| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
|
First published online April 28, 2006; 10.1104/pp.106.081240 Plant Physiology 141:620-637 (2006) © 2006 American Society of Plant Biologists OPEN ACCESS ARTICLE
Gene Expression Programs during Shoot, Root, and Callus Development in Arabidopsis Tissue Culture1,[W],[OA]Plant Sciences Institute (P.C., S.L., S.H.H.) and Department of Statistics (D.N.), Iowa State University, Ames, Iowa 50011
Shoots can be regenerated from Arabidopsis (Arabidopsis thaliana) root explants in tissue culture through a two-step process requiring preincubation on an auxin-rich callus induction medium. Regenerating tissues can be directed along different developmental pathways leading to the formation of shoots, new roots, or callus by transferring to the appropriate organ induction medium. Using gene-profiling methods, we identified groups of genes that serve as molecular signatures of the different developmental processes, i.e. genes that were specifically up- or down-regulated on one developmental pathway, but not on others. One transcription factor gene that was up-regulated during early shoot development was RAP2.6L (At5g13330), a member of the ERF (ethylene response factor) subfamily B-4 of the ERF/APETALA2 transcription factor gene family. RAP2.6L functions in shoot regeneration because T-DNA knockdown mutations in the gene reduced the efficiency of shoot formation in tissue culture, but not normal embryo or seedling development. RAP2.6L promoter:  -glucuronidase fusions demonstrated that the up-regulation of the gene during shoot regeneration was, at least in part, transcriptionally controlled. The promoter:-glucuronidase fusions also demonstrated that RAP2.6L expression was localized to the shoot and emerging leaves, but expression declined in the leaf lamina as leaves expanded. T-DNA knockdown mutations in RAP2.6L reduced the expression of many genes that are normally up-regulated during shoot development including CUP-SHAPED COTYLEDON2 that is involved in shoot meristem specification. Thus, RAP2.6L appears to be part of a network involved in regulating the expression of many other genes in shoot regeneration.
Nearly a half century ago, Skoog and Miller (1957)  showed that the developmental fate of regenerating tobacco (Nicotiana tabacum) pith tissue in culture could be directed by the plant hormones cytokinin and auxin. Shoots were produced at high concentrations of cytokinin relative to auxin, while roots were formed when the ratios were reversed. Undifferentiated tissue or callus formed at hormone concentrations that were optimal for callus growth, but not for shoot or root formation. The ability to direct the course of development by two simple plant hormones has intrigued plant biologists for years.
Much has been learned in the past few years about cytokinin and auxin signaling, but less is known about the developmental events downstream. Cytokinin signal transduction involves a multicomponent phosphorelay signaling system (Imamura et al., 1999
In this report, we used gene expression profiling to highlight genes that are specifically up- or down-regulated during the regeneration of shoots, roots, or calli from root explants with the goal of identifying molecular signatures for these developmental processes. In Arabidopsis, shoots are typically regenerated from root and/or hypocotyl explants by indirect organogenesis, which involves a period of callus formation prior to shoot induction (Valvekens et al., 1988
When CIM-preincubated root explants are transferred to a cytokinin-rich SIM, they first become committed to form shoots (will form shoots if transferred to basal medium) and then shoots emerge (Cary et al., 2002 In this study, we conducted a global analysis of gene expression during the acquisition of competence and during the regeneration of shoots, roots, and callus. In addition, we focused on the role of ERF/AP2 transcription factor RAP2.6L (a B-4 subfamily member), encoded by a gene that was specifically up-regulated during shoot regeneration. T-DNA knockdown mutations in RAP2.6L reduced the efficiency of shoot development and impacted the expression of shoot meristem-specifying genes. This analysis, therefore, allowed us to link an early responder in cytokinin signaling to events in shoot development.
Gene Expression Programs during CIM Preincubation
Shoots, callus, or roots can be regenerated from root explants in Arabidopsis tissue culture (Fig. 1
). Shoots are regenerated in a two-step process whereby root explants are preincubated for a few days on an auxin-rich CIM (we refer to the preincubation period on CIM as CIM preincubation or preCIM to distinguish it from later incubation on CIM; Valvekens et al., 1988
To gain a better understanding of the molecular events surrounding the acquisition of competence and the early developmental events in shoot, callus, and root development, gene expression patterns were profiled during CIM preincubation and SIM, CIM, and root induction medium (RIM) incubation (Fig. 1). Affymetrix Arabidopsis gene chips (ATH1) were used to profile gene expression in a randomized complete block design with two independent replications. In each replicated experiment, root explant samples were randomly collected for RNA extraction at each of nine time points: day 0, two time points during the preincubation period on CIM, and at two time points during incubation on SIM, RIM, or on further incubation on fresh CIM (Fig. 1). A standard ANOVA conducted for each gene indicated that thousands of genes exhibited some evidence of differential expression across the nine time points. Using the method of Storey and Tibshirani (2003) , nearly half (10,700 out of 22,810) of the probe sets exhibited nonconstant expression profiles when controlling the false discovery rate (FDR) at the 0.01 level.
