|
|
||||||||
|
First published online February 17, 2006; 10.1104/pp.105.074138 Plant Physiology 140:1345-1354 (2006) © 2006 American Society of Plant Biologists Light-Regulated, Tissue-Specific, and Cell Differentiation-Specific Expression of the Arabidopsis Fe(III)-Chelate Reductase Gene AtFRO61State Key Laboratory of Plant Genomics (H.F., F.A., S.Z., Z.J., J.Z.) and State Key Laboratory of Plant Cell and Chromosome Engineering (H.-Q.L.), Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, Beijing, China, 100101; and Graduate School, Chinese Academy of Sciences, Beijing, China, 100049 (H.F., F.A., S.Z., Z.J.)
Iron is an essential element for almost all living organisms, actively involved in a variety of cellular activities. To acquire iron from soil, strategy I plants such as Arabidopsis (Arabidopsis thaliana) must first reduce ferric to ferrous iron by Fe(III)-chelate reductases (FROs). FRO genes display distinctive expression patterns in several plant species. However, regulation of FRO genes is not well understood. Here, we report a systematic characterization of the AtFRO6 expression during plant growth and development. AtFRO6, encoding a putative FRO, is specifically expressed in green-aerial tissues in a light-dependent manner. Analysis of mutant promoter- -glucuronidase reporter genes in transgenic Arabidopsis plants revealed the presence of multiple light-responsive elements in the AtFRO6 promoter. These light-responsive elements may act synergistically to confer light responsiveness to the AtFRO6 promoter. Moreover, no AtFRO6 expression was detected in dedifferentiated green calli of the korrigan1-2 (kor1-2) mutant or undifferentiated calli derived from wild-type explants. Conversely, AtFRO6 is expressed in redifferentiated kor1-2 shoot-like structures and differentiating calli of wild-type explants. In addition, AtFRO7, but not AtFRO5 and AtFRO8, also shows a reduced expression level in kor1-2 green calli. These results suggest that whereas photosynthesis is necessary but not sufficient, both light and cell differentiation are necessary for AtFRO6 expression. We propose that AtFRO6 expression is light regulated in a tissue- or cell differentiation-specific manner to facilitate the acquisition of iron in response to distinctive developmental cues.
All living organisms except lactobacilli have an absolute requirement for iron that is involved in a variety of cellular activities, including in respiration, chlorophyll biosynthesis, photosynthetic electron transfer, nitrogen assimilation, and DNA synthesis. In addition, numerous proteins, especially enzymes, require iron as an essential component in the form of heme or iron-sulfur (Marschner, 1995
Over the past several years, knowledge about the molecular basis of iron acquisition from soil in strategy I plants has greatly increased. Based on the sequence homology with the yeast (Saccharomyces cerevisiae) Fe(III) reductase1 (FRE1) and FRE2 that have been shown to be involved in iron acquisition (Dancis et al., 1990
In Arabidopsis, a typical strategy I species, iron is first reduced on the root surface from ferric to ferrous iron by Fe(III)-chelate reductases (FROs) and then transferred across the rhizodermal plasmalemma into root cells. Subsequently, iron is oxidized and transported as Fe3+-citrate complex for long-distance transport in the xylem from roots to shoots (Hell and Stephan, 2003
Ferric-chelate reductase activity has been proposed in leaves such as LeFRO1 in tomato and PsFRO1 in pea, both of which are primarily expressed in leaves (Waters et al., 2002 Despite an increasingly accumulated body of knowledge on FROs in plants, thus far little is known about the mechanism of light-regulated activity of FROs in plant aerial tissues. In this report, expression of AtFRO6, a gene encoding a ferric-chelate reductase, is characterized in detail. The AtFRO6 gene is mainly expressed in green-aerial tissues in a light-dependent manner. Promoter deletion and site-directed mutation analyses defined multiple light-responsive elements (LREs) that are necessary for the light-dependent expression of AtFRO6. Moreover, an AT-1-like box is essential for the aerial green tissue-specific expression of AtFRO6. In undifferentiated calli derived from tissue-cultured explants or dedifferentiated calli of the korrigan1-2 (kor1-2) mutant, essentially no AtFRO6 expression was detected. These results suggest that the light-regulated expression of AtFRO6 is green tissue specific and cell differentiation specific.
