| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
|
First published online March 10, 2006; 10.1104/pp.105.076323 Plant Physiology 141:61-74 (2006) © 2006 American Society of Plant Biologists Cryptochrome 1 from Brassica napus Is Up-Regulated by Blue Light and Controls Hypocotyl/Stem Growth and Anthocyanin Accumulation1Interdisciplinary Centre for Plant Genomics and Department of Plant Molecular Biology, University of Delhi South Campus, New Delhi 110021, India
Cryptochromes are blue/ultraviolet-A light sensing photoreceptors involved in regulating various growth and developmental responses in plants. Investigations on the structure and functions of cryptochromes in plants have been largely confined to Arabidopsis (Arabidopsis thaliana), tomato (Lycopersicon esculentum), and pea (Pisum sativum). We report here the characterization of the cryptochrome 1 gene from Brassica napus (BnCRY1), an oilseed crop, and its functional validation in transgenics. The predicted BnCRY1 protein sequence shows a high degree of sequence identity (94%) to Arabidopsis CRY1. A semiquantitative reverse transcription-polymerase chain reaction and the western-blot analysis revealed that blue light up-regulates its transcript and protein levels in young seedlings. The BnCRY1 promoter harbors conventional light-responsive cis-acting elements, which presumably impart light activation to the GUS (  -glucuronidase) reporter gene expressed in Arabidopsis. Although the BnCRY1 transcript could be detected in all the tissues examined, its protein was virtually undetectable in mature leaves and the root, indicating a tissue-specific translational control or protein turnover. The antisense-BnCRY1 Brassica transgenic seedlings accumulated negligible levels of CRY1 protein and displayed an elongated hypocotyl when grown under continuous white or blue light (but not under red or far-red light); the accumulation of anthocyanins was also reduced significantly. The adult transformants were also found to be tall when grown under natural light environment in a containment facility without any artificial illumination. These data provide functional evidence for a role of blue light up-regulated cry1 in controlling photomorphogenesis in Brassica species.
Plants have evolved sophisticated sensory photoreceptors, which coordinately judge the quality, quantity, direction, and duration of light, to regulate diverse photomorphogenic responses throughout their life cycle (Gyula et al., 2003  ; Sullivan and Deng, 2003; Franklin and Whitelam, 2004). These sensory photoreceptors have been classified broadly into three groups based on the wavelength of light they perceive. Phytochromes, which are best characterized and extensively studied, comprise a small family of red/far-red (600–750 nm) sensing photoreceptors (Khurana et al., 1998, 2004; Quail, 2002; Chen et al., 2004). Cryptochromes and phototropins perceive the blue/UV-A (320–500 nm) part of the solar spectrum (Briggs and Olney, 2001; Khurana, 2001; Cashmore, 2003; Lin and Shalitin, 2003; Chen et al., 2004; Banerjee and Batschauer, 2005). The photoreceptors responsible for perceiving UV-B radiation (280–320 nm), however, remain elusive (Bharti and Khurana, 1997; Frohnmeyer and Staiger, 2003).
The first cryptochrome gene was cloned through the molecular analysis of T-DNA insertion mutant allele of hy4 (Ahmad and Cashmore, 1993
In plants, cryptochromes (cry1 and cry2) participate in many aspects of photomorphogenesis, such as inhibition of hypocotyl elongation (Ahmad and Cashmore, 1993
In dark, cry1 is localized in the nucleus and detected primarily in the cytoplasm on exposure to light, whereas cry2 is confined to the nucleus in both dark and light (Guo et al., 1999 Among higher plants, cryptochromes have been well studied and characterized only in Arabidopsis, tomato, and pea. To learn more about cryptochromes, we have initiated the characterization and functional analysis of the cryptochrome gene family from an agronomical important crop plant, Brassica napus, a close relative of Arabidopsis. The CRY1 gene was isolated from a variety ISN-706, which is cultivated in northern and cooler regions of India and is valued for oilseed. The BnCRY1 gene is represented as a single copy in the genome of B. napus, an allotetraploid, and its expression is up-regulated by light, both in terms of transcript abundance and the translational product. The analysis of anti-BnCRY1 transgenics has substantiated the role of CRY1 in regulating plant height and anthocyanin accumulation.
Gene Encoding CRY1 Protein in B. napus The full-length BnCRY1 gene from B. napus was isolated by screening a genomic library using AtCRY1 gene as a probe. Two of the strongly hybridizing clones were verified by sequence analysis and found to be identical. The larger clone was processed for sequencing by primer walking. The genomic sequence thus obtained was used to design primers and the corresponding cDNA clone amplified by reverse transcription (RT)-PCR and completed by 5' RACE and 3' RACE. The sequence of the genomic and cDNA clones of BnCRY1 is available in the EMBL Nucleotide Sequence Database (accession nos. AJ344565 [gene] and AJ704628 [cDNA]).
A comparative analysis of cDNA and genomic sequences revealed that BnCRY1 contains three introns and four exons (Fig. 1A
). The third intron spans 188 bp and is followed immediately by a 261 bp 3' untranslated region (UTR), which makes up the fourth exon. The stop codon (TAA) is generated by splicing of the third and fourth exons. The BnCRY1 cDNA contains a 5' noncoding region of 55 nucleotides and a coding region of 2,040 nucleotides (680 amino acids, 76.7 kD). It harbors a polyadenylation signal (AATAAA) at position 2,269 to 2,274 bp just before the polyA tail. The Kyte-Doolittle hydropathy plot analysis does not show any hydrophobic region (data not shown), suggesting that BnCRY1 is a soluble protein consistent with the earlier reports on AtCRY1 (Ahmad and Cashmore, 1993
Using the ClustalW algorithm (Thompson et al., 1994 ), the deduced amino acid sequence of BnCRY1 was aligned with AtCRY1, LeCRY1, and OsCRY1 (Ahmad and Cashmore, 1993; Perrotta et al., 2000; Matsumoto et al., 2003). When compared to other cryptochromes, including dicot and monocot representatives, a high percentage of sequence identity was observed in the N-terminal PHR (photolyase-related) domain of BnCRY1 (Fig. 1B). In the C-terminal region, although overall similarity is low, all three hallmark motifs are conserved. Collectively, these three motifs are known as the DAS domain and comprise DQXVP (function unknown), an acidic (short stretch represented by E and D), and STAESSSS (implicated in interaction with phytochrome A [phyA]) motifs (Ahmad et al., 1998b; Kanegae and Wada, 1998). However, the traditional STAESSSS motif present in dicots is not conserved in OsCRY1 (Matsumoto et al., 2003).