To identify genes that were up-regulated during CIM preincubation, we required that the estimated mean level of expression at 4 d preCIM be significantly greater than the estimated mean prior to preincubation (0 d preCIM) when controlling the FDR at the level of 0.02 using the method of Storey and Tibshirani (2003)
A similar analysis was conducted to identify genes down-regulated during preincubation on CIM. Among the most highly down-regulated genes between 0 and 4 d preCIM were seven that encoded class III peroxidases (Table I). These enzymes are involved in a variety of functions including lignification, suberization, auxin catabolism, wound healing, and defense against pathogen infection (Hiraga et al., 2001 ). Their down-regulation suggests that functions such as vascular lignification are compromised during CIM preincubation. Of the 502 genes down-regulated more than 10-fold, a greater number than anticipated from their frequency in the total genome encoded proteins associated with other membranes, i.e. other than those known to be associated with chloroplast, mitochondrial, plasma, endoplasmic reticulum, and Golgi membranes (Table II).
Following CIM preincubation, root explants can be transferred to cytokinin-rich SIM to induce shoot formation, to another auxin-rich RIM to form shoots, or further incubated on CIM to promote more callus formation. The morphogenic events that occur during these developmental processes in Arabidopsis tissue culture have been described by Huang and Yeoman (1984)
We examined gene expression programs on the three different developmental pathways, up to 10 d SIM, CIM, or RIM (10 d SIM, for example, means that root explants have been cultured for a total of 10 d, 4 d preincubation on CIM followed by 6 d incubation on SIM; Fig. 1). Ten-day SIM is about the time of shoot commitment, defined as the developmental stage when root explants can be transferred to basal medium and still continue to form shoots (Cary et al., 2002
We were particularly interested in genes that are specifically up- or down-regulated early in development on one pathway, but not on the others. To identify genes specifically up- or down-regulated during shoot development, we required that the estimated mean level of expression at 10 d SIM be greater for up-regulated genes or lesser in the case of down-regulated genes than the estimated mean at each of 4 d CIM, 7 d CIM, 10 d CIM, 7 d RIM, and 10 d RIM and to have a q value (Storey and Tibshirani, 2003 By these criteria, 478 genes were specifically up-regulated and 397 were down-regulated during early shoot development, 568 up-regulated while 583 down-regulated during root development, and 241 up-regulated and 373 down-regulated during callus development (Supplemental Table II). The up-regulated genes were categorized with respect to their assigned cellular compartments, molecular function, and biological processes (gene ontology [GO], The Arabidopsis Information Resource). Of the genes up-regulated during shoot development, genes encoding proteins targeted to chloroplasts were found in 2.2-fold excess over their frequency in the total genome, reflecting the fact that greening occurs (green callus formation) during these stages (Table II, GO cellular component). Among shoot development down-regulated genes, those encoding proteins targeted to the nucleus were found 2.1-fold excess over their presence in the total genome. Genes up-regulated during root development encoding proteins with transporter activity occurred in 1.9-fold excess over their expected frequency (Table II, GO molecular function). During callus development, a greater frequency than expected of up-regulated genes were involved in response to stress (1.9-fold excess; Table II, biological process).