AtFRO6 Specifically Expresses in Aerial Green Tissues
In a previous study, we reported the identification and characterization of eight putative AtFRO genes (Wu et al., 2005
To monitor the AtFRO6 expression in planta, we made an AtFRO6:: -glucuronidase (GUS) reporter construct, which was stably transformed into Arabidopsis plants (Columbia-0 [Col-0]) by vacuum infiltration (Clough and Bent, 1998In germinating seeds, no GUS activity was detected (Fig. 1, B and C). However, consistent with the northern-blot analysis, the GUS reporter gene was strongly expressed in cotyledons, leaves, and stems, but not in roots and hypocotyls (Fig. 1, DF). In flowers, the GUS activity appeared to be restricted to sepals (Fig. 1G). Weak GUS activity was also detected in siliques (Fig. 1G). We also tested the AtFRO6 expression under different iron conditions. Under the conditions of iron starvation or externally supplied iron, no substantial alterations of the GUS expression were observed (data not shown), suggesting that the AtFRO6 expression is not regulated by iron availability.
Sequence analysis of the AtFRO6 promoter revealed the presence of multiple putative LREs (Lescot et al., 2002
To characterize these putative LREs, we made two mutant constructs of AtFRO6::GUS, which carried truncations from the distal end of the promoter (Fig. 4A ). These constructs were stably transformed into wild-type Col-0 plants, and the GUS activity was analyzed in homozygous T2 or T3 plants. Note that, because the precise position of the transcription initiation site of AtFRO6 has not been determined, we deduced a transcription initiation site (referred to as +1) based on available cDNA sequences that contained the longest 5'-UTR of 58 bp (accession no. AY091140; see Fig. 2). Whereas the sequence upstream from 554 (StyI site) contained a putative GT1-box and several I-box-type cis-elements, the region between 554 and 322 (HindIII site) had a putative GATA-motif and a G-box (Fig. 4A). Deletion of these putative LREs caused substantially reduced GUS activities in pSty and pHind transgenic plants (80.9% and 49.7% relative to pFul, respectively; Fig. 4, B and C). These results suggest that these putative LREs may be involved in the maintenance of optimal promoter activity of AtFRO6. In particular, cis-elements located between 554 and 322 (covered by pSty and pHind), which contained a putative GATA-box and a putative G-box (Fig. 4A), contributed approximately 50% of the promoter activity (Fig. 4C).
The absence of AtFRO6 expression in roots under both the light and dark conditions may be caused by repressive or negative regulatory cis-elements in the AtFRO6 promoter. To test this possibility, we analyzed the GUS activity of pFul, pSty, and pHind transgenic plants germinated and grown in the dark. No detectable GUS activity was observed in these transgenic plants upon extensive staining (1624 h; data not shown). This result rules out the possibility that the AtFRO6 expression is directly regulated by a light-repressive mechanism. Compared to pFul, pSty and pHind showed a substantially reduced promoter activity. However, the light-dependent and tissue-specific expression pattern was not altered in pSty and pHind (Fig. 4, B and C), suggesting that the sequence between 322 and +1 contained additional regulatory elements sufficient for maintaining the tissue- or organ-specific expression pattern of AtFRO6. To identify possible cis-acting elements in this region, we made a series of internal deletion mutants based on pFul (Fig. 5A ). These mutant AtFRO6 promoter-GUS constructs, designated as pD1 through pD8, were introduced into wild-type Arabidopsis plants. Multiple independent T2 or T3 lines homozygous for single T-DNA insertions were identified and used for subsequent experiments. Deletions up to 169 (pD5) had no apparent effect on the aerial tissue-specific expression pattern of the reporter gene (Fig. 5B). As expected, pD1 through pD4, which had shorter deletions in this region, displayed an expression pattern similar to that of pD5 (Fig. 5B). Deletions of additional sequences toward the proximal end completely abolished the expression of the reporter gene (pD6, pD7, and pD8; Fig. 5B).
Similar to that of pSty and pHind, although the aerial tissue-specific expression pattern was maintained in pD1 through pD5, the GUS activity was remarkably reduced. Quantitative fluorometric GUS assay indicated that pD1 and pD2 maintained approximately 50% activity, whereas pD3, pD4, and pD5 had approximately 10% activity relative to that of wild-type promoter pFul (Fig. 5C). The region covered by pD3 through pD5 (225 to approximately 169) contains two putative G-box cis-elements (Fig. 5A). Deletion of these elements resulted in a 90% loss of the GUS activity (Fig. 5C), suggesting that these elements are crucial for the promoter activity. Consistent with this observation, a longer staining time was required for pD3, pD4, and pD5 transgenic plants compared to that of wild-type pFul transgenic plants (1624 versus 46 h). Taken together, data presented above suggest that multiple LREs in the AtFRO6 promoter are involved in the control of the promoter activity.
