|
|
||||||||
|
First published online February 3, 2006; 10.1104/pp.105.074039 Plant Physiology 140:1418-1436 (2006) © 2006 American Society of Plant Biologists Comparative Analysis of the Heat Stable Proteome of Radicles of Medicago truncatula Seeds during Germination Identifies Late Embryogenesis Abundant Proteins Associated with Desiccation Tolerance1,[W]Unité Mixte de Recherche 1191, Physiologie Moléculaire des Semences (Université d'Angers, Institut National d'Horticulture, Institut National de la Recherche Agronomique), Anjou Recherche Semences, 49045 Angers, France (J. Boudet, J. Buitink, P.S., O.L.); Laboratory of Plant Physiology, Department of Plant Sciences, Wageningen University, 6703 BD Wageningen, The Netherlands (F.A.H.); and Unité de Recherche, Biopolymères, Interactions, Allergie, Institut National de la Recherche Agronomique, 44316 Nantes, France (H.R., C.L.)
A proteomic analysis was performed on the heat stable protein fraction of imbibed radicles of Medicago truncatula seeds to investigate whether proteins can be identified that are specifically linked to desiccation tolerance (DT). Radicles were compared before and after emergence (2.8 mm long) in association with the loss of DT, and after reinduction of DT by an osmotic treatment. To separate proteins induced by the osmotic treatment from those linked with DT, the comparison was extended to 5 mm long emerged radicles for which DT could no longer be reinduced, albeit that drought tolerance was increased. The abundance of 15 polypeptides was linked with DT, out of which 11 were identified as late embryogenesis abundant proteins from different groups: MtEm6 (group 1), one isoform of DHN3 (dehydrins), MtPM25 (group 5), and three members of group 3 (MP2, an isoform of PM18, and all the isoforms of SBP65). In silico analysis revealed that their expression is likely seed specific, except for DHN3. Other isoforms of DNH3 and PM18 as well as three isoforms of the dehydrin Budcar5 were associated with drought tolerance. Changes in the abundance of MtEm6 and MtPM25 in imbibed cotyledons during the loss of DT and in developing embryos during the acquisition of DT confirmed the link of these two proteins with DT. Fourier transform infrared spectroscopy revealed that the recombinant MtPM25 and MtEm6 exhibited a certain degree of order in the hydrated state, but that they became more structured by adopting helices and sheets during drying. A model is presented in which DT-linked late embryogenesis abundant proteins might exert different protective functions at high and low hydration levels.
Desiccation tolerance (DT) corresponds to the ability to survive nearly complete protoplasmic dehydration (approximately 300 MPa). This phenomenon is widespread across the plant kingdom, including ferns, mosses, pollen, and seeds as well as several whole angiosperms, the so-called resurrection plants. In orthodox seeds, DT is acquired during maturation approximately halfway through the seed-filling phase. Upon seed imbibition, emerging radicles are the first to lose their ability to tolerate air drying, followed by hypocotyls and cotyledons (Buitink et al., 2003
LEA proteins are classified in at least five groups by virtue of similarity in their amino acid sequences (Cuming, 1999
In addition to being present in anhydrobiotes, LEA proteins are also expressed in desiccation-sensitive vegetative tissues as a response to stress involving changes in cellular water potential (Cuming, 1999
To comprehend the changes in LEA proteins simultaneously, comparative proteomic analysis was carried out in desiccation-tolerant and -sensitive radicles during germination. In addition, this approach allows to assess whether putative posttranslational modifications are also associated with DT, considering that some LEA proteins from groups 1, 2, and 3 are submitted to posttranscriptional and posttranslational modifications during seed maturation and germination (Bies et al., 1998
Several transcriptomic and proteomic analyses both during seed development (Gallardo et al., 2003
Changes in HS Protein Patterns in Relation to the Loss and Reestablishment of DT
In seeds of M. truncatula, DT of the radicle is maintained during the early phase of imbibition and is lost when the radicle protrudes the seed coat (Table I
). Germinated seeds with 2.8 mm long protruded radicles are not able to survive a 3 d drying at 42% relative humidity (RH) at 20°C (Table I). Previously, Buitink et al. (2003)
To identify proteins involved in DT, we compared the HS proteome extracted from 2.8 mm long, desiccation-sensitive radicles with those from 16 h-imbibed NG desiccation-tolerant radicles. To validate whether putative candidates were linked to DT, the HS proteome was also analyzed from PEG-treated 2.8 mm radicles, in which DT was reestablished. In NG radicles, the weight fraction of the HS proteome corresponded to 28% of the total soluble proteins. During germination, the amount of HS proteins decreased 2.3-fold (Table I). The osmotic treatment did not reverse this decrease; the amount of HS proteins in PEG-treated radicles represented 15% of the total soluble proteins. The HS fractions from the three stages were analyzed by two-dimensional gel electrophoresis (2DE) using a nonlinear pI gradient (Fig. 1 ). For each stage, the spots from six to eight replicates were detected and compared to each other using the PDQuest software. To secure the quality of the data, spots of poor quality and very low raw volumes were discarded using criteria set by the software. Furthermore, to be included in the statistical analysis, each spot had to be present in at least 50% of the gel replicates. In total, 391 spots satisfied these criteria and were included in the reference gel. The number of detected spots differed significantly among the stages (Table I). Concurrent with the decrease in the proportion of the HS fraction, the number of spots decreased from 328 to 252 during the loss of DT (Table I). In contrast, the PEG-induced reestablishment of DT led to a slight increase in the spot number (Table I). A nested ANOVA and the Student-Newman-Keuls test (P < 0.05) classified 376 spots out of the 391 spots in nine expression profiles (Table II ). For the remaining 15 spots, the Student-Newman-Keuls test did not reveal a significant difference in contrast to the nested ANOVA, which gives a better estimate of the residual variance. Out of the 376 spots, only 54 remained constant in the three stages (Table II). The profile with the highest number of spots (profile 2) represented those spots that were more abundant in the desiccation-tolerant NG stage compared to the other two stages. Only 5.9% (23) of the total detected spots had an expression profile associated with DT, that is, they were significantly more abundant in NG and PEG-treated 2.8 mm radicles than in the untreated, 2.8 mm sensitive radicles (Table II, profile 9). There were 32 spots that were associated with desiccation sensitivity, being more abundant in the 2.8 mm radicles: they represented 8% of the total amount spots. Another interesting group of spots are those found in profile 4, whose abundance increased significantly upon the PEG treatment (44 spots, 11.2%).