From Supplemental Table II we extracted the top 20 most highly up- or down-regulated genes on the three different developmental pathways (Table III
). The genes were rank ordered on the shoot development pathway by fold increase or decrease in comparing estimated mean expression levels (signal intensities) at 7 d SIM with 0 time (Table III). The top three most highly up-regulated genes during shoot development encoded GA 2-oxidase (At1g30040; Fig. 3A), a cytochrome P450 (At3g19270; Fig. 3B
), and a GA-regulated protein (At1g74670). Brenner et al. (2005)
In root development, genes were rank ordered by comparing 7 d RIM to 4 d CIM. Those times were chosen because the expression pattern most common to up-regulated root development-specific genes was one that declined during CIM preincubation and rose again on transfer to RIM. Several peroxidases numbered among the highly up-regulated root-specific genes (Table III), including peroxidase ATP12a (At1g05250; Fig. 3D). The peroxidases are most likely involved in cell wall or vascular synthesis in root development. The other most highly up-regulated root-specific genes encoded a germin-like protein (At5g38930; Fig. 3E) and glutathione S-transferase (At1g49860). Again, as might be expected, many of the top 20 genes (13 out of 19 for which there are data in AtGenExpress) specifically up-regulated during root regeneration represent genes that are most highly expressed in roots. The most highly down-regulated genes were a fairly heterogeneous group but included a cytokinin oxidase (At2g41510; Fig. 3F) and two genes encoding proteins involved in carotenoid metabolism (At1g30100 and At4g25700; Table III). In callus development, callus development-specific genes were rank ordered by fold increase in the comparison of estimated mean expression levels at 7 d CIM with 0 time (Table III). The most highly up-regulated genes in callus development encoded an unknown, expressed protein (At3g60420; Fig. 3G) and acireductone dioxygenase (At2g26400; Fig. 3H). The top 20 most highly up-regulated genes during callus development were a mixed group of genes with respect to where they are ultimately most highly expressed in plants. The most highly down-regulated genes included a DR4 protease inhibitor (At1g73330; Fig. 3I), two peroxidase genes (At5g17820 and At5g666390), a couple of pEARLI 1 genes (At4g12480 and At4g12470), and two that encoded subtilases (At5g59090 and At5g44530; Table III). Here, the most highly down-regulated genes were root-specific genes (12 out of 19) possibly reflecting a dedifferentiation process in root explants during callus development.
To gain a better understanding of the regulation of large groups of genes on different developmental pathways, we focused on the expression of transcription factors that are specifically up-regulated on one pathway, but not the others. No single class of transcription factors dominated any one pathway (Supplemental Table II), however, several genes specifically up-regulated on the shoot development pathway-encoded A-type ARRs, such as ARR15 (At1g74890) and ARR16 (At2g40670; Table III). Some A-type ARRs are thought to be non-DNA-binding gene expression regulators (Imamura et al., 1999
RAP2.6L was selected for further study because preliminary evidence from T-DNA insertion lines indicated that the gene functions during shoot regeneration in culture. Three Salk T-DNA lines (designated here as rap2.6L-1, -2, and -3) available at the time when this study was initiated were made homozygous as determined by PCR analysis (Fig. 4A ). The T-DNA in rap2.6L-1 is inserted 1 bp upstream from the start of transcription. T-DNAs in both rap2.6L-2 and -3 appeared to be compound insertions (with two left borders [LBs]) and located in the single, large intron (Fig. 4A). Homozygous lines were recovered and assayed for the presence of transcripts. Full-length transcripts were observed in wild type but only trace amounts, if any, in rap2.6L-1, 2, and 3 when assayed at 10 d SIM during shoot development in root explants (Fig. 4B). Transcript levels were severely reduced in the T-DNA insertion mutants during seedling development as well (data obtained for rap2.6L-2 not shown), however, the mutants had no obvious seedling or mature plant phenotype.
However, shoot formation in culture in rap2.6L-2 was severely impaired. There were fewer shoots after 17 d SIM (0.63 ± 0.03 shoots/explant; Fig. 4D) compared to wild type (1.64 ± 0.20 shoots/explant; Fig. 4C). In addition, the shoots on rap2.6L-2 explants were smaller and less green giving an overall appearance of much diminished shoot formation in the mutant compared to wild type. The rap2.6L-1 and -3 mutants behaved similarly (data not shown), providing additional evidence that the shoot regeneration phenotype is, indeed, due to the T-DNA mutation. Attempts were made to rescue rap2.6L-2 with a 35S promoter:RAP2.6L-myc cDNA construct. The construct was partially successful in restoring the shoot regeneration phenotype (Fig. 4E).
