|
|
||||||||
|
First published online February 24, 2006; 10.1104/pp.105.070508 Plant Physiology 140:1437-1450 (2006) © 2006 American Society of Plant Biologists Transcriptional Profiling Implicates Novel Interactions between Abiotic Stress and Hormonal Responses in Thellungiella, a Close Relative of Arabidopsis1,[W]Department of Biology, University of Waterloo, Waterloo, Ontario, Canada N2L 3G1 (C.E.W., Y.L., C.D., M.G., B.A.M.); Département de mathématiques et de statistique, Pavillon Alexandre-Vachon, Université Laval, Quebec, Canada G1K 7P4 (A.L.); Department of Biology, McMaster University, Hamilton, Ontario, Canada L8S 4K1 (D.G., P.N., B.W., G.B.G., E.A.W.); and Department of Plant Sciences, University of Saskatchewan, Saskatoon, Saskatchewan, Canada S7N 5A8 (G.R.G.)
Thellungiella, an Arabidopsis (Arabidopsis thaliana)-related halophyte, is an emerging model species for studies designed to elucidate molecular mechanisms of abiotic stress tolerance. Using a cDNA microarray containing 3,628 unique sequences derived from previously described libraries of stress-induced cDNAs of the Yukon ecotype of Thellungiella salsuginea, we obtained transcript profiles of its response to cold, salinity, simulated drought, and rewatering after simulated drought. A total of 154 transcripts were differentially regulated under the conditions studied. Only six of these genes responded to all three stresses of drought, cold, and salinity, indicating a divergence among the end responses triggered by each of these stresses. Unlike in Arabidopsis, there were relatively few transcript changes in response to high salinity in this halophyte. Furthermore, the gene products represented among drought-responsive transcripts in Thellungiella associate a down-regulation of defense-related transcripts with exposure to water deficits. This antagonistic interaction between drought and biotic stress response may demonstrate Thellungiella's ability to respond precisely to environmental stresses, thereby conserving energy and resources and maximizing its survival potential. Intriguingly, changes of transcript abundance in response to cold implicate the involvement of jasmonic acid. While transcripts associated with photosynthetic processes were repressed by cold, physiological responses in plants developed at low temperature suggest a novel mechanism for photosynthetic acclimation. Taken together, our results provide useful starting points for more in-depth analyses of Thellungiella's extreme stress tolerance.
Thellungiella salsuginea, also known as Thellungiella halophila, is an emerging model species for the molecular elucidation of abiotic stress tolerance (Bressan et al., 2001
The Shandong ecotype of Thellungiella grows in the high-salinity coastal areas in eastern China and has been proposed to be an appropriate relative of Arabidopsis (Arabidopsis thaliana) for studies of salinity tolerance mechanisms (Bressan et al., 2001
Transcript-profiling experiments using the Arabidopsis GeneChip array or full-length cDNA microarrays have shown that extensive changes occur in the transcriptome of Arabidopsis in response to drought, cold, or salinity stresses (Fowler and Thomashow, 2002
Since expressed sequence tag analyses of Thellungiella clones revealed 90% to 95% identities between Thellungiella and Arabidopsis cDNA sequences (Wang et al., 2004
Previously, we have reported the generation of 3,628 nonredundant cDNAs derived from stress-induced libraries of the Yukon ecotype of Thellungiella (Wong et al., 2005
Our experimental design primarily focuses on a slow and prolonged stress treatment applied to plants under controlled conditions (see "Materials and Methods") so as to approximate the type of exposure to individual stresses encountered by Thellungiella in the field. This approach contrasts with previous microarray studies in that they have focused on rapid, short-term abiotic stress treatments to identify genes involved in signaling pathways and transcriptional regulation of abiotic stress-induced genes in plants (Fowler and Thomashow, 2002 This study compares three stresses (cold, low water availability, and saline conditions) as well as recovery from water deficits in Thellungiella, using an expression-profiling strategy. We identify some intriguing features associated with Thellungiella's stress responses. The lower than expected degree of overlap among genes responsive to drought, cold, or salinity suggested that there are relatively few common end responses triggered by these stresses. In addition to activating the expression of some well-known stress-responsive genes, Thellungiella was found to down-regulate a large number of biotic stress-related genes under drought and salinity treatments. This infers the employment of a precise defense strategy under conditions of osmotic stress. A large number of photosynthetic-related transcripts were repressed in responses to cold stress. However, plants developed at low temperature demonstrated a high tolerance to photoinhibition of photosynthesis, which is difficult to reconcile based on known photoprotective processes. This suggests an important and perhaps novel photosynthetic response of Thellungiella to low temperature.