Discrimination between the Desiccation-Tolerant Proteome and the Osmotically Induced Proteome A total of 23 spots showed a higher abundance in both desiccation-tolerant stages compared to the sensitive stage (profile 9, Table II). These spots were further analyzed using two additional stages: 5 mm long, desiccation-sensitive emerged radicles before and after a PEG treatment (Table I). As a result, the spots could be separated in two subgroups: those that are only induced in the 2.8 mm long radicles after PEG treatment and are thus linked specifically to DT (subgroup A) and those that are also induced by the PEG incubation in 5 mm long radicles that remain desiccation sensitive (subgroup B). Out of the 23 spots, 11 were found to be associated specifically with the induction of DT (subgroup A) and seven were induced both in 2.8 and 5 mm long PEG-treated radicles (subgroup B), albeit not always to similar levels in both tissues. Among these seven spots, five exhibited a significantly higher intensity in 2.8 mm PEG-treated radicles than in the 5 mm ones. They were therefore also linked to DT. The remaining five spots could not be categorized in either of these two groups and are not further considered in this study.
It is noteworthy that, although the PEG incubation of the 5 mm long radicles did not lead to the reestablishment of DT, this treatment did result in an improvement of the tolerance to drying. This is demonstrated by the assessment of the water content to which 50% of the population of germinated seeds can be dried and rehydrated without loss of viability of their radicle (threshold water content, Fig. 2
; Table I). Germinated seeds with an emerged radicle of 2.8 mm long were able to survive a desiccation treatment down to 1 g/g, but died at lower water content. Fifty percent of survival was obtained at 0.3 g/g (Table I). After the PEG treatment, 2.8 mm long emerged radicles were able to survive nearly complete removal of water and were thus considered desiccation tolerant (Fig. 2). In contrast, 5 mm long radicles were very sensitive to drying. Fifty percent of death was obtained when the radicles were dried to 3.6 g/g. However, after a 2 d incubation in the osmoticum, they had become more tolerant to desiccation since the threshold water content decreased to 0.8 g/g (Table I). Whitsitt et al. (1997)
The 16 spots belonging to profile 9A and 9B and linked with DT were analyzed using matrix-assisted laser desorption ionization time of flight (MALDI-TOF) mass spectrometry and liquid chromatography-tandem mass spectrometry (LC-MS/MS). Out of these 16 spots, 11 were identified as six different LEA proteins, some of them being present as different isoforms (Table III
). Another polypeptide was identified as a homolog of a pea (Pisum sativum) legumin precursor (Table III). Since the Mr of this spot was much lower than expected, we suspected that the onset of the digestion of storage proteins, which is known to occur during radicle growth (Capron et al., 2000
To find out to which groups the identified LEA proteins linked to DT belong to, a phylogenetic tree was constructed with LEA proteins of M. truncatula after a search in The Institute for Genomic Research (http://www.tigr.org/tdb/mtgi) and National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov) databases using a set of keywords and the PFam domains characteristic of plant LEA proteins (http://www.sanger.ac.uk/Software/Pfam/index.shtml). Twenty-five genes were obtained and a phylogenetic tree with the protein sequences was generated using ClustalX (Thompson et al., 1997
Analysis of the changes in relative volume of Em6 and PM25 (Fig. 4, B and D ) demonstrated that the PEG treatment significantly reinduced the expression of both proteins in the 2.8 mm long emerged radicles. Nonetheless, the reestablishment of DT did not lead to a similar reinduction of the protein abundance as was the case in the NG, desiccation-tolerant seeds. The three DT-linked LEA proteins that belong to group 3 (MP2, PM18, and SBP65) were present as several isoforms, mainly differing in pI (Figs. 4 and 5 ). Based on the statistical analysis of their normalized intensities, they were categorized in different profiles. MP2 was present in two forms (Fig. 4, E and F); the most abundant one was linked to DT (spot 19) whereas a very faint spot (20) was classified in profile 4 (i.e. induced by the PEG treatment only in 2.8 mm long PEG-treated radicles; data not shown; Supplemental Table I). Three spots corresponding to PM18 (spots 15, 16, and 17) showed a different expression profile (Fig. 5A). Spot 16 (Fig. 5, A and B) was found to be linked to DT whereas the most acidic polypeptide (15) increased upon osmotic treatment regardless of whether full DT is induced or not (profile 9B, Fig. 5B). The most basic spot (18) did not vary significantly between NG and 2.8 mm radicles, but decreased in the 5 mm long protruded ones. Furthermore, it did not respond to the PEG treatment (Fig. 5B). A similar pattern was observed for spot 17. It was tentatively identified as a fourth isoform of PM18 because the experimental trypsin digestion before the MALDI-TOF analysis produced four digested peptides, the masses of which matched some obtained by the theoretical digestion of the translated Medicago tentative consensus (TC) similar to PM18. The third member of group 3, SBP65, existed in six isoforms with different pIs (spots 15, Fig. 5, C and D) and Mr (spot 6, Fig. 1). Again, the different isoforms were classified in two profiles: 9A, reinduced only in 2.8 mm long PEG-treated radicles and 9B, also reinduced in 5 mm long PEG-treated radicles (Fig. 5D). Nonetheless, for all isoforms, the abundance was significantly higher in those tissues that were desiccation tolerant than in those that remained sensitive.