Data presented above suggest that sequences between 195 and 135 (covered by pD4 through pD6) are required for light-inducible expression of AtFRO6 in the aerial green tissues. The loss of promoter activity in pD6 (deletion of 318 to 136) may be caused by nonspecific alterations of the promoter structure because of a relatively large deletion in this construct (183 bp). Alternatively, the aerial green tissue-specific expression of AtFRO6 is regulated by a cis-element located in this region. To distinguish these two possibilities, we made an additional mutant pD9, which contained a 35-bp deletion between 170 and 136 (Figs. 2 and 6A ). As shown in Figure 6B, pD9 did not show any detectable GUS activity, suggesting that this 35-bp sequence is essential for the promoter activity.
In this 35-bp region, we noticed two putative cis-elements that might be responsible for the regulation of the promoter. Whereas a perfect palindromic repeat was present at the distal end (AATGACACTCTCATT), two T-repeats were found at the proximal end (Figs. 2 and 6A). In particular, the proximal T-repeat (TATAGTTTTTTTTATT) is structurally similar to the previously characterized AT-1-box (AATATTTTTATT) found in the pea RbcS-3A promoter (Datta and Cashmore, 1989
A previous study suggested that AT-1-box-containing promoters display the photosynthetic cell-specific expression pattern (Datta and Cashmore, 1989
To further test if cell differentiation is a perquisite for the AtFRO6 expression, we examined the AtFRO6 expression during in vitro shoot regeneration. Root explants derived from pFul were cultured in the callus induction medium for 2 d and then transferred onto shoot induction medium (SIM; Koncz et al., 1989
Our previous studies showed that AtFRO5, AtFRO7, and AtFRO8 had an expression pattern similar to that of AtFRO6. These four genes have substantial expression in shoots, but with a significantly reduced expression level (AtFRO5 and AtFRO8) or no detectable expression (AtFRO6 and AtFRO7) in roots. Moreover, expression of AtFRO5 and AtFRO8 appears to be inducible by iron deficiency (Wu et al., 2005
In strategy I plants, a critical step for iron acquisition from soil is to reduce ferric to ferrous iron catalyzed by FROs that are encoded by evolutionarily conserved gene families FRO in various plant species. Expression of FRO genes shows distinctive patterns during plant growth and development and is regulated by various environmental factors (Robinson et al., 1999
The AtFRO6 expression was found to restrict to aerial green tissues but not in roots, suggestive of the involvement of a possible light regulatory mechanism. This view is supported by the observation that AtFRO6::GUS is expressed in light-grown but not in etiolated seedlings. Consistent with this light-dependent expression pattern, multiple putative LREs were found in the AtFRO6 promoter. By analyzing GUS expression driven by a series of mutant AtFRO6 promoters in transgenic Arabidopsis plants, we have been able to define several LREs that are involved in the light-dependent expression of the gene. All these LREs appear to contribute to the promoter activity at different degrees. Whereas deletion of three LREs upstream from 320 results in an approximate 50% reduction of the promoter activity, two G-box-type cis-elements upstream from 169 account for 90% activity of the promoter activity. Despite the importance of these LREs as highlighted above, however, deletion of the AT-1-like box upstream from 189 causes a complete loss of the GUS activity. Note that no detectable reporter activity in this mutant may attribute to detect limitation under the assay conditions. Nevertheless, mutations in any LREs cause substantially reduced promoter activities. One explanation for these results is that the AT-1-like box may be essential for basal transcription of the promoter. However, considering the position of this cis-element in various promoters, including in pea rbcS (Datta and Cashmore, 1989
In addition to light responsiveness, AtFRO6 appears to be cell differentiation-specific regulated. In most, if not all, cases, expression of a light-regulated gene is restricted to photosynthetic active cells and displays a tissue- or development-specific expression mode (Terzaghi and Cashmore, 1995