Physiological Characterization of Simulated Drought and Salinity Treatments Water and solute potential measurements were carried out for well-watered control plants and plants that were subjected to simulated drought or saline conditions (see "Materials and Methods"). We consistently found, under the experimental conditions used, that Thellungiella was visibly wilted after 3 d of withholding water, when the leaf relative water content is about 65%. As shown in Table I , the leaf solute potentials became more negative as the plants were salinized or subjected to simulated drought, an indication that the solutes have become more concentrated under these conditions. In contrast to the salinity treatment, solute accumulation for drought-treated plants is accompanied by a loss of turgor, but both turgor and solute concentrations return to values comparable to those for control plants upon rewatering. Thus, our osmotic stress treatment strategies elicit stress-related responses as monitored by changes in plant water relations under the controlled experimental conditions we utilized.
Identification of Stress-Responsive Genes
To identify stress-associated genes using the Thellungiella cDNA microarrays, we have employed analysis methods that avoid the determination of transcriptional changes using cutoffs based upon fold-changes. Instead, an empirical Bayesian strategy was used to assess the significance of each treatment for each gene as outlined in "Materials and Methods" (Labbe, 2005
Using this statistical test, we found the abundance of 101, 76, 22, and 46 transcripts to be significantly changed under drought, cold, high-salinity, and rewatering conditions, respectively. These transcripts were assigned a Munich Information Center for Protein Sequences (MIPS) protein code based on the best BLAST match. They range in fold-change relative to the corresponding control from 0.09 to 31 (Table II
). The former corresponds to a gene encoding a member of the protease/lipid transfer protein (LTP) family (At2g10940), while the latter is a sequence annotated as rab18 (At5g66400). The number of transcripts regulated by salinity was less than one-fifth and one-third of that of drought- and cold-regulated genes, respectively. This low level of transcriptional change has also been reported in two previous microarray studies of salinity effects using the Shandong ecotype of Thellungiella (Taji et al., 2004
We performed semiquantitative reverse transcription (RT)-PCR analysis on six randomly selected genes to check the validity of the microarray analysis (Fig. 1 ; Supplemental Table I). The transcript that has the best BLAST match to Arabidopsis UBQ10 (At4g05320) has similar intensity values across all datasets and hence was used as an internal control. In all cases, the expression profiles obtained by semiquantitative RT-PCR were in agreement with those provided by the microarray analysis (Table II).
The Venn diagrams in Figure 2 show the commonalities of transcript changes among the stresses studied. These could be distributed into shared and stress-specific responses. Based on their gene expression patterns, the transcripts represented in Figure 2A were further classified into 13 clusters. The annotation and fold-change for all the corresponding transcripts for each cluster are listed in Table II. Rewatering-responsive transcripts were compared with drought-responsive transcripts in a Venn diagram in Figure 2B, and their expression profiles were classified into six different groups as listed in Supplemental Table II.
Stimulus-Specific Responses
Clusters 1 and 6 contain a total of 61 transcripts that among the three stresses only respond to drought treatment. They represent 59% of all the 101 drought-regulated mRNAs. The greatest fold of induction was detected for a transcript encoding a homolog to a putative Arabidopsis alkaline
Cluster 6 contains transcripts that are repressed under drought and, interestingly, these include defense-related transcripts that encode
We found 25 transcripts to be specifically expressed following a 3-week exposure to cold treatment (Cluster 4; Table II). Among these transcripts are 17 cold-responsive transcripts that encode a putative lipoxygenase (LOX; At1g17420), two members of the plant defensin protein (PDF1.2a and PDF 2.2), and chalcone synthase (At5g44420; At2g02100; At5g13930; Cluster 4; Table I). According to AraCyc, the Arabidopsis Biochemical Pathway tool (http://www.arabidopsis.org/tools/aracyc/), this putative LOX is predicted to be involved in the biosynthesis of the phytohormone jasmonic acid (JA; Bell and Mullet, 1993
Our analysis identified 26 cold-repressed transcripts (Cluster 9; Table II); one-half encode products that have putative functions associated with photosynthesis. These include genes that encode chlorophyll a/b-binding proteins, plastocyanin, and PSI subunit proteins. Similar genes have been reported to be repressed in Arabidopsis "cold" microarray studies (Fowler and Thomashow, 2002
Surprisingly, only three genes were specifically responsive to the salinity treatment. These transcripts are represented by Cluster 11 (Table II) and are all down-regulated relative to the control. Two of the genes encode products associated with photosynthesis (chlorophyll a/b-binding protein and oxygen-evolving enhancer protein), whereas the third is an expressed protein of unknown function.