Another group of proteins that show an interesting profile are those being induced upon osmotic stress in protruded radicles of both stages, belonging to profile 4 (Table II). The two dehydrins (group 2) that were identified in this profile were DHN3 and BudCar5, both being present in several isoforms (Fig. 6 ). DHN3 was present in three isoforms (spots 1113, Fig. 6, A and B). The abundance of the two most basic forms (spots 12 and 13) increased as a response to the PEG treatment only in the 2.8 mm long radicles. In contrast, the most acidic form (11) responded to the osmotic treatment by increasing approximately 2-fold both in 2.8 and 5 mm radicles. Spot 11 was classified in profile 9B (Table II) as mentioned earlier. The amount of all Budcar5 isoforms (spots 3133) increased sharply upon the PEG incubation (Fig. 6, C and D). Dehydrins are known to be expressed under different types of stress and in different tissues, thus their induction upon PEG incubation was expected.
To investigate whether the six DT-linked LEA proteins were seed specific or expressed in different tissues and/or under different stress conditions, their gene expression was analyzed in silico. Also added to this analysis were two additional LEA proteins: CapLea1 (TC100264), a group 3 LEA protein representing the largest amount of the HS fraction but whose levels remained constant in the radicles of different stages (spot 34, Fig. 1), and BudCar5. In silico gene expression was expressed as the number of expressed sequence tags (ESTs) corresponding to the LEA proteins based on the total number of ESTs present in the particular cDNA library. Thirty-four libraries representing different organs submitted or not to drought, nutrient and biotic stresses, developing seeds at different stages, and germinating seeds were selected and pooled into nine groups (Fig. 7 ; Supplemental Table II). Except for DHN3, the remaining five LEA proteins that were identified in relation to DT appeared to be seed specific (Fig. 7). DHN3 was expressed in several libraries, mainly in drought-stressed leaves. The expression of BudCar5 was detected in all the libraries studied. The in silico expression analysis of all the LEA proteins shown in the phylogenetic tree (Fig. 3) revealed that all LEA genes from groups 1 to 4 that were specifically expressed in seeds (Supplemental Table II) were found to be linked to DT in this study. Only three other members of group 5 and Lea5 (no classification) that were present in the seed libraries were not detected here. Furthermore, only two of the 23 known LEA genes (DIP, a dehydrin and CapLea1B, member of group 3) were not present in at least one of the seed libraries (Supplemental Table II).
Whether the digestion of storage proteins yielded hydrophilic peptides during germination and PEG incubation was further assessed by excising and identifying spots of low mass from gels of radicles of NG seeds and 2.8 mm long emerged radicles of germinated seeds. Spots 35 and 40 (Fig. 1, Mr around 16,000) were also identified as homologs to the pea legumin precursor (theoretical Mr 65,000, TC85216). Four spots (22, 23, 24, and 25; Mr around 31,000; Fig. 1) were identified as homologs of the pea convicilin (TC100299) having a theoretical Mr of 78,300. These fragments of storage proteins belonged to profiles 2, 3, and 5 (Table II) and were not very abundant. Likewise, the HS proteome included proteins other than LEA proteins (for example, homologs of a Vicia faba transcription factor [TC94137], an ankyrin repeat protein 2 from Vitis aestivalis [TC100495], and a Gly-rich protein 2 of Nicotiana sylvestris [TC98399]; see Supplemental Table I).
The expression profiles of two of the six LEA proteins that were linked to DT were further characterized to confirm the data obtained from the 2D proteomic analysis. The analysis was extended to cotyledons during germination and embryos during seed development to ascertain the abundance of these LEA proteins with DT. MtPM25 and MtEm6 were chosen because they were represented by a single spot in the gels, thereby alleviating any complication with the interpretation of western blots that were performed in one dimension. Full-length cDNAs corresponding to the MtPM25 (DQ206870) and MtEm6 (DQ206712) were obtained by RACE. Sequences corresponding to an N-terminal poly-HIS tag and cleavage site for enterokinase were added to the full-length encoding sequence and the recombinant proteins were expressed in Escherichia coli. Rabbit polyclonal antibodies were raised against the purified recombinant MtPM25 and MtEm6. For each antibody, a signal at the expected molecular size was detected both with protein extracts from radicles and the recombinant protein. The signals were absent when the preimmune serums were used (data not shown). During seed imbibition, contents of both MtPM25 and MtEm6 in the radicles remained high for up to 15 h (Fig. 8, A and E ). In 20 h imbibed radicles (approximately 2.8 mm in length), MtPM25 was barely detectable, whereas MtEm6 had already disappeared. In accordance with the proteomic analysis, the osmotic treatment was found to reinduce the expression of both proteins in 2.8 mm long emerged radicles, albeit to lower levels than those found in NG radicles (Fig. 8, C and G). In 5 mm long radicles, the PEG treatment only resulted in the appearance of a very faint signal. The relationship between DT and the presence of both proteins was also confirmed for the cotyledons during germination (Fig. 8, B and F). In contrast to radicles, DT in cotyledons was maintained for up to 24 h of imbibition and lost at 48 h. In parallel, MtEm6 and MtPM25 amounts decreased to barely detectable levels and disappeared. During seed development, tolerance to rapid enforced drying was acquired between 14 and 22 d after pollination (DAP; Fig. 8). Contents of MtPM25 increased at 14 DAP in parallel with the acquisition of DT (Fig. 8D), whereas those of MtEm6 started to accumulate later at 18 DAP.