Like Type I photolyases, AtCRY1 associates with two cofactors, the light-harvesting cofactor (MTHF) and a catalytic cofactor (FAD; Lin et al., 1995
The secondary structure of BnCRY1 was solved by the self-optimized prediction method (SOPM; Geourjon and Deleage, 1994
The phylogenetic analysis of 30 plant and near-plant cryptochromes representing 12 diverse species was carried out using the Dnastar MegAlign program by the Clustal method (Fig. 2
). The BnCRY1 grouped under dicot CRY1 clade and showed maximum similarity with AtCRY1, which again reflects a close evolutionary relationship between Arabidopsis and Brassica. A distinct coevolution of cryptochromes along with the hierarchy of plant taxons from algae to angiosperms was also apparent. Duplication of the CRY gene into CRY1 and CRY2 predates the dicot-monocot divergence as these genes were found in both dicots and monocots. Interestingly, the presence of only CRY1-like genes in Adiantum and Physcomitrella suggests that the gene duplication that gave rise to CRY1 and CRY2 major lineages occurred after the divergence of lower plants and seed plants (Spermatophyta). Seed plants are believed to have evolved in the late Paleozoic era about 360 million years ago (Mya), whereas monocots and dicots diverged around 170 Mya (Sanderson et al., 2004
BnCRY1 Is Represented as a Single Copy Gene on the Genome of an Allotetraploid
B. napus is a natural allotetraploid (2n = 38, AACC) derived from interspecific hybridization of the two diploid (A and C) genomes of Brassica rapa and Brassica oleracea, respectively, followed by spontaneous chromosome doubling (Song et al., 1988
Light-Dependent and Spatial/Temporal Expression Profile
Gene Expression Analysis
Immunoblot Analysis for Protein Profile The BnCRY1 protein of approximately 76 kD could be detected (by immunoblot assay) in the extracts of whole seedlings grown in dark or white light (70 µmol m–2 s–1) for various durations (Fig. 5 , A and B). Apart from the predominant 76-kD polypeptide, a fast-migrating polypeptide was always detected in the extracts of the light-grown tissue. This additional polypeptide may represent an altered phosphorylation status of CRY1 (Shalitin et al., 2002 ). The level of BnCRY1 was found to increase significantly in seedlings grown in light from 4 to 10 d. In comparison, however, the level of protein remained nearly constant in dark-grown seedlings, except some increase on day 6. The level of BnCRY1 was quite low in the dark-grown seedlings, in comparison to those grown in white light (70 µmol m–2 s–1) continuously for 6 d (Fig. 5C); in fact, a long exposure had to be given to obtain signals for the dark-grown samples (Fig. 5B). To study the effect of blue light on the accumulation of the BnCRY1 protein, 6-d-old etiolated Brassica seedlings were exposed to blue light (10 µmol m–2 s–1) for 36 h (Fig. 5D). On irradiation of seedlings with blue light, the BnCRY1 levels increased severalfold (the gel blot in Fig. 5D was exposed little longer than in Fig. 5C).
The western-blot analysis revealed the presence of BnCRY1 in cotyledons, stems, buds, flowers, and siliques (Fig. 5E). The expression was particularly higher in cotyledons, stems, and siliques. However, despite repeated attempts, the BnCRY1 protein could not be detected in roots as well as mature leaves under the given conditions; note that the BnCRY1 transcript could be detected in both leaves and roots (Fig. 4C). The distribution pattern of BnCRY1 appears to be largely consistent with the role cry1 plays in regulating various growth and developmental processes in plants.
The core regulatory elements like TATA box and CAAT box were identified at positions –29 (AATATA) and –122 (TCCAAA), respectively. To demonstrate that BnCRY1 promoter is indeed light regulated, the 1,124-bp region upstream of BnCRY1 translational start site was analyzed using PLACE (plant cis-acting regulatory elements; http//www.dna.affrc.go.jp/htdocs/place; Higo et al., 1999
Light Activation of GUS Reporter by the BnCRY1 Promoter The T2 progeny seedlings of five independent transgenic events (for each construct) were grown in dark for 8 d and another set of 7-d-old dark-grown seedlings exposed to white light for 24 h. The analysis of both CRY1P1::GUS and CRY1P2::GUS harboring seedlings revealed that the GUS activity was higher in dark-grown seedlings irradiated with white light for 24 h, as compared to the dark control (Fig. 6 ). The increased GUS activity in seedlings exposed to light (for only 24 h) indicates that BnCRY1 promoter may be regulated by light. This study further provides evidence that the smaller deletion construct harboring several light regulatory elements may be sufficient for driving GUS expression in a light-dependent manner.
Spatial Expression of the BnCRY1 Promoter-Driven GUS The GUS activity was determined histochemically to analyze the pattern of GUS expression and infer the promoter activity of the endogenous gene. The CRY1P1::GUS construct, harboring 1.1-kb promoter, transcribed in all the organs like root, stem, leaf, floral bud, flower, and silique (Fig. 7, A–F ). The GUS activity was distinctly high in the cotyledons of the 15-d-old transgenic plants in comparison to the first pair of leaves. A low level of GUS expression with nonuniform pattern was also observed in the roots (Fig. 7, A and B). Thus, the GUS reporter construct exhibits a regulation essentially similar to that of the endogenous gene as observed by RT-PCR (Fig. 4).