Among the identified AtFROs, AtFRO6 shows the lowest FRO activity in yeast cells (Wu et al., 2005
Iron plays a great deal of roles in chloroplast development and function, including respiration, chlorophyll biosynthesis, and photosynthetic electron transfer (Leonhardt and Straus, 1994
Plant Materials, Growth Conditions, and Transformation of Plants
Arabidopsis (Arabidopsis thaliana) Col-0 and C24 ecotypes were used in this study. The kor1-2 mutant is in the C24 background (Zuo et al., 2000
In vitro regeneration of shoots from root explants was carried out as previously described (Sun et al., 2003
Search for putative cis-acting regulatory elements in the AtFRO6 promoter was performed using PlantCARE as described (Lescot et al., 2002
Plasmid construction was performed by standard methods (Sambrook and Russell, 2001 The AtFRO6 (At5g49730) promoter sequence was obtained by PCR amplification of a 1.1-kb DNA fragment, which included the entire promoter (extended to the 3'-UTR of At5g49740), 5'-UTR, and a part of the coding sequence of AtFRO6. The PCR fragment was cloned into a pGEM-T vector (Promega) to yield pT-Ful. There are two StyI sites in this region, located at the 554 (Fig. 3A) and 31 bp downstream from the putative translation start codon, respectively. To construct pFul, a 1.1-kb DNA fragment released from pT-Ful by SalI and StyI (partially digested with StyI and then filled in by the Klenow enzyme; the StyI site is located between codons 10 and 11 of the AtFRO6 coding sequence) was ligated to SalI- and SmaI-digested pBI101-1 (CLONTECH). Therefore, the first 11 residues of AtFRO6 were in-frame fused to GUS. To make pT-Sty, pT-Ful was digested with SalI/StyI (partial digestion), blunted with Klenow enzyme, and then religated. After the religation, the StyI site was eliminated and the SalI site was maintained. pSty was made by a similar approach as for pFul. To make pHind, pFul was digested with SalI and HindIII, filled in by Klenow, and then religated. All other mutant constructs (internal deletions and substitutions) were first made in a pGEM-T vector by PCR using appropriate primers, and the mutant DNA fragments were then cloned into pFul using SalI and SnaBI sites (SnaBI is in the GUS coding region). All constructs were confirmed by DNA sequencing. Primer pairs used in PCR (all sequences are from 5'-end to 3'-end) were as follows: D0F (GGTCGACGATGCTCTCAAGGCCAAAGA) and ATGStyB1 (GAGTCCTTGGACAAAAGAGGGGTT; StyI site is underlined) for pFul; and D0F and Hind3B1 (GGGAATTCGCTTACATTACCTGAATCTGAACA; EcoRI site is underlined) for the distal fragments of pD1 to pD8. The proximal fragments of pD1 to pD8, which contained partial sequences of the AtFRO6 promoter and the GUS coding region, were amplified by using pFul plasmid DNA as a PCR template and the following forward primers: D1F, ATAATAACCATCTTATCTATACT; D2F, CTCAGTCTCTCACCTTACCCT; D3F, TTGAAATCAACCTAACGTGACAC; D4F, CAAGTACGTTACTCTCACGTGT; D5F, GACACTCTCATTTTTTTTTATAGTT; D6F, GTGTACTAGGATTGTTGTCCGA; D7F, TTCATAAATGAGAATGATAGAAACC; and D8F, GGTCCAGAAAATTTTACTTGACTC. GUSB2 (GGCGGGATAGTCTGCCAGTTCA; located 3'-end of SnaBI site) was used as a backward primer in all these reactions. These two sets of fragments were ligated using EcoRI sites, located in the backward primer Hind3B1 of the distal fragment (see above) and the pGEM-T vector immediately flanking the proximal fragments, respectively. To make pS1, the distal fragment was amplified by D0F and S1B (ACTCGAGTTAACACGTGAGAGTAA; XhoI site is underlined), and the proximal fragment was amplified by S1F (ACTCGAGTCCCATTTTTTTTTATAGTTTTTTTTATTGTG; XhoI site is underlined) and GUSB2. These two fragments were ligated using XhoI sites. To make pS2, the distal fragment was amplified by D0F and S2B (CCCCGGGTATAGTGTTTTTTATTGTGTAC; SmaI site is underlined), and the proximal fragment was amplified by S2F (ACCCGGGGATGAGAGTGTCATTAACA; SmaI site is underlined) and GUSB2. These two fragments were ligated using SmaI sites. For pD9 and pD10, S1B and S2B were used, combined with D0F, for the amplification of the distal fragments, respectively, which were then ligated to SalI- and SpeI-digested pD6 (SpeI site was derived from pGEM-T vector).