Secondary Structure Analysis of MtPM25 and MtEm6 Proteins
It has been established that LEA proteins of groups 3 and 4 undergo an unordered-to-ordered structure transition during the loss of water (Wolkers et al., 2001
Superficial inspection of the IR spectrum in the amide-I region (Fig. 9) revealed that in D2O the proteins displayed a broadened band at a wavenumber position (1,460 cm1) that was lower than in the case of the fast-dried proteins (1,550 cm1). This behavior in D2O may be partly due to 2H exchange with protons in the protein backbone, which is particularly likely in unordered structures (Raussens et al., 1997 -helical content. In the fast-dried MtPM25, there is evidence of a shoulder at approximately 1,630 cm1, which is less prominent in the fast-dried MtEm6. This is suggestive of a larger proportion of intermolecular sheet in MtPM25 than in MtEm6 after fast drying. Finally, slow drying led to an increase in this structure for MtPM25, which is not observed for MtEm6. An additional slow-drying experiment was performed at 85% RH over a KCl saturated solution. In this case, the conformation remains similar to that after fast drying, indicating that the increase in -sheet structure occurs below 85% RH.
More detailed information on secondary structures in these proteins was obtained by a curve-fitting procedure on the original amide-I band according to Wolkers et al. (2001)
Table IV further shows that either fast or slow drying led to a considerable increase in -helical structure in both proteins at the expense of the unordered structures. This intramolecular rearrangement apparently was independent of the rate of drying. In contrast to MtEm6, MtPM25 tended to form extended sheets upon slow drying, which appeared to be reversible upon rehydration. When indicated as percentages of helix, sheet, and unordered structures, MtEm6 consisted of 57%, 12%, and 31%, and 60%, 8%, and 32%, after fast and slow drying, respectively. Data for MtPM25 were 54%, 17%, and 29%, and 56%, 25%, and 19%, respectively.
To identify proteins involved in DT, a proteomic screening of the HS fraction of soluble proteins from imbibed radicles of M. truncatula was combined with a physiological system that enables the reestablishment of DT in 2.8 mm long emerged radicles by an osmotic treatment. To separate the proteins induced by the osmoticum from those involved in DT, the comparison was extended to emerged radicles of 5 mm long, for which DT could no longer be reinduced by the same osmotic treatment. In total, 15 polypeptides were found, whose abundance was linked to DT. Among them 11 were identified, which represented six LEA proteins from different groups: MtEm6 (group 1), one isoform of DHN3 (dehydrins), MtPM25 (group 5), and three members of group 3 (MP2, the basic isoform of PM18, and all the isoforms of SBP65 ;Table III). Our in silico analysis revealed that the expression of all the DT-linked LEA genes was apparently seed specific, except for one isoform of DHN3.
The abundance of all these proteins was associated with DT (Figs. 4, 5, and 8). Nonetheless, the causal relationship between the six LEA proteins and DT remains difficult to assess. It is possible to obtain dry and viable seeds from Arabidopsis and maize mutants with very low or undetectable levels of Em transcripts (Williams and Tsang, 1991
This study also identified several LEA proteins that are linked to drought tolerance rather than DT, such as several isoforms of DHN3 (spots 12 and 13) as well as isoforms of BudCar5 (Fig. 6). Indeed, the isoforms of these dehydrins were induced not only in the 2.8 mm long radicles after PEG incubation, but also in the 5 mm long PEG-treated radicles. However, although the treatment on the 5 mm long radicles did not reestablish DT, it did lead nevertheless to an increased tolerance to drying, evident from the reduction in the threshold water content from 3.6 to 0.8 g/g. In silico analysis shows that both dehydrin genes are expressed in drought-stressed plants as well (Fig. 7). This observation concurs with those of Black et al. (1999)
Group 5 LEA proteins, to which MtPM25 belongs, have been reported to be a peculiar group, with low hydrophilicity and absence of heat stability (Cuming, 1999
Considering that MtEm6 and MtPM25 are hypothesized to play a role in the dry state, their conformation was also determined after drying. The removal of the water induced a transition from a fairly disordered conformation to the formation of a considerable amount of ordered structures (Table IV). Our study suggests that this behavior is yet another feature that now appears to be common to all LEA proteins. Indeed, originally observed for the groups 3 and 4 LEA proteins mentioned above, this study shows that it is also the case for members of groups 1 and 5. Both proteins show an increase in their
So at which hydration level do these proteins gain structure? Slow drying over saturated salt solutions indicated that the proteins had to be dried below an equilibrium RH of 85% to observe a change in the secondary structure (
Both group 2 (DHN3 and BudCar5) and group 3 LEA proteins (MP2, PM18, and SBP65) were detected as several isoforms. This observation extends previous experimental evidence showing that dehydrins are submitted to posttranslational modifications such as phosphorylation during seed development and germination (Campalans et al., 2000
SBP65 exhibits a peculiar posttranscriptional modification. This DT-linked group 3 LEA protein is known to be biotinylated in seeds of a wide range of species (Dehaye et al., 1997
Using a computational analysis, it has been argued that LEA proteins are members of a larger family of stress proteins called hydrophilins that could be used as predictors of the responsiveness to osmotic adaptation in prokaryotes and eukaryotes (Garay-Arroyo et al., 2000 Altogether, the data reported in this study suggest that the LEA proteins expressed in seeds can be divided in two groups, those that are induced only in tissues that are desiccation tolerant, and those that are also induced in osmotically shocked radicles that remain desiccation sensitive but do increase their tolerance to drying. The first group contains LEA proteins that seem to be seed specific, based on electronic northerns, whereas the second group is represented by proteins that are also expressed in vegetative tissues. Possibly, the proteins that are linked to DT might protect both at high hydration levels and at very low water contents (<0.3 g/g). Further research should be focused on elucidating whether these proteins play a role at water contents where the proteins have gained further order in their secondary structures and whether their functions are regulated by posttranslational modifications.