Clusters 2, 3, 5, 7, 8, 10, 12, and 13 consist of transcripts that are differentially regulated by more than one stress treatment relative to the control; the corresponding transcripts for each class are listed in Table II. As shown in Figure 2A, there was greater overlap between the drought- and salinity-induced changes as compared to the changes caused by drought and cold stresses. Out of 101 and 22 transcripts differentially regulated by drought treatment and salinity, respectively, there was an overlap of 15 sequences (68% of salinity-regulated transcripts), and all were repressed by both treatments. Based on best BLAST match, the corresponding gene products can be categorized under three major functional groups: signaling, photosynthesis, and defense related. A member of the basic helix-loop-helix transcription factor family (At1g61660) and a calmodulin-6 (At5g21274) represent the signaling group, whereas a putative chitinase (At2g43590), a pathogenesis-related protein (At1g75040), and a disease resistance protein (At5g41550) constitute the defense-related group. Meanwhile, 41% of the cold-regulated transcripts were also responsive to drought treatment. Among them were well-known cold- and drought-induced genes, such as ELIP (early light inducible), cor15b (cold-regulated protein), cor47, erd10 (early responsive to dehydration), cor6.6, Adh (alcohol dehydrogenase), and P5CS A (delta 1-pyrroline-5-carboxylate synthetase A; At2g39800), a gene encoding a product associated with Pro biosynthesis (Kreps et al., 2002
There is a higher percentage (68%) of genes that are also drought regulated in the salinity dataset when compared to that of the cold dataset (41%). This extensive overlap between the drought- and salinity-induced changes hints of commonalities between stress responses elicited by the drought and salinity treatments we used, suggesting cross talk between responses triggered by these stresses. This is consistent with previous observations on the greater overlap of drought- and high salinity-responsive gene expression in Arabidopsis (67%) in comparison to that of drought and cold (41%; Seki et al., 2002b
There were four transcripts that are cold and salinity regulated (Clusters 10 and 13; Table II). Genes encoding a putative
The expression of 149 transcripts changed in association with at least one stress treatment; only six of these responded to all stress treatments (Fig. 2A). This suggests that the stress-responsive mechanisms in Thellungiella are divergent for each of these stresses, as reflected by the lack of sequence overlap in our previously reported expressed sequence tag collections of stress-induced libraries (Wong et al., 2005
There were a total of 106 transcripts identified to be drought and/or rewatering responsive (Fig. 2B). Among these, 45 transcripts were differentially regulated by rewatering treatment when compared to the drought-treated control. The remaining 61 transcripts that were up- or down-regulated by drought were unchanged in rewatered plants relative to the drought sample. We identified 19 rewatering-repressed and drought-inducible transcripts, and 21 rewatering-inducible and drought-repressed transcripts (Supplemental Table II). The former includes transcripts with homology to that encoding Arabidopsis dehydration-induced protein ERD10 (At1g20450), COR47 (At1g20440), and a LEA protein (At1g52690), while the latter consists of genes that may be repressed by drought and released from the repression by rewatering. This includes photosynthesis-related proteins and is consistent with photosynthesis being important in the process of recovery following rewatering.
Our microarray study primarily focused on Thellungiella exposed to various stresses over the course of days or weeks to identify genes that may be mechanistically involved in acclimation or stress resistance in the steady state. Among the 149 transcripts that changed in response to drought, cold, or salinity, only six were regulated by all three stresses (Fig. 2A). This is in spite of the fact that osmotic stress and the associated oxidative stress appear to be common consequences of exposure to drought, salinity, and cold (Apel and Hirt, 2004
The salinity dataset contains the fewest transcripts that were stress regulated when compared to drought and cold datasets. This corresponds to less than 1% of the sequences represented by our array. A similar low degree of transcriptional change was revealed by other "stress" microarray studies in Thellungiella (Taji et al., 2004
Nevertheless, the low degree of mRNA changes in salt-acclimated Thellungiella is intriguing. The degree of fold-change for salinity stress-responsive transcripts relative to the control under our experimental conditions may be far less pronounced and hence lie beyond the detection sensitivity of microarray analysis. While it is possible that more dramatic transcriptional changes occur in the roots instead of leaves or at an earlier time point following salt treatment, this seems unlikely given that microarray experiments using roots and 2-h salt-treated tissues have been performed by others with similar results (Taji et al., 2004
The photosynthetic system in higher plants is highly susceptible to abiotic stresses (Huner et al., 1998
Among the photosynthesis-related genes that were repressed are those that encode Rubisco subunits, oxygen-evolving complex, PSI and PSII subunits, and chlorophyll a/b-binding proteins. However, only two members of this group of genes were consistently down-regulated by all three stress treatments, and both of them belong to the chlorophyll a/b-binding protein family. The fact that we did not see all photosynthesis-related genes repressed in the same manner across all three stresses may reflect the different impact that these stresses have on photosynthesis in the short as well as the long term. For example, in Arabidopsis, down-regulation of photosynthetic gene expression after cold treatment is associated with the accumulation of hexose phosphate and soluble sugars (Strand et al., 1997
Unlike light-harvesting proteins that are down-regulated by drought, cold, and high-salinity treatments, Thellungiella accumulates transcripts of ELIP to different levels in response to cold and drought treatment (At4g14690 and At3g22840; Cluster 2; Table II). ELIPs accumulate in thylakoid membranes during light stress, where they bind chlorophylls and carotenoids and provide protection against photooxidation (Montané and Kloppstech, 2000