Stem Elongation and Decreased Anthocyanin Accumulation in Brassica Transgenics with Reduced BnCRY1 Levels To study the in vivo function of Brassica cry1, the antisense transgenic approach was adopted. However, instead of B. napus, Brassica juncea was selected because of its amenability in tissue cultures and higher transformation efficiency. The C-terminal region of BnCRY1 was amplified and cloned in the reverse orientation between the 35S promoter and nopaline synthase (NOS) polyadenylation site as terminator in a modified pCAMBIA 2310 vector (Fig. 8A ) and introduced into B. juncea via Agrobacterium-mediated transformation of hypocotyl segments. The transgenic plants were allowed to grow and the T1 seeds harvested for at least 10 independent plants.
To check for the phenotype (hypocotyl growth) of the antisense-BnCRY1 (AsCRY1) transgenics, the hypocotyl length of 15-d-old T1 seedlings was measured. Under continuous white light (70 µmol m–2 s–1), all the seedlings examined showed elongated hypocotyl and petioles when compared to the wild type (Figs. 8C and 9A ). On illumination with continuous blue light (10 µmol m–2 s–1), all the transgenic lines showed decreased inhibition of hypocotyl elongation (Figs. 8C and 9B); because of shortage of seeds, the AsCRY1-2 lines could not be tested for hypocotyl growth inhibition assay under blue light. In comparison to seedlings grown under white light, the hypocotyl elongation growth was greater under blue light. This may be due to the inhibitory effect of far-red and red light present in the white light, which act in a combinatorial manner with blue light for complete realization of the hypocotyl/stem growth inhibition response (Folta and Spalding, 2001 ). However, the hypocotyl growth of the AsCRY1 transgenic seedlings was not affected differentially (vis-à-vis wild type) by either red or far-red light (Fig. 8C), indicating that impairment in Brassica cry1 function does not affect red or far-red response. The T1 plants were grown during the winter under a short photoperiod (November to April) in a containment facility. At the adult stage too, the AsCRY1 plants were distinctly taller (Fig. 8C). In addition, leaves too were relatively large and the stem diameter greater in the AsCRY1 plants. Whether cry1 in Brassica plays a direct role in regulating these traits or adversely affects the function of some other sensory photoreceptor will be our endeavor to examine.
In addition to controlling plant height, cry1 also regulates anthocyanin accumulation. Earlier studies with Arabidopsis have shown that anthocyanin levels have an overriding effect of developmental cues, and are optimal in 3- to 4-d-old light-grown seedlings and decline thereafter (Feinbaum and Ausubel, 1988 ; Bharti and Khurana, 2003). The anthocyanin content was thus checked in two of the transgenic lines (AsCRY1-1 and AsCRY1-2) grown in blue light (10 µmol m–2 s–1) for various durations. In B. juncea too, anthocyanin levels were high in the 3-d-old seedlings and declined subsequently both in the wild type and the transgenic lines. However, the anthocyanin content was relatively lower in the transgenic lines, on any given day, with the effect being more pronounced in the line AsCRY1-1, particularly on days 3 and 5 (Fig. 10
).
To substantiate whether the long-hypocotyl phenotype and reduced anthocyanin accumulation in AsCRY1 transgenic seedlings was indeed due to reduced CRY1 levels, immunoblot analysis was performed with wild-type and transgenic seedlings. The CRY1 protein could not be detected or was considerably reduced in all five AsCRY1 transgenic lines examined (Fig. 8B). The copy number of AsCRY1 insert(s) was checked by Southern analysis, and one to three insertions in independent transgenic lines were detected (data not shown). A strict correlation between plant height and anthocyanin content, and gene dosage effect, will be possible only when a more detailed analysis of the homozygous lines of antisense-BnCRY1 transgenics becomes available.
As expected, owing to the genomic relatedness among Arabidopsis and Brassica, the BnCRY1 gene showed similar structural organization as AtCRY1. Sequence analysis of BnCRY1 revealed 94% similarity with the gene encoding HY4 flavin-type blue light photoreceptor (AF361588). The BLASTP analysis confirmed the sequence match of BnCRY1 with the other known cryptochromes, such as AtCRY2, LeCRY1, LeCRY2, OsCRY1, OsCRY2, CPH1, PpCRY1, AcCRY1, and SaPHR. A low percentage identity (31%–43%) was also observed with DNA photolyases (CPD photolyase [AE005817] and 6-4 photolyase [AB042254]). Although the length of introns varied, the intron and exon boundaries were conserved between BnCRY1 and AtCRY1 genes. The secondary structure of BnCRY1 consists mainly of  -helices and -strands, which are randomly distributed throughout the primary amino acid sequence and thus do not cluster into groups like domain and helical domain that are present in the secondary structure of photolyases (Brudler et al., 2003).
Based on the evolutionary history and ancient duplication events, angiosperm cryptochromes have been grouped into two classes, CRY1 and CRY2 (Perrotta et al., 2000
Along with ploidy, the chromosomal rearrangements like duplications and deletions play a major role in evolution. The copy number of CRY1 varies from species to species; for example, AtCRY1 is represented as a single copy in the Arabidopsis genome, whereas both tomato and barley harbor two copies of CRY1. However, despite the fact that B. napus is an amphidiploid (AACC), this study shows that the BnCRY1 gene in B. napus genome is most probably represented as a single copy. The genetic analysis of B. napus indicates that the genome of this amphidiploid is in a state of flux, and a large scale rearrangement due to duplication, deletion, and inversions or translocations of genetic segments has occurred (Sharpe et al., 1995
The BnCRY1 transcript abundance, as well as protein levels, is regulated by light and developmental cues. Severalfold induction in the level of BnCRY1 protein was observed on illumination with white or blue light. The expression profile, along with in vivo promoter::GUS fusion analysis in transgenic Arabidopsis, indicates the abundance of CRY1 in young and meristematic tissues like cotyledonary leaves, emerging inflorescence buds with inflorescence meristem, and young siliques with developing embryos. Although the CRY1 transcript could be detected in the root tissue by RT-PCR analysis, no protein could be detected. Thus, the tissue-specific expression of BnCRY1 may also be regulated at the translational level and/or protein degradation. It is interesting to note here that the BnCRY1 protein was undetectable in leaves under our experimental conditions, whereas in Arabidopsis a substantial amount of CRY1 accumulates (Lin et al., 1996a
The decrease in growth inhibition of the AsCRY1 transgenics of Brassica under field conditions and also at the seedling stage provides evidence for the in vivo function of cry1 in regulating stem growth. The effect of cry1 in regulating plant height appears to be more pronounced in Brassica than reported for tomato and pea (Ninu et al., 1999
Plant Materials and Growth Conditions Seeds of Brassica napus var. ISN-706 and Brassica juncea var. RLM-198 were obtained from the Indian Agricultural Research Institute, New Delhi. Seeds were washed thoroughly and soaked overnight in running tap water. The imbibed seeds were spread on cotton saturated with reverse osmosis water. Plants were grown either in dark or light (16-h photoperiod) for desired duration in a culture room/growth chamber maintained at 24°C ± 1°C.