Plant Material and Treatments
Seeds of Medicago truncatula Gaertn. (cv Paraggio; Seedco Australia) were allowed to imbibe on filter paper in distilled water at 20°C in the dark for up to 3 d. For the proteomic analysis, desiccation-tolerant stages were established as described in Buitink et al. (2003)
Plants were grown in a sterile mix of vermiculite and soil in a growth chamber at 24°C/21°C, 16 h photoperiod, at 350 µM m2 s2. Flowers were tagged and developing seeds were harvested as described in Gallardo et al. (2003)
Soluble proteins were extracted from 50 (western blots) and 100 to 300 (2DE) radicles at 4°C in 400 and 950 L of buffer, respectively (50 mM HEPES pH 8.0, 1 mM EDTA, and 14% [v/v] of the protease inhibitor cocktail complete Mini [Roche Diagnostics Molecular Biochemicals]), 43 units of Dnase I, and 5.3 units of Rnase A. After two consecutive centrifugations at 13,000g at 4°C, the resulting supernatant was heated for 10 min at 95°C, cooled for 15 min on ice, and centrifuged at 13,000g for 15 min at 4°C. The resulting supernatant corresponded to the HS fraction. Protein concentrations were assayed according to Bradford (1976)
Twenty-four centimeters of immobilized pH gradient (non linear from 310) strips (Bio-Rad) containing 500 µg of HS proteins were rehydrated at 50 V for 12 h at 20°C. Isoelectrofocusing ran at 20°C at 250 V for 5 h then at 8 kV until 60 kVh in a Bio-Rad Protean isoelectric focusing cell. Thereafter, a two-step equilibration was carried out by incubating each strip at room temperature in 8 mL of solution: first step, 15 min in a buffer containing 8 M urea, 375 mM Tris pH 8.8, 20% (v/v) glycerol, 2% (w/v) SDS, and 130 mM DTT; second step, 30 min in the same buffer with 250 mM iodoacetamide instead of DTT. Size separation of proteins was performed on vertical polyacrylamide gels (12% [w/v] acrylamide) in a Ettan Daltsix Electrophoresis system (Amersham Biosciences) according to Gallardo et al. (2001)
Gels were stained with 0.08% (w/v) Brilliant Blue G-Colloidal for 24 h, destained briefly in 5% (v/v) acetic acid and 25% (v/v) methanol then in 25% (v/v) methanol for 8 h. Stained gels were scanned at 95.3 x 95.3 resolution with an optical density range of 0.05 to 3.13 using a GS 800 scanner (Bio-Rad). Digitalized gels were analyzed using the PDQuest 7.1 software (Bio-Rad). Images were filtered (mode pepper outlier 7 x 7). To identify differentially expressed protein spots, the gels corresponding to the NG, 2.8 mm and 2.8 mm + PEG stages were first compared using a representative gel of the NG stage as the reference gel. After optimization of the parameters for background subtraction and spot detection, the spots that were not present in at least 50% of the gels and those exhibiting a quality below the set value of 20% (maximum value being 100%) were discarded. After spot matching, spot intensities were normalized using the total quantity in valid spot method: the quantity of each spot in a gel is divided by the total quantity of all the spots in the reference gel. The statistical method of Schiltz et al. (2004)
Spots of interest were excised from the 2DE gels and subjected to in-gel tryptic digestion as described in Wilm et al. (1996)
Expression vectors for the overexpression of MtPM25 and MtEm6 proteins in Escherichia coli were constructed using the Gateway technology (Invitrogen). Full-length cDNA was amplified by PCR using a forward primer with an attB1 sequence (MtPM25_F: GGGGACAAGTTTGTACAAAAAAGCAGGCTTAGATTACAAGGATGATGATGATAAGATGAGTCAAGAACAACCAAG and MtEm6_F: GGGGACAAGTTTGTACAAAAAAGCAGGCTCGATGGGGCATCATCATCATCTAAACAACAAAACCG) followed by an additional sequence encoding the FLAG epitope and digestion site for enterokinase (DYKDDDK) just prior to the start codon and a reverse primer with an AttB2 sequence flanking the stop codon (MtPM25_R: GGGGACCACTTTGTACAAGAAAGCTGGGTCTTACTTAACATTTTCATTGAGCCTAGCAGCCGCA and MtEm6_R: GGGGACCACTTTGTACAAGAAAGCTGGGTTCACTTGTTCTGGCTCCTAC). PCRs and in vitro BP and LR clonase recombination reactions were carried out according to the manufacturer's instructions (Invitrogen) using pDON207, and as destination vector pDEST17 (Invitrogen). pDEST17 contains an N-terminal 6xHis-tag. pDEST17-PM25 and pDEST17-Em6 were transferred into BL21-AI competent cells (Invitrogen) and recombinant protein production was induced in the presence of 0.2% (w/v) Ara at 37°C. Bacterial proteins were extracted by sonication in 50 mM NaH2PO4 pH 8, 300 mM NaCl, 10 mM imidazol, and 1 mM phenylmethylsulfonyl fluoride. The 6xHis-tagged recombinant proteins were purified by nickel-nitrilotriacetic acid agarose (Ni-NTA) affinity chromatography (Ni-NTA Superflow, Qiagen) under native conditions according to the manufacturer's instructions. After digestion by enterokinase (EKMax, Invitrogen) according to the manufacturer's instructions, MtPM25 and MtEm6 recombinant proteins were separated from their tag by Ni-NTA affinity chromatography, desalted, and lyophilized.