The phytohormone ABA is involved in regulating diverse plant processes, including gene expression during abiotic and biotic stresses. More specifically, ABA is known to mediate the expression of many stress-responsive genes as a result of drought or saline conditions, but may have a limited role in cold regulation (for review, see Zhu, 2002
There was a concomitant decrease of various defense-related transcripts noted in the drought and salinity datasets. Interestingly, ABA has been found to enhance disease susceptibility (Ward et al., 1989
Intriguingly, a number of reports have shown an induction of defense-related genes by similar stresses in Arabidopsis (supplemental data in Seki et al., 2002a
The relatively lower percentage of ABA-responsive genes in our cold dataset in comparison to drought, in particular, is consistent with the emerging consensus that ABA may not play a critical role in the cold response (Seki et al., 2002a; Xiong and Zhu, 2002
A number of transcripts encoding cell wall-related proteins are found in the drought-responsive transcript dataset. Transcripts encoding a xyloglucan:xylogycosyl transferase (At2g06850) and a putative endotransglycosylase (At5g65730) were down-regulated, whereas some of those encoding a potentially cell wall-associated LTP family of proteins were up-regulated (At4g33550, At5g59310) by drought treatment. Similar proteins have been implicated in cell wall loosening (Nishitani and Tominaga, 1992
A possible explanation for the apparent antagonistic regulation of the two groups of cell wall-related transcripts observed in the drought dataset is that developmental and environmental cues may trigger the action of different groups of cell wall-loosening enzymes. In fact, there are two classes of enzymes involved in the cell wall-loosening process (for review, see Cosgrove, 2001
Our analysis revealed transcriptional changes of some JA-related gene products (LOX, PDF1.2a, chalcone synthase) after cold treatment. The current knowledge of JA-related genes derives mostly from work on defense mechanisms during pathogenesis and wounding, and to some extent osmotic stress (for review, see Wasternack et al., 1998
For a plant to survive a drought stress, not only does it have to overcome drought-associated damages but also injuries that occur upon rewatering as a result of rapid water uptake (Stewart, 1989
Our microarray analysis provides transcript profiles of drought, cold, high-salinity, or rewatering responses in Thellungiella. This analysis is a timely contribution to the emerging recognition of Thellungiella as a model species for the molecular elucidation of abiotic stress tolerance. Our results revealed interesting features and potentially valuable traits associated with the stress responses of Thellungiella. However, as with all microarray analyses, the interpretation of the transcript changes requires caution. Microarrays provide a sensitive but transient snapshot of gene expression. Furthermore, the changes in mRNA levels may not correlate with changes in protein or enzyme activity levels. Nevertheless, the results obtained from our microarray analysis provide useful starting points for more thorough investigation into the molecular mechanism behind the extreme stress tolerance of Thellungiella.
Plant Materials and Stress Treatments
Plants of the Yukon ecotype of Thellungiella salsuginea (Pall.) O.E. Schulz (Al-Shehbaz et al., 1999 For the cold treatments, plants were shifted to a day/night temperature regime of 5°C/4°C with all other conditions constant and leaves were sampled after 3 weeks. For the photosynthetic experiments, the plants were allowed to develop under these conditions for an additional 8 weeks. Drought stress was simulated in pots by withholding water from 1-month-old plants until they wilted visibly (3 d). For the drought and rewatering treatment, plants were subjected to drought treatment and then rewatered and allowed to recover for 2 d. To have plants acclimated to high salinity, plants were watered with NaCl solutions at concentrations that increased by 50 mM increment every 3 d until the final concentration reached 300 mM; tissues were harvested 3 d later.
Water and solute potentials and relative water content measurements were carried out for well-watered control plants, plants that were subjected to simulated drought or saline conditions, or rewatering after water deficits as described by Weretilnyk et al. (2001)
Fv/Fm and experiments examining the rapid induction of NPQ were determined in planta at room temperature using a PAM-2000 portable chlorophyll fluorometer (Heinz Walz GmbH) as detailed by Baerr et al. (2005)
Photoinhibition of photosynthesis was induced at 4°C by exposure to a photon flux density of 1,000 µmol photons m2 s1 at the leaf surface for 4 h as described previously (Gray et al., 2003
Total RNA was extracted from only aboveground tissues as described previously (Wong et al., 2005
A total of 3,628 unique clones derived from the abiotic stress libraries described previously (Wong et al., 2005
Forty micrograms of total RNA was reverse transcribed to synthesize aminoallyl-labeled cDNA, followed by coupling of the aminoallyl groups to either Cyanine 3 or 5 (Cy3/Cy5) fluorescent molecules using protocol from The Institute of Genome Research (http://www.tigr.org/tdb/microarray/protocolsTIGR.shtml). Anchored poly d(T) primers at a final concentration of 4 µM were used to prime the first-strand cDNA synthesis. Routinely, 2 ng of fish IL-1
The cDNA microarrays were hybridized with Cy3 and Cy5 fluorescently labeled probe pairs of untreated/drought 3 d, untreated/cold acclimated, untreated/salt acclimated, and rewatering after drought/drought 3 d. Three biological replicates with dye swap as technical replicate were examined for all experimental conditions. The statistical analysis was based on a total of six replicates per experimental condition (three biological replicates plus three technical replicates). Microarrays were prehybridized, hybridized, and washed according to the protocol provided by the MicroArray Lab at BRI (http://www.bri.nrc.gc.ca/microarraylab/labelling_en.pdf). An extra step of dipping the slides in isopropanol was performed prior to air drying the slides.