Total plant DNA was extracted from 8-d-old dark-grown Brassica seedlings following the procedure of Dellaporta et al. (1983)
The cDNA was amplified by RT-PCR using primer pair (5'-CCATCGATATGTCTAATTCATGTTCAGGTG-3' and 5'-GTCTCGAGGTGACAGCCGTCTCCA-3') designed based upon BnCRY1 gene sequence obtained. Using 1 µg total RNA isolated from 4-d-old light-grown seedlings (Nagy et al., 1988
An aliquot of 15 µg of the plant DNA was digested independently with EcoRI, HindIII, SalI, XbaI, and XhoI restriction enzymes (Roche Molecular Biolabs) and Southern analysis performed as described earlier (Thakur et al., 2003
For expression analysis, total RNA was isolated from various tissues (frozen in liquid nitrogen) using a LiCl method (Nagy et al., 1988
The BnCRY1 gene was restriction digested with BamHI and SalI enzymes, which have the internal sites present in the third exon, and the 350-bp fragment thus generated cloned into pQE-30 vector in the same reading frame as 6xHis affinity tag. The fusion protein was expressed in Escherichia coli strain M15 and purified using a Ni-NTA affinity column (Qiagen). Immunizations were done by subcutaneous injection of 20 µg of emulsified protein per mouse followed by two booster doses with 15 µg of protein after every 2 weeks. Serum collected was stored at –80°C for later use.
The total protein from plant tissue was extracted following the procedure of Zivy et al. (1983)
The 1.1-kb and 348-bp genomic fragments upstream of translation start site were PCR amplified using primers 5'-GCTCTAGACATGAGTTGGAATCAGTT-3', 5'-GCTCTAGAATACATGTGCGGAGGTACG-3', and 5'-CCTCTAGACTCAATCTTAAAGCTCTTAC-3'. The amplified promoter fragments were cloned in pBI101 vector (Jefferson et al., 1987
Arabidopsis seedlings harboring the transgene promoter::GUS fusions were stained overnight at 37°C in GUS assay buffer (1 M NaHPO4 buffer, pH 7.0, 50 mM EDTA, pH 8.0, 0.5 mM potassium ferrocyanide, 0.5 mM potassium ferricyanide, 0.1% Triton X-100, 1 mg/mL 5-bromo-4-chloro-3-indolyl-
For quantitative analysis, GUS activity was measured as described by Jefferson et al. (1987)
The BnCRY1 cDNA was amplified by PCR: 5 min at 94°C for 30 cycles (94°C for 30 s, 65°C for 30 s, and 70°C for 45 s), followed by incubation at 70°C for 7 min, using the primer pair 5'CRYSacI GGGAGCTCGAAGAAGGACTTGGCGAT and 3'CRYBamHI CGCGGATCCAACTATTTCATGGTGGTTC. The antisense fragment (corresponding to the C terminus of BnCRY1) thus obtained was cloned in the modified pCAMBIA 2310 vector using BamHI and SacI restriction sites and introduced in B. juncea var. RLM-198 hypocotyl sections via Agrobacterium. For regeneration and shoot formation from putative transgenics, the hypocotyl sections cocultivated with Agrobacterium were placed on agar-gelled Murashige and Skoog medium containing 1 mg/L naphthylacetic acid, 1 mg/L benzylaminopurine, 3.4 mg/L AgNO3, 250 mg/L cefotaxime, and 50 mg/L kanamycin. The callus or regenerating plantlets were subcultured on fresh medium after every 15 d, for two to three times, until the shootlets appeared. The healthy shoots were transferred to the rooting medium containing 0.1 mg/L naphthylacetic acid and 50 mg/L kanamycin. As soon as a small root mass was observed, the plantlets were transferred to earthen pots containing garden soil. The T0 plants raised in a growth room were allowed to set seed at 24°C ± 1°C, under continuous light (100 µmol m–2 s–1). The adult (T1) transgenic plants were grown under field conditions in a containment facility.
For hypocotyl elongation growth assay, seeds were germinated in clay pots containing garden soil and irradiated with white light, blue light, red light, or far-red light in the cabinets kept in a growth room. After 10 d of growth, the hypocotyl length of 10 seedlings each of wild type and antisense-BnCRY1 line was measured and averaged. The experiments were repeated at least once with essentially similar results, and, thus, the data of only a representative experiment are presented. For anthocyanin estimation, the wild-type and antisense seedlings were grown on Murashige and Skoog medium supplemented with 2% Suc and 0.8% agar under continuous blue light (10 µmol m–2 s–1) for 3 to 5 d. The anthocyanins from three seedlings of each line were extracted independently overnight in 3 mL of acidic (1% HCl) methanol in a dark chamber. To the acidic methanol extract, 2 mL of water and 3 mL of chloroform were added and mixed thoroughly. The absorbance of aqueous phase was determined at 530 nm as a measure of anthocyanin levels on a per-seedling basis.