Twenty micrograms of proteins per sample were separated by SDS-PAGE using 12% (w/v) acrylamide separating gels. Following electrophoresis, the gels were transferred onto nitrocellulose membranes (Schleicher and Schuell) for 1 h at 100 V in 25 mM Tris (pH 8.3), 192 mM Gly, and 20% (v/v) methanol using a mini-transblot system (Bio-Rad). The membrane was then blocked with Tris-buffered saline (TBS; 10 mM Tris-HCl pH 7.5 and NaCl 150 mM) containing 1.5% Tween 20 for 45 min under constant agitation and rinsed several times with TBS containing 0.05% (v/v) Tween 20 (TBST). The membrane was incubated for 1 h at room temperature with a rabbit polyclonal antibody raised against MtPM25 or MtEm6 (dilution 1:10,000 in TBST). After washing in TBST, the membrane was incubated for 1 h with an antirabbit IgG peroxidase conjugate (Biosource International) diluted 1:50,000 in TBST. After washing in TBST and TBS, immunodetection was performed by chemiluminescence according to Grelet et al. (2005)
Dry protein films were prepared by drying 5 µL droplets of a solution of lyophilized protein in water (20 mg/mL) on circular (2 x 13 mm) CaF2 IR windows at 25°C. Fast drying was carried out in a stream of dry air (3% RH) and slow drying above saturated NH4NO3 (67% RH) in a ventilated box. The protein films lost most of their water within 5 min and 1 h, respectively, but the samples were left overnight under these conditions before analysis. Protein samples in D2O were obtained by adding 0.5 µL D2O to the fast-dried specimens. Each sample was hermetically sealed between IR windows using a rubber O ring and mounted into a brass holder. These procedures were performed in a cabin continuously purged with dry air (3% RH) to prevent rehydration of dry samples and exchange with water vapor in the case of samples in D2O. IR spectra were recorded at room temperature on a FTIR spectrometer (Perkin-Elmer, model 1725) equipped with a liquid nitrogen-cooled mercury/cadmium/telluride detector and a Perkin-Elmer microscope as described previously (Wolkers and Hoekstra, 1995 Sequence data for MtPM25 and MtEm6 have been deposited with the GenBank data library under the respective accession numbers DQ206870 and DQ206712.
We thank J. Brettner (SeedCo Australia) for the gift of the seeds, N. Sommerer (Institute National de la Recherche Agronomique Montpellier) for preliminary MALDI-TOF analyses, and B. Ly-Vu (Institut National d'Horticulture) for dissecting the thousands of radicles used in this study. Received November 14, 2005; returned for revision January 8, 2006; accepted January 10, 2006.
1 This work was supported by grants from the Contrat de Plan Etat-Région-des Pays-de-la Loire 20002006, Institut National de la Recherche Agronomique, and Van Gogh Netherlands Organization for Scientific Research/EGIDE. The author responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors (www.plantphysiol.org) is: Olivier Leprince (olivier.leprince{at}inh.fr).
[W] The online version of this article contains Web-only data. Article, publication date, and citation information can be found at www.plantphysiol.org/cgi/doi/10.1104/pp.105.074039. * Corresponding author; e-mail olivier.leprince{at}inh.fr; fax 33241225549.
Allison SD, Chang B, Randolph TW, Carpenter JF (1999) Hydrogen bonding between sugar and protein is responsible for inhibition of dehydration-induced protein unfolding. Arch Biochem Biophys 365: 289298[CrossRef][Web of Science][Medline] Alsheikh MK, Svensson JT, Randall SK (2005) Phosphorylation regulated ion-binding is a property shared by the acidic subclass of dehydrins. Plant Cell Environ 28: 11141122[CrossRef] Arenas-Mena C, Raynal M, Borrell A, Varoquaux F, Cutanda MC, Stacy RAP, Pagès M, Delseny M, Culiañez-Macià FA (1999) Expression and cellular localization of Atrab 28 during Arabidopsis embryogenesis. Plant Mol Biol 40: 355363[Medline] Asirvatham VS, Watson BS, Sumner LW (2002) Analytical and biological variances associated with proteomic studies of Medicago truncatula by two-dimensional polyacrylamide gel electrophoresis. Proteomics 2: 960968[CrossRef][Medline] Avelange-Macherel M-H, Ly-Vu B, Delaunay J, Richomme P, Leprince O (2005) NMR metabolite profiling analysis reveals changes in phospholipid metabolism associated with the re-establishment of desiccation tolerance upon osmotic stress in germinated radicles of cucumber. Plant Cell Environ doi/10.1111/j.1365-3040.2005.01424.x Bateman A, Coin L, Durbin R, Finn RD, Hollich V, Griffiths-Jones S, Khanna A, Marshall M, Moxon S, Sonnhammer ELL, et al (2004) The Pfam protein families database. Nucleic Acids Res 32: D138D141 Battista JR, Park M-J, McLemore AE (2001) Inactivation of two homologues of proteins presumed to be involved in the desiccation tolerance of plants sensitizes Deinococcus radiodurans R1 to desiccation. Cryobiology 43: 133139[CrossRef][Medline] Bies N, Aspart L, Carles C, Gallois P, Delseny M (1998) Accumulation and degradation of Em proteins in Arabidopsis thaliana: evidence for post-transcriptional controls. J Exp Bot 49: 19251933 Black M, Corbineau F, Gee H, Côme D (1999) Water content, raffinose, and dehydrins in the induction of desiccation tolerance in immature wheat embryos. Plant Physiol 120: 463471 Blackman SA, Obendorf RL, Leopold AC (1995) Desiccation tolerance in developing soybean seedsthe role of stress proteins. Physiol Plant 93: 630638[CrossRef] Borrell A, Cutanda MC, Lumbreras V, Pujal J, Goday A, Culiàñez-Macià FA, Pagès M (2002) Arabidopsis thaliana Atrab28: a nuclear targeted protein related to germination and toxic cation tolerance. Plant Mol Biol 50: 