ScanArray confocal scanning system and QuantArray data acquisition software (Perkin-Elmer) were used according to the manufacturer's instructions to capture the data. Normalization between the Cy3 and Cy5 fluorescent dye emission intensities was achieved by adjusting the level of the photomultiplier gains. The signal intensities for all 14,688 spots were quantified and local background fluorescence values were automatically calculated by the QuantArray program. After local background subtraction, the data were imported into an algorithm that used a Bayesian approach to assess the significance of each treatment for each gene (Labbe, 2005
To correct for intensity-dependent bias and spatial bias simultaneously, a data transformation method called the Joint Lowess method (Cui et al., 2003 The list of genes identified to be significantly up- or down-regulated was then clustered using STATISTICA (version 6.1; Stats Soft). A Euclidean matrix was used to calculate the distances, and a complete linkage method was then applied for hierarchical clustering of these genes.
First-strand cDNA was prepared from 5 µg of total RNA with the Superscript RT II kit (Invitrogen) and oligo(dT)18 according to the manufacturer's instructions. A 0.5-µL aliquot of the total RT reaction volume (20 µL) was used as template in a 25-µL semiquantitative RT-mediated PCR amplification reaction. Number of cycles used for the transcripts investigated was routinely between 20 and 25, ensuring that the amount of amplified product remained in linear proportion to the initial template present in the reaction. Eight microliters of the PCR reaction was separated on 1% agarose gel containing 0.1 µg/µL ethidium bromide and visualized under UV light. The amount of amplified product was then estimated semiquantitatively using FluorChem Imaging System according to the manufacturer's instructions (Alpha Innotech). Primers used were At1g56600F, CGAACCGGTCTTTGCAGCCACCG and At1g56600R, TGACGTACTGAAGCACACCGGCC; At5g59310F, AACCTTAGAAAACAAAAGTCAACTAAATCT and At5g59310R, CTAGACTTGGGTTGATGCTCTGT; At1g06430F, GGAGCTGATCTTGCAAACCTCTTG and At1g06430R, AGCCGACGAATCCATTAGCGAC; At5g52300F, ACAGGATCAGCCGTGATGACG and At5g52300R, TATTTTCCCCCTCCAATTCC; At5g66400F, GGTGGTTGCTCTTCCAACATGGCGTCTTACCAGAA and At5g66400R, CGGAATTCTTAACGACCACCACCACCAGGAAGTTTATC; and At4g05320F, AGTCGACCCTTCATTTGGTG and At4g05320R, TGATAAAGTAAGCAGGCGC.
We thank Wilson Sung for assistance in managing the microarray datasets, Jeffrey Pylatuik for providing tips on improving fluorescence probe labeling efficiency, Kazuhiro Fujiki for providing the clone for fish transgene, and Kevin Lanctot for writing an algorithm to convert QuantArray output files into a format accepted by the microarray statistical analysis. Received August 28, 2005; returned for revision December 10, 2005; accepted January 19, 2006.
1 This work was supported by grants from the Natural Sciences and Engineering Research Council of Canada, Agriculture and Agri-Food Canada, the Canola Council of Canada, the Food System Biotechnology Centre at the University of Guelph, the Ontario Genomics Institute, and Performance Plants. The author responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors (www.plantphysiol.org) is: Barbara Moffatt (moffatt{at}uwaterloo.ca).
[W] The online version of this article contains Web-only data. Article, publication date, and citation information can be found at www.plantphysiol.org/cgi/doi/10.1104/pp.105.070508. * Corresponding author; e-mail moffatt{at}uwaterloo.ca; fax 15197460614.