To further confirm that the T-DNA insertions in the RAP2.6L gene were most likely responsible for the shoot regeneration phenotype, rap2.6L-2 was crossed with wild type and F2s, generated by selfing F1s, were analyzed for the segregation of the T-DNA and the defect in shoot regeneration. The F2 segregants yielded 28 wild type:45 heterozygous T-DNA:23 homozygous T-DNA, which approximated a 1:2:1 pattern (
We also investigated the function of RAP2.6L in shoot development by fusing an ERF-associated amphiphilic repression (EAR) motif to the C terminus of the protein. EAR motifs generally function as transcriptional repressors (Ohta et al., 2001
To strengthen the claim that RAP2.6L is a transcription factor, we examined the subcellular localization of RAP2.6L-
To determine where RAP2.6L is expressed in seedlings, transcriptional fusions (RAP2.6L promoter:GUS constructs) were developed. In untreated seedlings, the construct was largely expressed in the shoot apex and vasculature of roots and leaves (Fig. 6 ). One very interesting feature was that expression in leaf lamina declined as a frontal wave that traversed down the young leaf as it expanded (see arrows in Fig. 6, B and C). The pattern is very reminiscent of sink-to-source transitions that likewise move as a front down young leaves as they grow (Leisner et al., 1992 ; Leisner and Turgeon, 1993). It would be interesting to determine if the two fronts correspond.
Transcriptional fusions were also used to confirm whether up-regulation in RAP2.6L gene expression in root explants during incubation on SIM is, indeed, a transcriptional phenomenon. GUS was expressed at low levels in root vasculature at day 0 and during preincubation on CIM, however, GUS expression increased dramatically when explants were incubated on SIM (Fig. 7A ). Thus, the up-regulation of RAP2.6L has, at least, a strong transcriptional component. RAP2.6L promoter activity (GUS staining) was most intense in regions of the root explant where callus had formed, particularly at the ends of the explanted root segments (Fig. 7A). In cross-sectional view, GUS staining was localized to sites of cell proliferation (Fig. 7, B and C). GUS staining is shown at 7 d SIM, at a time when callus formation is easily recognizable. At this stage the epidermis has deteriorated and the vascular bundle broken apart. Callus tissue, most likely derived from the pericycle and/or vascular parenchyma in the intact root, is heavily GUS stained. It is from this tissue that organs regenerate, however, RAP2.6L expression well precedes any evidence of organ primordia formation (Cary et al., 2002 ).
Downstream Targets of RAP2.6L Expression
Since the T-DNA insertion mutation rap2.6L-2 severely down-regulates the expression of the gene, we attempted to measure the impact of the mutation on the expression of other genes during shoot regeneration as determined by Affymetrix DNA chip analysis. This experiment was performed using three independent wild-type samples and two independent mutant samples. Twenty-four genes showed more than 10-fold down-regulation in rap2.6L-2 compared to wild type when controlling the FDR at the 0.05 level (Table IV
; Supplemental Table III). The RAP2.6L gene itself was down-regulated over 30-fold when rap2.6L-2 was compared to wild type. The two most highly down-regulated genes at 10 d SIM are of unknown function; one (At3g05730) is a shoot development-specific gene that is highly up-regulated during shoot development. Others that were significantly down-regulated included cellulose synthetase, subtilisin-like Ser protease,
The developmental system described here is a powerful tool for studying gene expression during organogenesis in plants. By profiling gene expression during CIM preincubation and during early shoot, root, and callus regeneration, we have developed a framework to define molecular signatures for the different developmental processes.
Many of the genes up-regulated during early stages of shoot development were genes that respond to cytokinin induction, most notably the A-type ARRs (Brandstatter and Kieber, 1998
The genes associated with the acquisition of competence and those that are unique to callus formation were more difficult to categorize. During CIM preincubation, cells in the explants are thought to dedifferentiate and acquire competence to respond to subsequent shoot induction signals. As pointed out, a gene involved in chromatin remodeling, a GNAT, and several transcription factors were highly up-regulated at that time. At later stages of CIM incubation (such as 10 d CIM), cells proliferate and form undifferentiated callus tissue. Many genes that were specifically up-regulated are stress-related factors such as genes encoding a AAA-type ATPase family protein, ATP-binding cassette (ABC) transporter, and a WRKY 38 stress-response transcription factor. Similar stress-related genes form the molecular signature for pluripotent animal cells (Ramalho-Santos et al., 2002 Many of the genes specifically up-regulated during root development on RIM were expressed at high levels on day 0, in the mature root. It might be expected that the molecular signatures for early callus and root regeneration would be quite similar since both represent growth on auxin-rich medium. The most obvious difference was the number of root development-specific genes associated with cell wall and vascular development: peroxidases, extensin, arabinogalactan protein, xyloglucan endotransglycosylase, and so forth.