For irradiation of Brassica seedlings with monochromatic lights, blue, red, and far-red light sources were custom designed. The blue and red light sources consist of 31 x 12 array of light-emitting diodes (LED) selected for their spectral quality. Each LED ( Sequence data from this article can be found in the GenBank/EMBL data libraries under the following accession numbers: AtCRY, Q43125; LeCRY1, AAD44161; PsCRY1, AAO23970; OmCRY1, AAR08429; LeCRY1B, AAL02092; OsCRY1b, BAB70688; SbCRY2, AAN37909; OsCRY1a, BAB70686; AcCRY2, BAA32808; AcCRY1, BAA32807; PpCRY1a, BAA83338; PpCRY1b, BAB70665; AcCRY3, BAA32809; AcCRY4, BAA88423; OsCRY2, BAC78798; LeCRY2, AAF72556; AcRY5, BAA88424; AtCRY2, AAL16379; ArCRY2-3, BAC67178; ArCRY2-4, BAC67179; ArCRY2-1, BAC67176; PsCRY2b AAO23972; OsCRY1, BAA82885; ArCRY2-2, BAC67177; PsCRY2a, AAO23971; OsCRY2 (indica var.), CAC82538; CrCPH1, AAC37438; AtCRYDASH, NP_568461; and SaPHR, X72019.
We sincerely thank Drs. Margaret Ahmad and Akhilesh K. Tyagi for useful suggestions, Dibyendu Kumar for assistance in phylogenetic analysis, and Dr. Anil K. Tyagi for providing facilities and assistance in raising anti-BnCRY1 antibodies. We are grateful to Arvind Dixit for design and assembly of the light sources. Received December 27, 2005; returned for revision February 17, 2006; accepted February 17, 2006.
1 This work was supported by the Department of Biotechnology, Government of India, and through infrastructural support from the University Grants Commission, New Delhi, by the Department of Science and Technology, Government of India, and by the Council of Scientific and Industrial Research, New Delhi (research fellowship to M.C. and P.S.). 
2 Present address: Department of Horticulture, 233 Horticulture Hall, Iowa State University, Ames, Iowa 50011. The author responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors (www.plantphysiol.org) is: Jitendra P. Khurana (khuranaj{at}genomeindia.org). Article, publication date, and citation information can be found at www.plantphysiol.org/cgi/doi/10.1104/pp.105.076323. * Corresponding author; e-mail khuranaj{at}genomeindia.org; fax 91–11–24115270.
Ahmad M, Cashmore AR (1993) HY4 gene of A. thaliana encodes a protein with characteristics of a blue-light photoreceptor. Nature 366: 162–166[CrossRef][Medline] Ahmad M, Jarillo JA, Cashmore AR (1998a) Chimeric proteins between CRY1 and CRY2 Arabidopsis blue light photoreceptors indicate overlapping functions and varying protein stability. Plant Cell 10: 197–207 Ahmad M, Jarillo JA, Smirnova O, Cashmore AR (1998b) The CRY1 blue light photoreceptor of Arabidopsis interacts with phytochrome A in vitro. Mol Cell 1: 939–948[CrossRef][Web of Science][Medline] Ahmad M, Lin C, Cashmore AR (1995) Mutations throughout an Arabidopsis blue-light photoreceptor impair blue-light-responsive anthocyanin accumulation and inhibition of hypocotyl elongation. Plant J 8: 653–658[CrossRef][Web of Science][Medline] An G, Ebert P, Mitra A, Ha S (1988) Binary vectors. In SB Gelvin, RA Schilperoort, eds, Plant Molecular Biology Manual. Kluwer Academic Publishers, Dordrecht, The Netherlands, pp A3 1–19 Banerjee R, Batschauer A (2005) Plant blue-light receptors. Planta 220: 498–502[CrossRef][Web of Science][Medline] Bharti AK, Khurana JP (1997) Mutants of Arabidopsis as tools to understand the regulation of phenylpropanoid pathway and UV-B protection mechanisms. Photochem Photobiol 65: 765–776[Web of Science][Medline] Bharti AK, Khurana JP (2003) Molecular characterization of transparent testa (tt) mutants of Arabidopsis thaliana (ecotype Estland) impaired in flavonoid biosynthesis pathway. Plant Sci 165: 1321–1332[CrossRef][Web of Science] Botto JF, Alonso-Blanco C, Garzaron I, Sanchez RA, Casal JJ (2003) The Cape Verde Islands allele of cryptochrome 2 enhances cotyledon unfolding in the absence of blue light in Arabidopsis. Plant Physiol 133: 1547–1556 Brautigam CA, Smith BS, Ma Z, Palnitkar M, Tomchick DR, Machius M, Deisenhofer J (2004) Structure of the photolyase-like domain of cryptochrome 1 from Arabidopsis thaliana. Proc Natl Acad Sci USA 33: 12142–12147 Briggs WR, Olney MA (2001) Photoreceptors in plant photomorphogenesis to date. Five phytochromes, two cryptochromes, one phototropin, and one superchrome. Plant Physiol 125: 85–88 Brudler R, Hitomi K, Daiyasu H, Toh H, Kucho K, Ishiura M, Kanehisa M, Roberts VA, Todo T, Tainer JA, et al (2003) Identification of a new cryptochrome class. Structure, function, and evolution. Mol Cell 11: 59–67[CrossRef][Web of Science][Medline] Casal JJ (2000) Phytochromes, cryptochromes, phototropin: photoreceptor interactions in plants. Photochem Photobiol 71: 1–11[CrossRef][Web of Science][Medline] Cashmore AR (2003) Cryptochromes: enabling plants and animals to determine circadian time. Cell 114: 537–543[CrossRef][Web of Science][Medline] Chen M, Chory J, Fankhauser C (2004) Light signal transduction in higher plants. Annu Rev Genet 38: 87–117[CrossRef][Web of Science][Medline] Dellaporta SL, Wood J, Hicks JB (1983) A plant DNA minipreparation: version 2. Plant Mol Biol Rep 1: 