Al-Shehbaz IA, O'Kane SL Jr, Price RA (1999) Generic placement of species excluded from Arabidopsis (Brassicaceae). Novon 9: 296307[CrossRef][Web of Science] Anderson JP, Badruzsaufari E, Schenk PM, Manners JM, Olivia JD, Ehlert C, Maclean DJ, Ebert PR, Kazan K (2004) Antagonistic interaction between abscisic acid and jasmonate-ethylene signaling pathways modulates defense gene expression and disease resistance in Arabidopsis. Plant Cell 16: 34603479 Apel K, Hirt H (2004) Reactive oxygen species: metabolism, oxidative stress, and signal transduction. Annu Rev Plant Biol 55: 373399[CrossRef][Medline] Audenaert K, De Meyer GB, Hofte MM (2002) Abscisic acid determines basal susceptibility of tomato to Botrytis cinerea and suppresses salicylic acid-dependent signaling mechanisms. Plant Physiol 128: 491501 Baerr JN, Thomas JD, Taylor BG, Rodermel SR, Gray GR (2005) Differential photosynthetic compensatory mechanisms exist in the immutans mutant of Arabidopsis thaliana. Physiol Plant 124: 390402[CrossRef] Balsamo RA, Willigen CV, Boyko W, Farrant J (2005) Retention of mobile water during dehydration in the desiccation-tolerant grass Eragrostis nindensis. Physiol Plant 124: 336342 Bell E, Mullet JE (1993) Characterization of an Arabidopsis-lipoxygenase gene responsive to methyl jasmonate and wounding. Plant Physiol 103: 11331137[Abstract] Benjamini Y, Hochberg Y (1995) Controlling the false discovery rate. A practical and powerful approach to multiple testing. J R Stat Soc Ser B 57: 289300 Bray E (2002) Classification of genes differentially expressed during water-deficit stress in Arabidopsis thaliana: an analysis using microarray and differential expression data. Ann Bot (Lond) 89: 803811 Bressan RA, Zhang C, Zhang H, Hasegawa P, Bohnert H, Zhu JK (2001) Learning from the Arabidopsis experience. The next gene search paradigm. Plant Physiol 127: 13541360 Bruxelles C, Peacock WJ, Dennis ES, Dolferus R (1996) Abscisic acid induces the alcohol dehydrogenase gene in Arabidopsis. Plant Physiol 111: 381391[Abstract] Cheong YH, Chang H, Gupta R, Wang X, Zhu T, Luan S (2002) Transcriptional profiling reveals novel interactions between wounding, pathogen, abiotic stress, and hormonal responses in Arabidopsis. Plant Physiol 129: 661677 Cody WJ (2000) Flora of the Yukon Territory, Ed 2. NRC Research Press, Ottawa Cosgrove DJ (2001) Wall structure and wall loosening. A look backwards and forwards. Plant Physiol 125: 131134 Cui X, Kerr MK, Churchill GA (2003) Data transformation for cDNA microarray data. Stat Appl Genet Mol Biol 2: Article 4 Dudley RM, Haughton D (2002) Asymptotic normality with small relative errors of posterior probabilities of half-spaces. Ann Statist 30: 13111344[CrossRef] Fowler S, Thomashow MF (2002) Arabidopsis transcriptome profiling indicates that multiple regulatory pathways are activated during cold acclimation in addition to the CBF cold response pathway. Plant Cell 14: 16751690 Gong Q, Li P, Ma S, Rupassara I, Bohnert HJ (2005) Salinity stress adaptation competence in the extremophile Thellungiella halophila in comparison to its relative Arabidopsis thaliana. Plant J 44: 826839[Web of Science][Medline] Gonzalez-Aguilar GA, Tiznado-Hernandez ME, Zavaleta-Gatica R, Martinez-Tellez MA (2004) Methyl jasmonate treatments reduce chilling injury and activate the defense response of guava fruits. Biochem Biophys Res Commun 313: 694701[CrossRef][Web of Science][Medline] Gray GR, Heath D (2005) A global reorganization of the metabolome in Arabidopsis during cold acclimation is revealed by metabolic fingerprinting. Physiol Plant 124: 236248 Gray GR, Hope BJ, Qin X, Taylor BT, Whitehead CL (2003) The characterization of photoinhibition and recovery during cold acclimation in Arabidopsis thaliana using chlorophyll fluorescence imaging. Physiol Plant 119: 365375 Gray GR, Savitch LV, Ivanov AG, Huner NPA (1996) Photosystem II excitation pressure and development of resistance to photoinhibition. II. Adjustment of photosynthetic capacity in winter wheat and winter rye. Plant Physiol 110: 6171[Abstract] Hong JK, Hwang BK (2002) Induction by pathogen, salt and drought of a basic class II chitinase mRNA and its in situ localization in pepper (Capsicum annuum). Physiol Plant 114: 549558[CrossRef][Medline] Huner NPA, Öquist G, Hurry VM, Krol M, Falk S, Griffith M (1993) Photosynthesis, photoinhibition and low temperature acclimation in cold tolerant plants. Photosynth Res 37: 1939 Huner NPA, Öquist G, Sarhan F (1998) Energy balance and acclimation to light and cold. Trends Plant Sci 3: 224230[CrossRef][Web of Science] Hutin C, Nussaume L, Moise N, Moya I, Kloppstech K, Havaux M (2003) Early light-induced proteins