAGGACCTGAACTTGGAGAACCTAGCTTCAGGGGGT). When used with the pGBT9-c-myc-do oligonucleotides, the amplified fragment contains the expression domain of pGBT9 and a c-myc tag in frame with the truncated BRCA2 cDNA. RAD51, DMC1, DSS1(I) and (V), and each AtBRCA2 cDNA sequence cloned into plasmids pGADT7 and pGBKT7 (CLONTECH) were used as matrix to in vitro produce the proteins. Primer pairs were designed to amplify the cDNAs (pGADT7do, AAGTGAACTTGCGGGGTTTTTCAGTATCTACG, and pGBKT7do, CATAAGAAATTCGCCCGG, plus the left border of the vector [pGADT7up, TATTCGATGATGAAGATACCCCACAAACC, or pGBKT7up, TCATCGGAAGAGAGTAG]). PCR was conducted with Pfx DNA polymerase (Invitrogen). Coupled transcription/translation was performed for each protein with the PCR products as a matrix in the presence of 35S Met (15.1 µCi/ reaction; Redivue, Amersham; TNT T7 Quick for PCR DNA kit, Promega). Translation products were analyzed by SDS-PAGE. To eliminate DNA or RNA, 5 µL of the translation products were treated with DNaseI (Invitrogen) or RnaseA (Qiagen).
Coimmunoprecipitation was conducted with the Matchmaker kit (CLONTECH), using anti-c-myc or anti-HA antibodies and protein A beads, as recommended. Results were analyzed after SDS-PAGE on a 12% acrylamide gel by autoradiography performed with a Molecular Imager Fx Pro (Bio-Rad).
Human BRC3 wild-type and mutant peptides were provided by S. West (Davies et al., 2001 Sequence data from this article can be found in the GenBank/EMBL data libraries under accession numbers AJ619975 [for Dss1(I)] and AJ619976 [for Dss1(V)].
We thank Dr. Steve West for providing HsRad51 and HsDmc1 cloned into yeast two-hybrid vectors, and for providing the HsBRC3 peptide. We are grateful to F. Ambart and J. Vidal for useful comments in the course of our experiments, and to C. Mézard and S. Lemaire for their critical reading and useful comments on our manuscript. Received September 19, 2005; returned for revision December 19, 2005; accepted December 23, 2005.
1 This work was supported in part by the Association pour la Recherche contre le Cancer. E. Dray was supported by a Ministère de l'éducation Nationale, de la Recherche et de la Technologie fellowship, and N.S. was a recipient of a Ligue Nationale contre le Cancer fellowship.
2 Present address: Molecular Biology Program, Memorial Sloan-Kettering Cancer Center, 1275 York Avenue, New York, New York 10021. The author responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors (www.plantphysiol.org) is: Marie-Pascale Doutriaux (doutriau{at}ibp.u-psud.fr). Article, publication date, and citation information can be found at www.plantphysiol.org/cgi/doi/10.1104/pp.105.075838. * Corresponding author; e-mail doutriau{at}ibp.u-psud.fr; fax 33(0)169153424.
Bishop DK, Park D, Xu L, Kleckner N (1992) DMC1: a meiosis-specific yeast homolog of E. coli recA required for recombination, synaptonemal complex formation, and cell cycle progression. Cell 69: 439456[CrossRef][ISI][Medline] Bork P, Blomberg N, Nilges M (1996) Internal repeats in the BRCA2 protein sequence. Nat Genet 13: 2223[CrossRef][ISI][Medline] Chen CF, Chen PL, Zhong Q, Sharp ZD, Lee WH (1999) Expression of BRC repeats in breast cancer cells disrupts the BRCA2-Rad51 complex and leads to radiation hypersensitivity and loss of G(2)/M checkpoint control. J Biol Chem 274: 3293132935 Chen J, Silver DP, Walpita D, Cantor SB, Gazdar AF, Tomlinson G, Couch FJ, Weber BL, Ashley T, Livingston DM, et al (1998a) Stable interaction between the products of the BRCA1 and BRCA2 tumor suppressor genes in mitotic and meiotic cells. Mol Cell 2: 317328[CrossRef][ISI][Medline] Chzen PL, Chen CF, Chen Y, Xiao J, Sharp ZD, Lee WH (1998b) The BRC repeats in BRCA2 are critical for RAD51 binding and resistance to methyl methanesulfonate treatment. Proc Natl Acad Sci USA 95: 52875292 Couteau F, Belzile F, Horlow C, Grandjean O, Vezon D, Doutriaux M-P (1999) Random chromosome segregation without meiotic arrest in both male and female meiocytes of a dmc1 mutant of Arabidopsis. Plant Cell 11: 16231634 Davies AA, Masson JY, McIlwraith MJ, Stasiak AZ, Stasiak A, Venkitaraman AR, West SC (2001) Role of BRCA2 in control of the RAD51 recombination and DNA repair protein. Mol Cell 7: 273282[CrossRef][ISI][Medline] Esashi F, Christ N, Gannon J, Liu Y, Hunt T, Jasin M, West SC (2005) CDK-dependent phosphorylation of BRCA2 as a regulatory mechanism for recombinational repair. Nature 434: 598604[CrossRef][Medline] Funakoshi M, Li X, Velichutina I, Hochstrasser M, Kobayashi H (2004) Sem1, the yeast ortholog of a human BRCA2-binding protein, is a component of the proteasome regulatory particle that enhances