GUS activity was assayed by histochemical and fluorimetric analyses as described (Jefferson et al., 1987
RNA northern-blotting analyses were carried out as described previously (Sun et al., 2003
Expression of AtFRO5 through AtFRO8 was analyzed by real-time quantitative RT-PCR as described (Li et al., 2005
We thank the Arabidopsis Biological Resources Center for cDNA clones. We are grateful to Dr. Nam-Hai Chua of Rockefeller University for critically reading the manuscript. J.Z. acknowledges that this work was initiated in the lab of Dr. Nam-Hai Chua at Rockefeller University. Received November 15, 2005; returned for revision January 26, 2006; accepted February 6, 2006.
1 This work was supported by the National Natural Science Foundation (grant nos. 30125025 and 30221002 to J.Z.; grant nos. 30225029 and 30530460 to H.-Q.L.), by the Chinese Academy of Sciences (grant no. KSCX2SW308 to J.Z.), and by HarvestPlus Program-China (to H.-Q.L.).
2 These authors contributed equally to the paper. The author responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors (www.plantphysiol.org) is: Jianru Zuo (jrzuo{at}genetics.ac.cn). Article, publication date, and citation information can be found at www.plantphysiol.org/cgi/doi/10.1104/pp.105.074138. * Corresponding author; e-mail jrzuo{at}genetics.ac.cn; fax 861064873428.
Aro EM, Virgin I, Andersson B (1993) Photoinhibition of Photosystem II. Inactivation, protein damage and turnover. Biochim Biophys Acta 1143: 113134[Medline] Brüggemann W, Maas-Kantel K, Moog P (1993) Iron uptake by leaf mesophyll cells: the role of the plasma membrane-bound ferric-chelate reductase. Planta 190: 151155 Che P, Gingerich DJ, Lall S, Howell SH (2002) Global and hormone-induced gene expression changes during shoot development in Arabidopsis. Plant Cell 14: 27712785 Clough SJ, Bent AF (1998) Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J 16: 735743[CrossRef][Web of Science][Medline] Cody GD, Boctor NZ, Filley TR, Hazen RM, Scott JH, Sharma A, Yoder HS Jr (2000) Primordial carbonylated iron-sulfur compounds and the synthesis of pyruvate. Science 289: 13371340 Colangelo EP, Guerinot ML (2004) The essential basic helix-loop-helix protein FIT1 is required for the iron deficiency response. Plant Cell 16: 34003412 Connolly EL, Fett JP, Guerinot ML (2002) Expression of the IRT1 metal transporter is controlled by metals at the levels of transcript and protein accumulation. Plant Cell 14: 13471357 Curie C, Alonso JM, Le Jean M, Ecker JR, Briat JF (2000) Involvement of NRAMP1 from Arabidopsis thaliana in iron transport. Biochem J 347: 749755[CrossRef][Web of Science][Medline] Dancis A, Klausner RD, Hinnebusch AG, Barriocanal JG (1990) Genetic evidence that ferric reductase is required for iron uptake in Saccharomyces cerevisiae. Mol Cell Biol 10: 22942301 Datta N, Cashmore AR (1989) Binding of a pea nuclear protein to promoters of certain photoregulated genes is modulated by phosphorylation. Plant Cell 1: 10691077 de la Guardia MD, Alcantara E (1996) Ferric chelate reduction by sunflower (Helianthus annuus L.) leaves: influence of light, oxygen, iron deficiency and leaf age. J Exp Bot 47: 669675 Donald RG, Schindler U, Batschauer A, Cashmore AR (1990) The plant G box promoter sequence activates transcription in Saccharomyces cerevisiae and is bound in vitro by a yeast activity similar to GBF, the plant G box binding factor. EMBO J 9: 17271735[Web of Science][Medline] Eide D, Broderius M, Fett J, Guerinot ML (1996) A novel iron-regulated metal transporter from plants identified by functional expression in yeast. Proc Natl Acad Sci USA 93: 56245628 Fleming MD, Trenor CC III, Su MA, Foernzler D, Beier DR, Dietrich WF, Andrews NC (1997) Microcytic anaemia