19–22[CrossRef] Devlin PF, Kay SA (1999) Cryptochromes: bringing the blues to circadian rhythms. Trends Cell Biol 9: 295–298[CrossRef][Web of Science][Medline] Devlin PF, Kay SA (2000) Cryptochromes are required for phytochrome signaling to the circadian clock but not for rhythmicity. Plant Cell 12: 2499–2510 Duek PD, Fankhauser C (2003) HFR1, a putative bHLH transcription factor, mediates both phytochrome A and cryptochrome signalling. Plant J 34: 827–836[CrossRef][Web of Science][Medline] Emery P, So WV, Kaneko M, Hall JC, Rosbash M (1998) CRY, a Drosophila clock and light-regulated cryptochrome, is a major contributor to circadian rhythm resetting and photosensitivity. Cell 95: 669–679[CrossRef][Web of Science][Medline] Feinbaum RL, Ausubel FM (1988) Transcriptional regulation of the Arabidopsis thaliana chalcone synthase gene. Mol Cell Biol 8: 1985–1992 Folta KM, Pontin MA, Karlin-Neumann G, Bottini R, Spalding EP (2003) Genomic and physiological studies of early cryptochrome 1 action demonstrate roles for auxin and gibberellin in the control of hypocotyl growth by blue light. Plant J 36: 203–214[CrossRef][Web of Science][Medline] Folta KM, Spalding EP (2001) Opposing roles of phytochrome A and phytochrome B in early cryptochrome-mediated growth inhibition. Plant J 28: 333–340[CrossRef][Web of Science][Medline] Franklin KA, Whitelam GC (2004) Light signals, phytochromes and cross-talk with other environmental cues. J Exp Bot 55: 271–276 Frohnmeyer H, Staiger D (2003) Ultraviolet-B radiation-mediated responses in plants. Balancing damage and protection. Plant Physiol 133: 1420–1428 Geourjon C, Deleage G (1994) SOPM: a self-optimized method for protein secondary structure prediction. Protein Eng 7: 157–164 Giliberto L, Perrotta G, Pallara P, Weller JL, Fraser PD, Bramley PM, Fiore A, Tavazza M, Giuliano G (2005) Manipulation of the blue light photoreceptor cryptochrome 2 in tomato affects vegetative development, flowering time, and fruit anti-oxidant content. Plant Physiol 137: 199–208 Giovani B, Byrdin M, Ahmad M, Brettel K (2003) Light-induced electron transfer in a cryptochrome blue-light photoreceptor. Nat Struct Biol 10: 489–490[CrossRef][Web of Science][Medline] Guilfoyle TJ (1997) The structure of plant gene promoters. In JK Setlow, ed, Genetic Engineering. Plenum Press, New York, pp 15–47 Guo H, Duong H, Ma N, Lin C (1999) The Arabidopsis blue light receptor cryptochrome 2 is a nuclear protein regulated by a blue light dependent post-translational mechanism. Plant J 19: 279–287[CrossRef][Web of Science][Medline] Guo H, Mockler T, Duong H, Lin C (2001) SUB1, an Arabidopsis Ca2+-binding protein involved in cryptochrome and phytochrome coaction. Science 291: 487–490 Guo H, Yang H, Mockler TC, Lin C (1998) Regulation of flowering time by Arabidopsis photoreceptors. Science 279: 1360–1363 Gyula P, Schafer E, Nagy F (2003) Light perception and signalling in higher plants. Curr Opin Plant Biol 6: 446–452[CrossRef][Web of Science][Medline] Higo K, Ugawa Y, Iwamoto M, Korenaga T (1999) Plant cis-acting regulatory DNA elements (PLACE) database. Nucleic Acids Res 27: 297–300 Hoffman PD, Batschauer A, Hays JB (1996) PHH1, a novel gene from Arabidopsis thaliana that encodes a protein similar to plant blue-light photoreceptors and microbial photolyases. Mol Gen Genet 253: 259–265[CrossRef][Web of Science][Medline] Imaizumi T, Kadota A, Hasebe M, Wada M (2002) Cryptochrome light signals control development to suppress auxin sensitivity in the moss Physcomitrella patens. Plant Cell 14: 373–386 Imaizumi T, Kanegae T, Wada M (2000) Cryptochrome nucleocytoplasmic distribution and gene expression are regulated by light quality in the fern Adiantum capillus-veneris. Plant Cell 12: 81–96 Imaizumi T, Kiyosue T, Kanegae T, Wada M (1999) Cloning of the cDNA encoding the blue light photoreceptor cryptochrome from the moss Physcomitrella patens (accession no. AB027528). Plant Physiol 120: 1205 Jefferson RA, Kavanagh TA, Bevan MW (1987) GUS fusions: Kanegae T, Wada M (1998) Isolation and characterization of homologues of plant blue-light photoreceptor (cryptochrome) genes from the fern Adiantum capillus-veneris. Mol Gen Genet 259: 345–353[CrossRef][Web of Science][Medline] Kang X, Chong J, Ni M (2005) HYPERSENSITIVE TO RED AND BLUE 1, a ZZ-type zinc finger protein, regulates phytochrome B-mediated red and cryptochrome-mediated blue light responses. Plant Cell 17: 822–835 Khurana JP (2001) Cryptic blues: mechanism in sight! Curr Sci 80: 189–198 Khurana JP, Dasgupta U, Laxmi A, Kumar D, Paul LK (2004) Light control of plant development by phytochromes: a perspective. Proc Indian Natl Sci Acad Part B Biol Sci 70: 379–411 Khurana JP, Kochhar A, Tyagi AK (1998) Photosensory perception and signal transduction in higher plants: molecular genetic analysis. CRC Crit Rev Plant Sci 17: 465–539[CrossRef] Kleine T, Lockhart P, Batschauer A (2003) An Arabidopsis protein closely related to Synechocystis cryptochrome is targeted to organelles. Plant J 35: 93–103[CrossRef][Web of Science][Medline] Kobayashi K, Kanno S, Smit B, Van der Horst GT, Takao M, Yasui