249259[CrossRef][Medline] Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72: 248254[CrossRef][Web of Science][Medline] Buitink J, Hoekstra FA, Leprince O (2002) Biochemistry and biophysics of tolerance systems. In M Black, HW Pritchard, eds, Desiccation and Survival in Plants: Drying Without Dying. CABI Publishing, Oxon, UK, pp 293318 Buitink J, Leprince O (2004) Glass formation in plant anhydrobiotes: survival in the dry state. Cryobiology 48: 215228[CrossRef][Medline] Buitink J, Ly Vu B, Satour P, Leprince O (2003) The re-establishment of desiccation tolerance in germinated radicles of Medicago truncatula Gaertn seeds. Seed Sci Res 13: 273286[CrossRef] Byler DM, Susi H (1986) Examination of the secondary structure of proteins by deconvolved FTIR spectra. Biopolymers 25: 469487[CrossRef][Web of Science][Medline] Campalans A, Pagès M, Messeguer R (2000) Protein analysis during almond embryo development: identification and characterization of a late embryogenesis abundant protein. Plant Physiol Biochem 38: 449457[CrossRef] Capron I, Corbineau F, Dacher F, Job C, Côme D, Job D (2000) Sugarbeet seed priming: effects of priming conditions on germination, solubilization of 11-S globulin and accumulation of LEA proteins. Seed Sci Res 10: 243254 Carles C, Bies-Etheve N, Aspart L, Léon-Kloosterziel KM, Koorneef M, Echeverria M, Delseny M (2002) Regulation of Arabidopsis thaliana Em genes: role of ABI5. Plant J 30: 373383[CrossRef][Web of Science][Medline] Cheng Z, Targolli J, Huang X, Wu R (2002) Wheat LEA genes, PMA80 and PMA1959 enhance dehydration tolerance of transgenic rice (Oryza sativa L.). Mol Breed 10: 7182[CrossRef] Cuming AC (1999) LEA proteins. In PR Shewry, R Casey, eds, Seed Proteins. Kluwer Academic Press, Dordrecht, The Netherlands, pp 753780 Dehaye L, Duval M, Viguier D, Yaxley J, Job D (1997) Cloning and expression of the pea encoding SBP65, a seed specific biotinylated protein. Plant Mol Biol 35: 605621[CrossRef][Web of Science][Medline] Ditzer A, Kirch H-H, Nair A, Bartels D (2001) Molecular characterization of two alanine-rich Lea genes abundantly expressed in the resurrection plant C. plantagineum in response to osmotic stress and ABA. J Plant Physiol 158: 623633[CrossRef][Web of Science] Dure L III (1993) Structural motifs of Lea proteins. In TJ Close, EA Bray, eds, Plant Responses to Cellular Dehydration during Environmental Stress, Current Topics in Plant Physiology, Vol 10. ASPP Series, Rockville, MD, pp 91103 Gallardo K, Job C, Groot SPC, Puype M, Demol H, Vandekerckhove J, Job D (2001) Proteomic analysis of Arabidopsis seed germination and priming. Plant Physiol 126: 835848 Gallardo K, Le Signor C, Vandekerckhove J, Thompson RD, Burstin J (2003) Proteomics of Medicago truncatula seed development establishes the time frame of diverse metabolic processes related to reserve accumulation. Plant Physiol 133: 119 Garay-Arroyo A, Colmenero-Florest JM, Garciarrubio A, Covarrubias AA (2000) Highly hydrophilic proteins in prokaryotes and eukaryotes are common during conditions of water deficits. J Biol Chem 275: 56685674 Goyal K, Tisi L, Basran A, Browne J, Burnell A, Zurdo J, Tunnacliffe A (2003) Transition from natively unfolded to folded state induced by desiccation in an anhydrobiotic nematode protein. J Biol Chem 278: 1297712984 Goyal K, Walton LJ, Tunnacliffe A (2005) LEA proteins prevent protein aggregation due to water stress. Biochem J 388: 151157[CrossRef][Web of Science][Medline] Grelet J, Benamar A, Teyssier E, Avelange-Macherel M-H, Grunwald D, Macherel D (2005) Identification in pea seed mitochondria of a later embryogenesis abundant protein able to protect enzymes from drying. Plant Physiol 137: 157167 Hajduch M, Ganapathy A, Stein JW, Thelen JJ (2005) A systematic proteomic study of seed filling in soybean: establishment of high-resolution two-dimensional reference maps, expression profiles, and an interactive proteome database. Plant Physiol 137: 13971419 Haris PI, Coke M, Chapman D (1989) Fourier transform infrared spectroscopic investigation of rhodopsin structure and its comparison with bacteriorhodopsin. Biochim Biophys Acta 995: 160167[CrossRef][Medline] Hoekstra FA, Golovina EA, Buitink J (2001) Mechanisms of plant desiccation tolerance. Trends Plant Sci 5: 431438 Houde M, Dallaire S, N'Dong D, Sarhan F (2004) Overexpression of the acidic dehydrin WCOR410 improves freezing tolerance in transgenic strawberry leaves. Plant Biotech J 2: 381387[CrossRef] Imai R, Chang L, Ohta A, Bray EA, Takagi M (1996) A lea-class gene of tomato confers salt and freezing tolerance when expressed in Saccharomyces cerevisiae. Gene 170: 243248[CrossRef][Web of Science][Medline] Kermode AR (1997) Approaches to elucidate the basis of desiccation-tolerance in seeds. Seed Sci Res 7: 7595 Leprince O, Harren FJM, Buitink J, Alberda M, Hoekstra FA (2000) Metabolic dysfunction and unabated respiration precede the loss of membrane integrity during dehydration of germinating radicles. Plant Physiol 122: 597608 Liu Y, Zheng Y (2005) PM2, a group 3 LEA protein from soybean, and its 22-mer repeating region confer salt tolerance in Escherichia coli. Biochim Biophys Res Commun 331: 325332[Medline] McCubbin WD, Kay CM, Lane BG (1985) Hydrodynamic and optical properties of the wheat germ Em protein. Can J Biochem Cell Biol 63: 803811[Web of Science] Meurs C, Basra AS, Karssen CM, van Loon LC (1992) Role of abscisic acid in the induction of desiccation tolerance in developing seeds of Arabidopsis thaliana. Plant Physiol 98: 14841493 Niogret MF, Culiañez-Macià FA, Goday A, Mar Albà M, Pagès M (1996) Expression and cellular localization of rab28 mRNA and Rab28 protein during maize