protect Arabidopsis from photooxidative stress. Proc Natl Acad Sci USA 100: 49214926 Inan G, Zhang Q, Li PH, Wang ZL, Cao ZY, Zhang H, Zhang CQ, Quist TM, Goodwin SM, Zhu JH, et al (2004) Salt cress. A halophyte and cryophyte Arabidopsis relative model system and its applicability to molecular genetic analyses of growth and development of extremophiles. Plant Physiol 135: 17181737 Jang JC, Sheen J (1994) Sugar sensing in higher plants. Plant Cell 6: 16651679[Abstract] Kendziorski CM, Newton MA, Lan H, Gould MN (2003) On parametric empirical Bayes methods for comparing multiple groups using replicated gene expression. Stat Med 22: 38993914[CrossRef][Web of Science][Medline] Krapp A, Hofmann B, Schafer C, Stitt M (1993) Regulation of the expression of rbcs and other photosynthetic genes by carbohydrates: a mechanism for the sink regulation of photosynthesis. Plant J 3: 817828[CrossRef][Web of Science] Krapp A, Stitt M (1995) An evaluation of direct and indirect mechanisms for the sink-regulation of photosynthesis in spinach: changes in gas-exchange, carbohydrates, metabolites, enzyme-activities and steady-state transcript levels after cold-girdling source leaves. Planta 195: 313323[Web of Science] Kreps JA, Wu Y, Chang HS, Zhu T, Wang X, Harper J (2002) Transcriptome changes for Arabidopsis in response to salt, osmotic, and cold stress. Plant Physiol 130: 21292141 Krol M, Ivanov AG, Jansson S, Kloppstech K, Huner NPA (1999) Greening under high light and cold temperature affects the level of xanthophyll-cycle pigments, early light-inducible proteins, and light-harvesting polypeptides in wild-type barley and the Chlorina f2 mutant. Plant Physiol 120: 193203 Labbe A (2005) Multiple testing using the posterior probability of half-space: application to gene expression data. PhD thesis. University of Waterloo, Waterloo, ON, Canada Labbe A, Thompson ME (2005) Hierarchical inverse Gaussian models and multiple testing: application to gene expression data. Stat Appl Genet Mol Biol 4: Article 23 Mantyla E, Lang V, Pavla ET (1995) Role of abscisic acid in drought-induced freezing tolerance, cold acclimation, and accumulation of LT178 and RAB18 proteins in Arabidopsis thaliana. Plant Physiol 107: 141148[Abstract] McDonald KL, Cahill DM (1999) Influence of abscisic acid and the abscisic acid biosynthesis inhibitor, norflurazon, on interactions between Phytophthora sojae and soybean (Glycine max). Eur J Plant Pathol 105: 651658[CrossRef] Mohr PG, Cahill DM (2003) Abscisic acid influences the susceptibility of Arabidopsis thaliana to Pseudomonas syringae pv. tomato and Peronospora parasitica. Funct Plant Biol 30: 461469[CrossRef] Montané MH, Kloppstech K (2000) The family of light-harvesting-related proteins (LHCs, ELIPs, HLIPs): Was the harvesting of light their primary function? Gene 258: 18[CrossRef][Web of Science][Medline] Müller P, Li X-P, Niyogi KK (2001) Non-photochemical quenching. A response to excess light energy. Plant Physiol 125: 15581566 Nieuwland J, Feron R, Huisman BAH, Fasolino A, Hilbers CW, Derksen J, Mariani C (2005) Lipid transfer proteins enhance cell wall extension in tobacco. Plant Cell 17: 20092019 Nishitani K, Tominaga R (1992) Endo-xyloglucan transferase, a novel class of glycosyltransferase that catalyzes transfer of a segment of xyloglucan molecule to another xyloglucan molecule. J Biol Chem 267: 2105821064 Orthen B, Popp M, Smirnoff N (1994) Hydroxyl radical scavenging properties of cyclitols. Proc R Soc Edinb Sect B (Biol) 102: 269272 Penninckx IA, Thomma BP, Buchala A, Métraux J-P, Broekaert WF (1998) Concomitant activation of jasmonate and ethylene response pathways is required for induction of a plant defensin gene in Arabidopsis. Plant Cell 10: 21032113 Pharr DM, Stoop JMH, Williamson JD, Studer Feusi ME, Massel MO, Conkling MA (1995) The dual role of mannitol as osmoprotectant and photoassimilate in celery. Hortic Sci 30: 11821188 Potter E, Kloppstech K (1993) Effects of light stress on the expression of early light-inducible proteins in barley. Eur J Biochem 214: 779786[Web of Science][Medline] Rathinasabapathi R (2000) Metabolic engineering for stress tolerance: installing osmoprotectant synthesis pathways. Ann Bot (Lond) 86: 709716 Rezzonico E, Flury N, Meins F Jr, Beffa R (1998) Transcriptional down-regulation by abscisic acid of pathogenesis-related Richard S, Lapointe G, Rutledge RG, Seguin A (2000) Induction of chalcone synthase expression in white spruce by wounding and jasmonate. Plant Cell Physiol 41: 982987 Seki M, Ishida J, Narusaka M, Fujita M, Nanjo T, Umezawa T, Kamiya A, Nakajima M, Enju A, Sakurai T, et al (2002a) Monitoring the expression pattern of around 