In this study, we also began to dissect the control of the large-scale gene expression changes that take place during early shoot development. We focused on RAP2.6L (At5g13330), a gene encoding an ERF/AP2 transcription factor, because it was one of the transcription factor genes specifically and highly up-regulated during early shoot development. T-DNA mutations in RAP2.6L reduced the efficiency of shoot regeneration in culture and significantly knocked down the expression of approximately 35% of the 478 genes that are specifically up-regulated on SIM. This would tend to indicate that RAP2.6L acts early and plays a pivotal role during the shoot regeneration process. High on the list of genes impacted by the rap2.6L-2 mutation were genes such as those encoding the catalytic subunit of cellulose synthase, a RNA polymerase II subunit, a subtilisin-like Ser protease, a HPt phosphotransmitter, and a GATA-binding transcription factor. Further down the list, but still significantly down-regulated in the mutant was CUC2, a gene along with CUC1 that is important for shoot regeneration and meristem specification (Aida et al., 1997 We found that a RAP2.6L promoter:GUS construct was expressed in seedlings, primarily in the shoot apex and the vasculature. Tissue-specific microarray expression data from AtGenExpress (http://www.arabidopsis.org/info/expression/ATGenExpress.jsp) confirms that RAP2.6L transcripts are present at highest levels in germinating seedlings and in the developing cotyledons. In RAP2.6L constructs bearing the transcriptional repressor EAR motif (35S promoter:RAP2.6L-EAR), the most obvious phenotype is a defect in cotyledon development. The RAP2.6L-EAR-expressing seedlings bore curled, not fully expanded cotyledons, often intercalated with nonchlorophyllous callus.
RAP2.6L is up-regulated when root explants are transferred onto cytokinin-rich SIM, however, there are conflicting observations whether cytokinin alone is sufficient to up-regulate the expression of the gene. For example, we have treated seedlings with various concentrations of cytokinin and at various times (usually hours) and not observed up-regulation in RAP2.6L promoter:GUS expression. Also, microarray data at AtGenExpress indicate that RAP2.6L is not significantly up-regulated in seedlings of a similar age treated with transzeatin (1 µM). On the other hand, Brenner et al. (2005) Finally, the observation that seedlings develop normally, but shoots do not efficiently regenerate in the rap2.6L-2 mutant argues that the gene malfunction is less well compensated during shoot regeneration in culture than during shoot formation in seedling development. However, the huge loss in expression of many shoot-specific genes during shoot regeneration in rap2.6L-2 demonstrates the key role for this gene in shoot regeneration.
Plant Material and Culture Conditions
Arabidopsis (Arabidopsis thaliana) seedlings (ecotype Columbia-0) were grown for 7 d on plant nutrient solution medium (Che et al., 2002
Total RNA was isolated from plant tissues by TRIzol (Life Technologies, Gibco-BRL) extraction. Precipitated RNA was solubilized in water treated with 0.1% (v/v) diethyl pyrocarbonate and purified with a RNeasy kit (Qiagen). Purified RNA was assessed for integrity using an Agilent 2100 Bioanalyzer. Gene expression patterns were profiled using Affymetrix Arabidopsis 22K GeneChips according to procedures described by Che et al. (2002) Semiquantitative RT-PCR analysis was used to confirm various expression patterns determined by microarray. Two micrograms of total RNA were reverse transcribed using Ready-To-Go You-Prime first-strand beads (Amersham) in a 33 µL reaction. PCR was carried out using 2 µL of the RT reaction as template. Cycle numbers were optimized for each sample to obtain data in the exponential range. Amplified DNA fragments were separated on 2% agarose gel and stained with ethidium bromide. The primers used for amplification were as follows. Ubiquitin 5 (At3g62250): UBQ5F (5'-CTTGAAGACGGCCGTACCCTC-3'), UBQ5R (5'-CGCTGAACCTTTCAAGATCCATCG-3'); At2g23170: IAAaseF TCCTCACAAGCTCTGGGACA, IAAaseR CGTTAGGGCTCGTGTACACG; At2g23060: AcetF CCTCATGCTGGTGGCTGAGA, AcetR ATTGACGGAAGCGTGATTGT; At2g03850: LEAF ATGATGCCTCACAGAAAGCT, LEAR TGGAGGCATTATAGCTTCTT; At1g75880: EXL1F GATATTGTAGCGGAAGAGCT, EXL1R CTGAGCAAAAGAACGAGCATTRAP; RAP2.6-like transcription factor (RAP2.6L; At5g13330): Rap2.6-likeF (5'-ACCAGACCAAGATCAACCAAGA-3'), Rap2.6-likeR (5'-TTATTCTCTTGGGTAGTTATAA-3'); CUC2 (At5g53950): CUP3 (5'-CAGCCAATATCTTCCACCGGG-3'), CUP11 (5'-GGAGAGGTGGGAGTGAGACGGA-3').