mice have a mutation in Nramp2, a candidate iron transporter gene. Nat Genet 16: 383386[CrossRef][Web of Science][Medline] Fujita T, Kouchi H, Ichikawa T, Syono K (1994) Cloning of cDNAs for genes that are specifically or preferentially expressed during the development of tobacco genetic tumors. Plant J 5: 645654[Medline] Ghassemian M, Wong B, Ferreira F, Markley JL, Straus NA (1994) Cloning, sequencing and transcriptional studies of the genes for cytochrome c-553 and plastocyanin from Anabaena sp. PCC 7120. Microbiology 140: 11511159 Giuliano G, Pichersky E, Malik VS, Timko MP, Scolnik PA, Cashmore AR (1988) An evolutionarily conserved protein binding sequence upstream of a plant light-regulated gene. Proc Natl Acad Sci USA 85: 70897093 Gonzalez-Vallejo EB, Morales F, Cistue L, Abadia A, Abadia J (2000) Iron deficiency decreases the Fe(III)-chelate reducing activity of leaf protoplasts. Plant Physiol 122: 337344 Guerinot ML, Yi Y (1994) Iron: nutritious, noxious, and not readily available. Plant Physiol 104: 815820[CrossRef][Web of Science][Medline] Gunshin H, Mackenzie B, Berger UV, Gunshin Y, Romero MF, Boron WF, Nussberger S, Gollan JL, Hediger MA (1997) Cloning and characterization of a mammalian proton-coupled metal-ion transporter. Nature 388: 482488[CrossRef][Medline] Hell R, Stephan UW (2003) Iron uptake, trafficking and homeostasis in plants. Planta 216: 541551[Web of Science][Medline] Henriques R, Jasik J, Klein M, Martinoia E, Feller U, Schell J, Pais MS, Koncz C (2002) Knock-out of Arabidopsis metal transporter gene IRT1 results in iron deficiency accompanied by cell differentiation defects. Plant Mol Biol 50: 587597[CrossRef][Web of Science][Medline] Isaac IS, Dawson JH (1999) Haem iron-containing peroxidases. Essays Biochem 34: 5169[Medline] Jakoby M, Wang HY, Reidt W, Weisshaar B, Bauer P (2004) FRU (BHLH029) is required for induction of iron mobilization genes in Arabidopsis thaliana. FEBS Lett 577: 528534[CrossRef][Web of Science][Medline] Jefferson R, Kavanagh T, Bevan MW (1987) GUS fusion: Koncz C, Martini N, Mayerhofer R, Koncz-Kalman Z, Korber H, Redei GP, Schell J (1989) High-frequency T-DNA-mediated gene tagging in plants. Proc Natl Acad Sci USA 86: 84678471 Lam E, Chua NH (1989) ASF-2: a factor that binds to the cauliflower mosaic virus 35S promoter and a conserved GATA motif in Cab promoters. Plant Cell 1: 11471156 Leonhardt K, Straus NA (1994) Photosystem II genes isiA, psbDI and psbC in Anabaena sp. PCC 7120: cloning, sequencing and the transcriptional regulation in iron-stressed and iron-repleted cells. Plant Mol Biol 24: 6373[CrossRef][Web of Science][Medline] Lescot M, Dehais P, Thijs G, Marchal K, Moreau Y, Van de Peer Y, Rouze P, Rombauts S (2002) PlantCARE, a database of plant cis-acting regulatory elements and a portal to tools for in silico analysis of promoter sequences. Nucleic Acids Res 30: 325327 Li L, Cheng X, Ling HQ (2004) Isolation and characterization of Fe(III)-chelate reductase gene LeFRO1 in tomato. Plant Mol Biol 54: 125136[CrossRef][Web of Science][Medline] Li X-B, Fan X-P, Wang X-L, Cai L, Yang W-C (2005) The cotton ACTIN1 gene is functionally expressed in fibers and participates in fiber elongation. Plant Cell 17: 859875 Ling HQ, Bauer P, Bereczky Z, Keller B, Ganal M (2002) The tomato fer gene encoding a bHLH protein controls iron-uptake responses in roots. Proc Natl Acad Sci USA 99: 1393813943 Ling HQ, Koch G, Baumlein H, Ganal MW (1999) Map-based cloning of chloronerva, a gene involved in iron uptake of higher plants encoding nicotianamine synthase. Proc Natl Acad Sci USA 96: 70987103 Marschner H (1995) Mineral Nutrition of Higher Plants. Academic Press, San Diego Matsunaga I, Shiro Y (2004) Peroxide-utilizing