7,000 Arabidopsis genes under ABA treatments using a full-length cDNA microarray. Funct Integr Genomics 2: 282329[CrossRef][Medline] Seki M, Narusaka M, Ishida J, Nanjo T, Fujita M, Oono Y, Kamiya A, Nakajima M, Enju A, Sakurai T, et al (2002b) Monitoring the expression profiles of 7000 Arabidopsis genes under drought, cold and high salinity stresses using a full length cDNA microarray. Plant J 31: 279292[CrossRef][Web of Science][Medline] Sheen J (1994) Feedback-control of gene-expression. Photosynth Res 3: 427438 Shinozaki K, Yamaguchi-Shinozaki K, Seki M (2003) Regulatory network of gene expression in the drought and cold stress responses. Curr Opin Plant Biol 6: 410417[CrossRef][Web of Science][Medline] Steponkus PL (1984) Behavior of the plasma-membrane of isolated protoplasts during a freeze-thaw cycle. Cryobiology 21: 694695 Stewart GR (1989) Desiccation injury, anhydrobiosis and survival. In HG Jones, TJ Flowers, MB Jones, eds, Plant under Stress. Cambridge University Press, Cambridge, UK, pp 115130 Stitt M, Hurry V (2002) A plant for all seasons: alterations in photosynthetic carbon metabolism during cold acclimation in Arabidopsis. Curr Opin Plant Biol 5: 199206[CrossRef][Web of Science][Medline] Strand Å, Foyer CH, Gustafsson P, Gardeström P, Hurry V (2003) Altering flux through the sucrose biosynthesis pathway in transgenic Arabidopsis thaliana modifies photosynthetic acclimation at low temperatures and the development of freezing tolerance. Plant Cell Environ 26: 523535 Strand Å, Hurry V, Gustafsson P, Gardeström P (1997) Development of Arabidopsis thaliana leaves at low temperatures releases the suppression of photosynthesis and photosynthetic gene expression despite the accumulation of soluble carbohydrates. Plant J 12: 605614[CrossRef][Web of Science][Medline] Taji T, Seki M, Satou M, Sakurai T, Kobayashi M, Ishiyama K, Narusaka Y, Narusaka M, Zhu J-K, Shinozaki K (2004) Comparative genomics in salt tolerance between Arabidopsis and Arabidopsis-related halophyte salt cress using Arabidopsis microarray. Plant Physiol 135: 16971709 Tunnacliffe A, Lapinski J (2003) Resurrecting Van Leeuwenhoek's rotifers: a reappraisal of the role of disaccharides in anhydrobiosis. Philos Trans R Soc Lond B Biol Sci 358: 17551771 Volkov V, Wang B, Dominy PJ, Fricke W, Amtmann A (2004) Thellungiella halophila, a salt-tolerant relative of Arabidopsis thaliana, possesses effective mechanisms to discriminate between potassium and sodium. Plant Cell Environ 27: 114[Medline] Wang ZI, Li PH, Fredricksen M, Gong ZH, Kim CS, Zhang CQ, Bohnert HJ, Zhu JK, Bressan RA, Hasegawa PM, et al (2004) Expressed sequence tags from Thellungiella halophila, a new model to study plant salt-tolerance. Plant Sci 166: 609616 Ward EWB, Cahill DM, Bhattacharyya MK (1989) Abscisic acid suppression of phenylalanine ammonia-lyase activity and mRNA, and resistance of soybeans to Phytophthora megasperma f. sp. glycinea. Plant Physiol 91: 2327 Warwick SI, Francis A, Mulligan GA (2004) Brassicaceae of Canada (contribution no. 981317.1225). Agriculture and Agri-Food Canada, Eastern Cereal and Oilseed Research Centre, Ottawa, ON, Canada Wasternack C, Miersch O, Kramell R, Hause B, Ward J, Beale M, Boland W, Parthier B, Feussner I (1998) Jasmonic acid: biosynthesis, signal transduction, gene expression. Lipid-Fett 100: 139146 Weretilnyk EA, Alexander KJ, Drebenstedt M, Snider JD, Summers PS, Moffatt BA (2001) Maintaining methylation activities during salt stress. The involvement of adenosine kinase. Plant Physiol 125: 856865 Wong CE, Li Y, Whitty B, Akhter S, Diaz C, Brandle J, Golding B, Weretinylk E, Moffatt BA, Griffith M (2005) Expressed sequence tags from the Yukon ecotype of Thellungiella salsuginea reveal that gene expression in response to cold, drought and salinity shows little overlap. Plant Mol Biol 58: 561574[CrossRef][Web of Science][Medline] Xiong L, Zhu JK (2002) Molecular and genetic aspects of plant responses to osmotic stress. Plant Cell Environ 25: 131139[CrossRef][Medline] Zhu JK (2002) Salt and drought stress signal transduction in plants. Annu Rev Plant Biol 53: 247273[CrossRef][Medline] Zimmermann P, Hirsch-Hoffmann M, Hennig L, Gruissem W (2004) GENEVESTIGATOR. Arabidopsis microarray database and analysis toolbox. Plant Physiol 136: 26212632 Zuther E, Buchel K, Hundertmark M, Stitt M, Hincha DK, Heyer AG (2004) The role of raffinose in the cold acclimation response of Arabidopsis thaliana. FEBS Lett 576: 169173[CrossRef][Web of Science][Medline] This article has been cited by other articles:
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ASPB Publications | PLANT PHYSIOLOGY® | THE PLANT CELL | |
|---|---|---|---|