A (1998) Characterization of photolyase/blue-light receptor homologs in mouse and human cells. Nucleic Acids Res 26: 5086–5092 Kobayashi Y, Ishikawa T, Hirayama J, Daiyasu H, Kanai S, Toh H, Fukuda I, Tsujimura T, Terada N, Kamei Y, et al (2000) Molecular analysis of zebrafish photolyase/cryptochrome family: two types of cryptochromes present in zebrafish. Genes Cells 5: 725–738[Abstract] Kulshreshtha R, Kumar N, Balyan HS, Gupta PK, Khurana P, Tyagi AK, Khurana JP (2005) Structural characterization, expression analysis and evolution of the red/far-red sensing photoreceptor gene, PHYTOCHROME C (PHYC), localized on the ‘B’ genome of hexaploid wheat (Triticum aestivum L.). Planta 221: 675–689[CrossRef][Web of Science][Medline] Kumar D (2000) Isolation and characterization of OsCRY2 cDNA from rice (Oryza sativa L.) encoding a sensory blue light receptor, cryptochrome 2. M.Phil. thesis. University of Delhi, Delhi, India Lakshmikumaran M, Das S, Srivastava PS (2003) Application of molecular markers in Brassica coenospecies: comparative mapping and tagging. In T Nagata, S Tabata, eds, Brassicas and Legumes: From Genome Structure to Breeding. Springer-Verlag, Berlin, pp 37–68 Lin C (2002) Blue light receptors and signal transduction. Plant Cell (Suppl) 14: S207–S225 Lin C, Ahmad M, Cashmore AR (1996a) Arabidopsis cryptochrome 1 is a soluble protein mediating blue light-dependent regulation of plant growth and development. Plant J 10: 893–902[CrossRef][Web of Science][Medline] Lin C, Ahmad M, Chan J, Cashmore AR (1996b) CRY2: a second member of the Arabidopsis cryptochrome gene family (accession no. U43397). Plant Physiol 110: 1047 Lin C, Robertson DE, Ahmad M, Raibekas AA, Jorns MS, Dutton PL, Cashmore AR (1995) Association of flavin adenine dinucleotide with the Arabidopsis blue light receptor CRY1. Science 269: 968–970 Lin C, Shalitin D (2003) Cryptochrome structure and signal transduction. Annu Rev Plant Biol 54: 469–496[CrossRef][Medline] Lin C, Yang H, Guo H, Mockler T, Chen J, Cashmore AR (1998) Enhancement of blue-light sensitivity of Arabidopsis seedlings by a blue light receptor cryptochrome 2. Proc Natl Acad Sci USA 95: 2686–2690 Malhotra K, Baer M, Li YF, Sancar GB, Sancar A (1992) Identification of chromophore binding domains of yeast DNA photolyase. J Biol Chem 267: 2909–2914 Malhotra K, Kim ST, Batschauer A, Dawut L, Sancar A (1995) Putative blue-light photoreceptors from Arabidopsis thaliana and Sinapis alba with a high degree of sequence homology to DNA photolyase contain the two photolyase cofactors but lack DNA repair activity. Biochemistry 34: 6892–6899[CrossRef][Medline] Matsumoto N, Hirano T, Iwasaki T, Yamamoto N (2003) Functional analysis and intracellular localization of rice cryptochromes. Plant Physiol 133: 1494–1503 Millar AJ (2003) A suite of photoreceptors entrains the plant circadian clock. J Biol Rhythms 18: 217–226 Mockler TC, Guo H, Yang H, Duong H, Lin C (1999) Antagonistic actions of Arabidopsis cryptochromes and phytochrome B in the regulation of floral induction. Development 126: 2073–2082[Abstract] Moller SG, Kim YS, Kunkel T, Chua NH (2003) PP7 is a positive regulator of blue light signaling in Arabidopsis. Plant Cell 15: 1111–1119 Nagy F, Kay SA, Chua N-H (1988) Analysis of gene expression in transgenic plants. In SB Gelvin, RA Schilperoort, DPS Verma, eds, Plant Molecular Biology Manual. Kluwer Academic Publishers, Dordrecht, The Netherlands, pp B4 1–29 Ninu L, Ahmad M, Miarelli C, Cashmore AR, Giuliano G (1999) Cryptochrome 1 controls tomato development in response to blue light. Plant J 18: 551–556[CrossRef][Web of Science][Medline] Okazawa A, Trakulnaleamsai C, Hiramatsu H, Fukusaki E, Yoneyama K, Takeuchi Y, Kobayashi A (2005) Cloning of a cryptochrome homologue from the holoparasitic plant Orobanche minor Sm. Plant Physiol Biochem 43: 499–502[CrossRef][Web of Science][Medline] Perrotta G, Ninu L, Flamma F, Weller JL, Kendrick RE, Nebuloso E, Giuliano G (2000) Tomato contains homologues of Arabidopsis cryptochromes 1 and 2. Plant Mol Biol 42: 765–773[CrossRef][Web of Science][Medline] Perrotta G, Yahoubyan G, Nebuloso E, Renzi L, Giuliano G (2001) Tomato and barley contain duplicated copies of cryptochrome 1. Plant Cell Environ 24: 991–997 Piechulla B, Merforth N, Rudolph B (1998) Identification of tomato Lhc promoter regions necessary for circadian expression. Plant Mol Biol 38: 655–662[CrossRef][Web of Science][Medline] Platten JD, Foo E, Elliott RC, Hecht V, Reid JB, Weller JL (2005a) Cryptochrome 1 contributes to blue light sensing in pea. Plant Physiol 139: 1472–1482 Platten JD, Foo E, Foucher F, Hecht V, Reid JB, Weller JL (2005b) The cryptochrome gene family in pea includes two differentially expressed CRY2 genes. Plant Mol Biol 59: 683–696[CrossRef][Web of Science][Medline] Quail PH (2002) Photosensory perception and signalling in plant cells: new paradigms? Curr Opin Cell Biol 14: 180–188[CrossRef][Web of Science][Medline] Sancar A (2004) Regulation of the mammalian circadian clock by cryptochrome. J Biol Chem 279: 34079–34082 Sanderson MJ, Thorne JL, Wikstrom