embryogenesis. Plant J 9: 549557[Medline] Page RMD (1996) TREEVIEW: an application to display phylogenetic trees on personal computers. Comput Appl Biosci 12: 357358 Prestrelski SJ, Tedeschi N, Arakawa T, Carpenter JF (1993) Dehydration-induced conformational transitions in proteins and their inhibition by stabilizers. Biophys J 65: 661671[Web of Science][Medline] Ramanjulu S, Bartels D (2002) Drought- and desiccation-induced modulation of gene expression in plants. Plant Cell Environ 25: 141151[CrossRef][Medline] Raussens V, Ruysschaert J-M, Goormaghtigh E (1997) Fourier transform infrared spectroscopy study of the secondary structure of the gastric H1, K1-ATPase and of its membrane-associated proteolytic peptides. J Biol Chem 272: 262270 Reyes JL, Rodrigo M-J, Colmenero-Flores JM, Gil J-V, Garay-Arroyo A, Campos F, Salamini F, Bartels D, Covarrubias AA (2005) Hydrophilins from distant organisms can protect enzymatic activities from water limitation effects in vitro. Plant Cell Environ 28: 709718[CrossRef] Ried JL, Walker-Simmons MK (1993) Group 3 late embryogenesis abundant proteins in desiccation-tolerant seedlings of wheat (Triticum aestivum L.). Plant Physiol 102: 125131[Abstract] Riera M, Figueras M, Lopez C, Goday A, Pagès M (2004) Protein kinase CK2 modulates developmental functions of the abscisic acid responsive protein Rab17 from maize. Proc Natl Acad Sci USA 101: 98799884 Schiltz S, Gallardo K, Huart M, Negroni L, Sommerer N, Burstin J (2004) Proteome reference maps of vegetative tissues in pea: an investigation of nitrogen mobilization from leaves during seed filling. Plant Physiol 135: 22412260 Shih M-D, Lin S-C, Hsieh J-S, Tsou C-H, Chow T-Y, Lin T-P, Hsing Y-IC (2004) Gene cloning and characterization of a soybean (Glycine max L.) LEA protein, GmPM16. Plant Mol Biol 56: 689703[CrossRef][Web of Science][Medline] Singh S, Cornilescu CC, Tyler RC, Cornilescu G, Tonelli M, Lee MS, Markley JL (2005) Solution structure of a late embryogenesis abundant protein (LEA14) from Arabidopsis thaliana, a cellular stress-related protein. Protein Sci 14: 26012609[CrossRef][Web of Science][Medline] Soeda Y, Konings MCJM, Vorst O, van Houwelinhen AMML, Stoopen GM, Maliepaard CA, Kodde J, Bino RJ, Groot SPC, van der Geest A (2005) Gene expression programs during Brassica oleracea seed maturation, osmopriming, and germination are indicators of progression of the germination process and the stress tolerance level. Plant Physiol 137: 354358 Soulages JL, Kim K, Arrese EL, Walters C, Cushman JC (2003) Conformation of a group 2 late embryogenesis abundant protein from soybean: evidence for poly (L-proline)-type II structure. Plant Physiol 131: 963975 Soulages JL, Kim K, Walters C, Cushman JC (2002) Temperature-induced extended helix/random coil transitions in a group 1 late embryogenesis-abundant protein from soybean. Plant Physiol 128: 822832 Surewicz WK, Mantsch HH (1988) New insight into protein secondary structure from resolution-enhanced infrared spectra. Biochim Biophys Acta 952: 115130[CrossRef][Medline] Swire-Clark GA, Marcotte WR Jr, (1999) The wheat LEA protein Em functions as an osmoprotective molecule in Saccharomyces cerevisiae. Plant Mol Biol 39: 117128[CrossRef][Web of Science][Medline] Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DJ (1997) The ClustalX windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res 25: 48764882 Walters C, Farrant JM, Pammenter NW, Berjak P (2002) Desiccation stress and damage. In M Black, HW Pritchard, eds, Desiccation and Survival in Plants: Drying Without Dying. CABI Publishing, Oxon, UK, pp 263292 Watson BS, Asirvatham VS, Wang L, Sumner LW (2003) Mapping the proteome of barrel medic (Medicago truncatula). Plant Physiol 131: 11041123 Wechsberg GE, Probert RJ, Bray CM (1994) The relationship between "dehydrin-like" proteins and seed longevity in Ranunculus sceleratus L. J Exp Bot 45: 10271030 Wehmeyer N, Vierling E (2000) The expression of small heat shock proteins in seeds responds to discrete developmental signals and suggests a general protective role in desiccation tolerance. Plant Physiol 122: 10991108 Whitsitt MS, Collins RG, Mullet JE (1997) Modulation of dehydration tolerance in soybean seedlings: dehydrin Mat1 is induced by dehydration but not by abscisic acid. Plant Physiol 114: 917925[Abstract] Williams B, Tsang A (1991) A maize gene expressed during embryogenesis is abscisic acid-inducible and highly conserved. Plant Mol Biol 16: 919923[CrossRef][Web of Science][Medline] Wilm M, Shevchenko A, Houthaeve T, Breit S, Schweigerer L, Fotsis T, Mann M (1996) Femtomole sequencing of proteins from polyacrylamide gels by nano-electrospray mass spectrometry. Nature 379: 466469[CrossRef][Medline] Wise J (2003) LEAping to conclusions: a computational reanalysis of the late embryogenesis abundant proteins and their possible roles. BMC Bioinformatics 4: 5271[CrossRef][Medline] Wolkers WF, Hoekstra FA (1995) Aging of dry desiccation-tolerant pollen does not affect protein secondary structure. Plant Physiol 109: 907915[Abstract] Wolkers WF, McCready S, Brandt WF, Lindsey GG, Hoekstra FA (2001) Isolation and characterization of a D-7 LEA protein from pollen that stabilizes glasses in vitro. Biochim Biophys Acta 1544: 196206[CrossRef][Medline] Wolkers WF, van Kilsdonk MG, Hoekstra FA (1998) Dehydration-induced conformational changes of poly-L-lysine as influenced by drying rate and carbohydrates. Biochim Biophys Acta 1425: 127136[Medline] This article has been cited by other articles:
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ASPB Publications | PLANT PHYSIOLOGY® | THE PLANT CELL | |
|---|---|---|---|