Microarray experiments to identify shoot, root, and callus-specific genes were designed as a randomized complete block design with two independent replications. Within each replication, 10 plates of root explants were randomly assigned to each of the nine time points as indicated. A total of 18 Affymetrix ATH1 GeneChips were used to measure expression in pools of root explants, with one GeneChip per combination of time point and replication. SAS software was used to conduct a separate ANOVA for each of 22,810 probe sets. Signals were normalized by scaling all GeneChips to a target intensity of 1,500 (see Affymetrix GeneChip GCOS manual: http://www.affymetrix.com/products/software/specific/gcos.affx). The natural logarithm of the scaled signal measure was used as the response variable for each ANOVA. The ANOVA model for each gene included replication and time point effects (with 1 and 8 degrees of freedom, respectively) along with an error term (8 degrees of freedom) essential for testing the statistical significance of observed time point differences. The F test for differences among time point means was used to identify genes in which expression was not constant across all conditions. To identify genes specifically up- and down-regulated during shoot, root, and callus development, several contrasts of time point means were implemented for each gene as part of our ANOVA. Specific contrasts included a comparison of 10 d SIM with each of 4 d CIM, 7 d CIM, 10 d CIM, 7 d RIM, and 10 d RIM to identify shoot development-specific genes; a comparison of 10 d RIM with 4 d CIM, 7 d CIM, 10 d CIM, 7 d SIM, 10 d SIM to identify root development-specific genes; and a comparison of 10 d CIM to 4 d CIM, 7 d RIM, 10 d RIM, 7 d SIM, and 10 d SIM to identify callus development-specific genes.
A set of 22,810 P values was obtained for the F test for time point differences and each of the other seven contrasts of time point means. Each of these sets of P values was converted to q values using an R implementation (R Development Core Team RFfSC; R: A language and environment for statistical computing, http://www.R-project.org [Vienna, Austria]) of the algorithm of Storey and Tibshirani (2003) The microarray analysis to identify the downstream targets of RAP2.6.L (expression in rap2.6L-2 compared to wild type) were identical to the analysis of the developmental time course experiment except that block terms were excluded from the model and gene-specific variance estimates were obtained by pooling across two experiments to obtain sufficient error degrees of freedom (five per gene) for the contrast of interest (rap2.6L-1 mutant versus wild type).
Segregation analysis was performed by genotyping progeny of the rap2.6L-1, -2, or -3 mutants in various crosses. Progeny (usually 7-d-old seedlings) were genotyped by extracting DNA from seedlings (usually from a single cotyledon) using the DNA Quick-prep procedure (see http://www.biotech.wisc.edu/NewServicesandResearch/Arabidopsis/FindingYourPlantIndex.html) and using the following primers for the rap2.6L-1 insertion site. RAP26T3F: 5'-TTGCGATCCCCACTTGTTGT-3'; Rap26T3R: 5'-TGAAAGATGCATTGAACTTG-3'; for the Rap2.6L-2 and -3 insertion sites, AP226F: 5'-TTCGTCTTGGAACGAGACTG-3'; AP226R: 5'-AAAACTGATTCGACCAACAATAA-3' and for the LB of the T-DNA insert (LB: 5'-TGGTCCACGTAGTGGGCCATC-3').
Translational fusions were constructed between RAP2.6L and GUS to examine the subcellular location of RAP2.6L. RAP2.6L with its own promoter was fused in frame to the GUS reporter gene by insertion into the PstI and BamI sites of the multicloning site in the pCAMBIA3300 GUS vector (see http://www.cambia.org/pCAMBIA_vectors.html#Description). RAP2.6L promoter and coding region were amplified using a genomic DNA template and the following primers: Ap2.6GUSF 5'-AACTGCAGCTGATTTTCCTCTTTAAAACGGAAAACA-3' and Ap2.6tGUSR 5'-CGGGATCCTCTCTTGGGTAGTTATAATAATTGTAACC-3'. A transcriptional fusion linking the RAP2.6L promoter to GUS was created by inserting the RAP2.6L promoter into the multicloning site of pCAMBIA3300 GUS. The RAP2.6L promoter was amplified using the following primers: AP2.6proF 5'-AACTGCAGTTGTTCTTCCTTGGTTTT-3' and AP2.6proR CGGGATCCGGCGGTGACATCAGTCTC. The resulting constructs were introduced into Agrobacterium tumefaciens strain C58, which was used to generate transgenic plants by the floral dip method (Clough and Bent, 1998
Histochemical staining for GUS activity was conducted as described by Jefferson (1987) For sectioned material, samples stained for GUS were fixed with formaldehyde/paraformaldehyde, dehydrated in a graded ethanol series, cleared with xylene, infiltrated, and embedded using Paraplast X-Tra paraffin (Fisher Scientific). Sections were made using an A/O 820 rotary microtome (Fisher Scientific). After GUS staining was visualized and photographed, the sections were further stained with 1 µg mL–1 4'-6-diamidino-2-phenylindole (DAPI) for 30 min, and sections were visualized by epifluorescence with an Olympus IX71 microscope.