N, Bremer K (2004) Molecular evidence on plant divergence times. Am J Bot 91: 1656–1665 Sang Y, Li Q-H, Rubio V, Zhang Y-C, Mao J, Deng X-W, Yang H-Q (2005) N-terminal domain-mediated homodimerization is required for photoreceptor activity of Arabidopsis cryptochrome 1. Plant Cell 17: 1569–1584 Santos MA (1991) An improved method for the small scale preparation of bacteriophage DNA based on phage precipitation by zinc chloride. Nucleic Acids Res 19: 5442 Shalitin D, Yang H, Mockler TC, Maymon M, Guo H, Whitelam GC, Lin C (2002) Regulation of Arabidopsis cryptochrome 2 by blue-light-dependent phosphorylation. Nature 417: 763–767[CrossRef][Medline] Shalitin D, Yu X, Maymon M, Mockler T, Lin C (2003) Blue light-dependent in vivo and in vitro phosphorylation of Arabidopsis cryptochrome 1. Plant Cell 15: 2421–2429 Sharpe AG, Parker IA, Keith DJ, Lydiate DJ (1995) Frequent nonreciprocal translocations in the amphidipliod genome of oilseed rape (Brassica napus). Genome 38: 1112–1121[Medline] Small GD, Min B, Lefebvre PA (1995) Characterization of a Chlamydomonas reinhardtii gene encoding a protein of the DNA photolyase/blue light photoreceptor family. Plant Mol Biol 28: 443–454[CrossRef][Web of Science][Medline] Song KM, Osborn TC, Williams PH (1988) Brassica taxonomy based on nuclear restriction fragment length polymorphism (RFLPs). 1. Genome evolution of diploid and amphidiploid species. Theor Appl Genet 75: 784–794 Sullivan JA, Deng XW (2003) From seed to seed: the role of photoreceptors in Arabidopsis development. Dev Biol 260: 289–297[CrossRef][Web of Science][Medline] Terzaghi WB, Cashmore AR (1995) Light regulated transcription. Annu Rev Plant Physiol Plant Mol Biol 46: 445–474[CrossRef][Web of Science] Thakur JK, Malik MR, Bhatt V, Reddy MK, Sopory SK, Tyagi AK, Khurana JP (2003) A POLYCOMB group gene of rice (Oryza sativa L. subspecies indica), OsiEZ1, codes for a nuclear localized protein expressed preferentially in young seedlings and during reproductive development. Gene 314: 1–13[Medline] Thompson JD, Higgins DG, Gibson TJ (1994) CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 22: 4673–4680 Toth R, Kevei E, Hall A, Millar AJ, Nagy F, Kozma-Bognar L (2001) Circadian clock-regulated expression of phytochrome and cryptochrome genes in Arabidopsis. Plant Physiol 127: 1607–1616 Towbin H, Staehelin T, Gordon J (1979) Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proc Natl Acad Sci USA 76: 4350–4354 Tyagi AK, Gaur T (2003) Light regulation of nuclear photosynthetic genes in higher plants. CRC Crit Rev Plant Sci 22: 417–452 Valvekens D, Lijsebettens MV, Montagu MV (1992) Arabidopsis regeneration and transformation (root explant system). In K Lindsay, ed, Plant Tissue Culture Manual. Kluwer Academic Publishers, Dordrecht, The Netherlands, pp A8 1–17 van der Spek PJ, Kobayashi K, Bootsma D, Takao M, Eker AP, Yasui A (1996) Cloning, tissue expression, and mapping of a human photolyase homolog with similarity to plant blue-light receptors. Genomics 37: 177–182[CrossRef][Web of Science][Medline] Wang H, Ma LG, Li JM, Zhao HY, Deng XW (2001) Direct interaction of Arabidopsis cryptochromes with COP1 in light control of development. Science 294: 154–158 Wang Z-Y, Kenigsbuch D, Sun L, Harel E, Ong MS, Tobin EM (1997) A myb-related transcription factor is involved in the phytochrome regulation of an Arabidopsis Lhcb gene. Plant Cell 9: 491–507[Abstract] Ward JM, Cufr CA, Denzel MA, Neff MM (2005) The Dof transcription factor OBP3 modulates phytochrome and cryptochrome signaling in Arabidopsis. Plant Cell 17: 475–485 Yadav V, Mallapa C, Gangappa SN, Bhatia S, Chattopadhyay S (2005) A basic helix-loop-helix transcription factor in Arabidopsis, MYC2, acts as a repressor of blue light-mediated photomorphogenic growth. Plant Cell 17: 1953–1966 Yang HQ, Tang RH, Cashmore AR (2001) The signaling mechanism of Arabidopsis CRY1 involves direct interaction with COP1. Plant Cell 13: 2573–2587 Yang HQ, Wu Y, Tang RH, Liu D, Liu Y, Cashmore AR (2000) The C-termini of Arabidopsis cryptochrome mediate a constitutive light response. Cell 103: 815–827[CrossRef][Web of Science][Medline] Zeugner A, Byrdin M, Bouly J-P, Bakrim N, Giovani B, Brettel K, Ahmad M (2005) Light-induced electron transfer in Arabidopsis cryptochrome-1 correlates with in vivo function. J Biol Chem 280: 19437–19440 Zivy M, Thiellement H, de Vienne D, Hofmann JP (1983) Study on nuclear and cytoplasmic genome expression in wheat by two dimensional gel electrophoresis. Theor Appl Genet 66: 1–7 This article has been cited by other articles:
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ASPB Publications | PLANT PHYSIOLOGY® | THE PLANT CELL | |
|---|---|---|---|
TOP
ABSTRACT
RESULTS
symbols indicate the residues interacting with FAD and MTHF, respectively. Lines above the sequences mark the DAS domain present in the C-terminal region. The predicted secondary structure of BnCRY1 as determined using SOPM is shown below the alignment data and consists of 
DNA. Restriction enzymes used for digesting genomic DNA have been indicated on the top of the sections.