biocatalysts: structural and functional diversity of heme-containing enzymes. Curr Opin Chem Biol 8: 127132[CrossRef][Web of Science][Medline] Michel KP, Pistorius EK (2004) Adaptation of the photosynthetic electron transport chain in cyanobacteria to iron deficiency: the function of IdiA and IsiA. Physiol Plant 120: 3650[CrossRef][Medline] Partridge J, Wallace DF, Raja KB, Dooley JS, Walker AP (1998) Monocyte-macrophage ferric reductase activity is inhibited by iron and stimulated by cellular differentiation. Biochem J 336: 541543[Medline] Puente P, Wei N, Deng XW (1996) Combinatorial interplay of promoter elements constitutes the minimal determinants for light and developmental control of gene expression in Arabidopsis. EMBO J 15: 37323743[Web of Science][Medline] Robinson NJ, Procter CM, Connolly EL, Guerinot ML (1999) A ferric-chelate reductase for iron uptake from soils. Nature 397: 694697[CrossRef] Roman DG, Dancis A, Anderson GJ, Klausner RD (1993) The fission yeast ferric reductase gene frp1+ is required for ferric iron uptake and is homologous to the gp91-phox subunit of the human NADPH phagocyte oxidoreductase. Mol Cell Biol 13: 43424350 Römheld V, Marschner H (1986) Evidence for a specific uptake system for iron phytosiderophores in roots of grasses. Plant Physiol 80: 175180 Sambrook J, Russell DW (2001) Molecular Cloning, Ed 3. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY Sugiyama M (1999) Organogenesis in vitro. Curr Opin Plant Biol 2: 6164[CrossRef][Web of Science][Medline] Sun J, Niu QW, Tarkowski P, Zheng B, Tarkowska D, Sandberg G, Chua NH, Zuo J (2003) The Arabidopsis AtIPT8/PGA22 gene encodes an isopentenyl transferase that is involved in de novo cytokinin biosynthesis. Plant Physiol 131: 167176 Terzaghi WB, Cashmore AR (1995) Photomorphogenesis. Seeing the light in plant development. Curr Biol 5: 466468[CrossRef][Web of Science][Medline] Thomine S, Wang R, Ward JM, Crawford NM, Schroeder JI (2000) Cadmium and iron transport by members of a plant metal transporter family in Arabidopsis with homology to Nramp genes. Proc Natl Acad Sci USA 97: 49914996 Tjaden G, Coruzzi GM (1994) A novel AT-rich DNA binding protein that combines an HMG I-like DNA binding domain with a putative transcription domain. Plant Cell 6: 107118[Abstract] Varotto C, Maiwald D, Pesaresi P, Jahns P, Salamini F, Leister D (2002) The metal ion transporter IRT1 is necessary for iron homeostasis and efficient photosynthesis in Arabidopsis thaliana. Plant J 31: 589599[CrossRef][Web of Science][Medline] Vert G, Grotz N, Dedaldechamp F, Gaymard F, Guerinot ML, Briat JF, Curie C (2002) IRT1, an Arabidopsis transporter essential for iron uptake from the soil and for plant growth. Plant Cell 14: 12231233 Villain P, Mache R, Zhou DX (1996) The mechanism of GT element-mediated cell type-specific transcriptional control. J Biol Chem 271: 3259332598 Waters BM, Blevins DG, Eide DJ (2002) Characterization of FRO1, a pea ferric-chelate reductase involved in root iron acquisition. Plant Physiol 129: 8594 Wu H, Li L, Du J, Yuan Y, Cheng X, Ling HQ (2005) Molecular and biochemical characterization of the Fe(III) chelate reductase gene family in Arabidopsis thaliana. Plant Cell Physiol 46: 15051514 Yuan YX, Zhang J, Wang DW, Ling HQ (2005) AtbHLH29 of Arabidopsis thaliana is a functional ortholog of tomato FER involved in controlling iron acquisition in strategy I plants. Cell Res 15: 613621[CrossRef][Web of Science][Medline] Zuo J, Niu QW, Nishizawa N, Wu Y, Kost B, Chua NH (2000) KORRIGAN, an Arabidopsis endo-1,4- This article has been cited by other articles:
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ASPB Publications | PLANT PHYSIOLOGY® | THE PLANT CELL | |
|---|---|---|---|