RAP2.6L constructs bearing the EAR repressor motif (LDLDLELRLGFA) were developed by excising YFP from pSKY by cutting with SpeI and NotI and replacing it with a DNA fragment containing the EAR motif to create pSKEAR. The DNA fragment was assembled from two single-stranded oligomers: EARF 5'-GACTAGTTTAGATCTAGATCTTGAGTTGAGACTGGGTTTCGCCTGAGCGGCCGCTAAACTAT-3' and EARR 5'-ATAGTTTAGCGGCCGCTCAGGCGAAACCCAGTCTCAACTCAAGATCTAGATCTAAACTAGTC-3'. The RAP2.6L coding region was inserted into the AscI and SpeI sites of pSKEAR by amplifying RAP2.6L using the primers described above, 35S promoter:RAP2.6L-myc and 35S promoter:RAP2.6L-YFP constructs were generated by amplifying the insert from a full-length RAP2.6L cDNA clone obtained from the Arabidopsis Biological Resource Center using the primers Ap2RAP2.6LF 5'-TAGCGGCGCGCCATGGTCTCCGCTCTCAGCCG-3' and Ap2RAP2.6LR 5'-GACTAGTTTCTCTTGGGTAGTTATAAT-3' and inserting into the AscI and SpeI sites of pSKM (myc) and pSKY (YFP). The primers were also used to generate 32P-labeled probes used for Northern-blot analysis of RAP2.6L transcripts. Received March 30, 2006; returned for revision April 18, 2006; accepted April 19, 2006.
1 This work was supported by the National Science Foundation (IBN-0236060) and by the National Research Initiative of the U.S. Department of Agriculture Cooperative State Research, Education and Extension Service (grant no. 2003–35304–13363).  The author responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors (www.plantphysiol.org) is: Stephen H. Howell (shh{at}iastate.edu).
[W] The online version of this article contains Web-only data.
[OA] Open Access articles can be viewed online without a subscription. Article, publication date, and citation information can be found at www.plantphysiol.org/cgi/doi/10.1104/pp.106.081240. * Corresponding author; e-mail shh{at}iastate.edu; fax 515–294–5256.
Aida M, Ishida T, Fukaki H, Fujisawa H, Tasaka M (1997) Genes involved in organ separation in Arabidopsis: an analysis of the cup-shaped cotyledon mutant. Plant Cell 9: 841–857 Aida M, Ishida T, Tasaka M (1999) Shoot apical meristem and cotyledon formation during Arabidopsis embryogenesis: interaction among the CUP-SHAPED COTYLEDON and SHOOT MERISTEMLESS genes. Development 126: 1563–1570[Abstract] Allison DB, Cui X, Page GP, Sabripour M (2006) Microarray data analysis: from disarray to consolidation and consensus. Nat Rev Genet 7: 55–65[CrossRef][Web of Science][Medline] Banno H, Ikeda Y, Niu QW, Chua NH (2001) Overexpression of Arabidopsis ESR1 induces initiation of shoot regeneration. Plant Cell 13: 2609–2618 Barry WT, Nobel AB, Wright FA (2005) Significance analysis of functional categories in gene expression studies: a structured permutation approach. Bioinformatics 21: 1943–1949 Brandstatter I, Kieber JJ (1998) Two genes with similarity to bacterial response regulators are rapidly and specifically induced by cytokinin in Arabidopsis. Plant Cell 10: 1009–1019 Brenner WG, Romanov GA, Kollmer I, Burkle L, Schmulling T (2005) Immediate-early and delayed cytokinin response genes of Arabidopsis thaliana identified by genome-wide expression profiling reveal novel cytokinin-sensitive processes and suggest cytokinin action through transcriptional cascades. Plant J 44: 314–333[CrossRef][Web of Science][Medline] Cary AJ, Che P, Howell SH (2002) Developmental events and shoot meristem gene expression patterns during shoot development in Arabidopsis thaliana. Plant J 32: 867–877[CrossRef][Web of Science][Medline] Che P, Gingerich DJ, Lall S, Howell SH (2002) Global and cytokinin-related gene expression changes during shoot development in