proteasome stability. J Cell Sci 117: 64476454 Galkin VE, Esashi F, Yu X, Yang S, Wes SC, Egelman EH (2005) BRCA2 BRC motifs bind RAD51-DNA filaments. Proc Natl Acad Sci USA 102: 85378542 Gudmundsdottir K, Lord CJ, Witt E, Tutt AN, Ashworth A (2004) DSS1 is required for RAD51 focus formation and genomic stability in mammalian cells. EMBO Rep 5: 989993[CrossRef][ISI][Medline] Kojic M, Yang H, Kostrub CF, Pavletich NP, Holloman WK (2003) The BRCA2-interacting protein DSS1 is vital for DNA repair, recombination, and genome stability in Ustilago maydis. Mol Cell 12: 10431049[CrossRef][ISI][Medline] Kojic M, Zhou Q, Lisby M, Holloman WK (2005) Brh2-Dss1 interplay enables properly controlled recombination in Ustilago maydis. Mol Cell Biol 25: 25472557 Krogan NJ, Lam MH, Fillingham J, Keogh MC, Gebbia M, Li J, Datta N, Cagney G, Buratowski S, Emili A, et al (2004) Proteasome involvement in the repair of DNA double-strand breaks. Mol Cell 16: 10271034[CrossRef][ISI][Medline] Li W, Chen C, Markmann-Mulisch U, Timofejeva L, Schmelzer E, Ma H, Reiss B (2004) The Arabidopsis AtRAD51 gene is dispensable for vegetative development but required for meiosis. Proc Natl Acad Sci USA 101: 1059610601 Lim DS, Hasty P (1996) A mutation in mouse rad51 results in an early embryonic lethal that is suppressed by a mutation in p53. Mol Cell Biol 16: 71337143[Abstract] Lo T, Pellegrini L, Venkitaraman AR, Blundell TL (2003) Sequence fingerprints in BRCA2 and RAD51: implications for DNA repair and cancer. DNA Repair (Amst) 2: 10151028[CrossRef][Medline] Marston NJ, Richards WJ, Hughes D, Bertwistle D, Marshall CJ, Ashworth A (1999) Interaction between the product of the breast cancer susceptibility gene BRCA2 and DSS1, a protein functionally conserved from yeast to mammals. Mol Cell Biol 19: 46334642 Martin JS, Winkelmann N, Petalcorin MI, McIlwraith MJ, Boulton SJ (2005) RAD-51-dependent and -independent roles of a Caenorhabditis elegans BRCA2-related protein during DNA double-strand break repair. Mol Cell Biol 25: 31273139 Masson JY, Davies AA, Hajibagheri N, Van Dyck E, Benson FE, Stasiak AZ, Stasiak A, West SC (1999) The meiosis-specific recombinase hDmc1 forms ring structures and interacts with hRad51. EMBO J 18: 65526560[CrossRef][ISI][Medline] Pellegrini L, Yu DS, Lo T, Anand S, Lee M, Blundell TL, Venkitaraman AR (2002) Insights into DNA recombination from the structure of a RAD51-BRCA2 complex. Nature 420: 287293[CrossRef][Medline] Scully R, Livingston DM (2000) In search of the tumour-suppressor functions of BRCA1 and BRCA2. Nature 408: 429432[CrossRef][Medline] Sharan SK, Morimatsu M, Albrecht U, Lim DS, Regel E, Dinh C, Sands A, Eichele G, Hasty P, Bradley A (1997) Embryonic lethality and radiation hypersensitivity mediated by Rad51 in mice lacking Brca2. Nature 386: 804810[CrossRef][Medline] Sharan SK, Pyle A, Coppola V, Babus J, Swaminathan S, Benedict J, Swing D, Martin BK, Tessarollo L, Evans JP, et al (2003) BRCA2 deficiency in mice leads to meiotic impairment and infertility. Development 131: 131142[CrossRef][ISI][Medline] Siaud N, Dray E, Gy I, Takvorian N, Gérard E, Doutriaux MP (2004) Brca2 is involved in meiosis in Arabidopsis thaliana as suggested by its interaction with Dmc1. EMBO J 23: 13921401[CrossRef][ISI][Medline] Tsuzuki T, Fujii Y, Sakumi K, Tominaga Y, Nakao K, Sekiguchi M, Matsushiro A, Yoshimura Y, Morita T (1996) Targeted disruption of the Rad51 gene leads to lethality in embryonic mice. Proc Natl Acad Sci USA 93: 62366240 Wong AK, Pero R, Ormonde PA, Tavtigian SV, Bartel PL (1997) RAD51 interacts with the evolutionarily conserved BRC motifs in the human breast cancer susceptibility gene brca2. J Biol Chem 272: 3194131944 Wooster R, Bignell G, Lancaster J, Swift S, Seal S, Mangion J, Collins N, Gregory S (1995) Identification of the breast cancer susceptibility gene BRCA2. Nature 378: 789792[CrossRef][Medline] Yang H, Jeffrey PD, Miller J, Kinnucan E, Sun Y, Thoma NH, Zheng N, Chen PL, Lee WH, Pavletich NP (2002) BRCA2 function in DNA binding and recombination from a BRCA2-DSS1-ssDNA structure. Science 297: 18371848 Yang H, Li Q, Fan J, Holloman WK, Pavletich NP (2005) The BRCA2 homologue Brh2 nucleates RAD51 filament formation at a dsDNA-ssDNA junction. Nature 433: 653657[CrossRef][Medline] Yu VP, Koehler M, Steinlein C, Schmid M, Hanakahi LA, van Gool AJ, West SC, Venkitaraman AR (2000) Gross chromosomal rearrangements and genetic exchange between nonhomologous chromosomes following BRCA2 inactivation. Genes Dev 14: 14001406
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ASPB Publications | PLANT PHYSIOLOGY | THE PLANT CELL | |
|---|---|---|---|