Arabidopsis. Plant Cell 14: 2771–2785 Clough SJ, Bent AF (1998) Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J 16: 735–743[CrossRef][Web of Science][Medline] D'Agostino IB, Deruere J, Kieber JJ (2000) Characterization of the response of the Arabidopsis response regulator gene family to cytokinin. Plant Physiol 124: 1706–1717 Daimon Y, Takabe K, Tasaka M (2003) The CUP-SHAPED COTYLEDON genes promote adventitious shoot formation on calli. Plant Cell Physiol 44: 113–121 Fisher RA (1934) Statistical Methods for Research Workers, Ed 14. Oliver and Boyd, Edinburgh Gamborg OJ, Miller RA, Ojima K (1968) Nutrient requirement of suspension cultures of soybean root cells. Exp Cell Res 50: 151–158[CrossRef][Web of Science][Medline] Gautheret RJ (1966) Factors affecting differentiation of plant tissue grown in vitro. In W Beerman, PD Nieuwkoop, E Wolff, eds, Cell Differentiation and Morphogenesis. North-Holland Publishing, Amsterdam, pp 55–95 Hibara K, Takada S, Tasaka M (2003) CUC1 gene activates the expression of SAM-related genes to induce adventitious shoot formation. Plant J 36: 687–696[CrossRef][Web of Science][Medline] Hicks GS (1980) Patterns of organ development in plant tissue culture and the problem of organ determination. Bot Rev 46: 1–23 Hiraga S, Sasaki K, Ito H, Ohashi Y, Matsui H (2001) A large family of class III plant peroxidases. Plant Cell Physiol 42: 462–468 Hiratsu K, Matsui K, Koyama T, Ohme-Takagi M (2003) Dominant repression of target genes by chimeric repressors that include the EAR motif, a repression domain, in Arabidopsis. Plant J 34: 733–739[CrossRef][Web of Science][Medline] Huang BC, Yeoman MM (1984) Callus proliferation and morphogenesis in tissue cultures of Arabidopsis thaliana L. Plant Sci Lett 33: 353–363[CrossRef] Hutchison CE, Kieber JJ (2002) Cytokinin signaling in Arabidopsis. Plant Cell (Suppl) 14: S47–S59 Hwang I, Chen HC, Sheen J (2002) Two-component signal transduction pathways in Arabidopsis. Plant Physiol 129: 500–515 Hwang I, Sheen J (2001) Two-component circuitry in Arabidopsis cytokinin signal transduction. Nature 413: 383–389[CrossRef][Medline] Imamura A, Hanaki N, Nakamura A, Suzuki T, Taniguchi M, Kiba T, Ueguchi C, Sugiyama T, Mizuno T (1999) Compilation and characterization of Arabidopsis thaliana response regulators implicated in His-Asp phosphorelay signal transduction. Plant Cell Physiol 40: 733–742 Inoue T, Higuchi M, Hashimoto Y, Seki M, Kobayashi M, Kato T, Tabata S, Shinozaki K, Kakimoto T (2001) Identification of CRE1 as a cytokinin receptor from Arabidopsis. Nature 409: 1060–1063[CrossRef][Medline] Jefferson RA (1987) Assaying chimeric genes in plants: the GUS gene fusion system. Plant Mol Biol Rep 5: 387–405 Jenuwein T, Allis CD (2001) Translating the histone code. Science 293: 1074–1080 Leibfried A, To JP, Busch W, Stehling S, Kehle A, Demar M, Kieber JJ, Lohmann JU (2005) WUSCHEL controls meristem function by direct regulation of cytokinin-inducible response regulators. Nature 438: 1172–1175[CrossRef][Medline] Leisner S, Turgeon R (1993) Movement of virus and photassimilate in the phloem: a comparative analysis. Bioessays 15: 741–748[CrossRef][Web of Science][Medline] Leisner SM, Turgeon R, Howell SH (1992) Long distance movement of cauliflower mosaic virus in infected turnip plants. Mol Plant Microbe Interact 5: 41–47 Loidl P (2004) A plant dialect of the histone language. Trends Plant Sci 9: 84–90[CrossRef][Web of Science][Medline] Mason MG, Li J, Mathews DE, Kieber JJ, Schaller GE (2004) Type-B response regulators display overlapping expression patterns in Arabidopsis. Plant Physiol 135: 927–937 Ohta M, Matsui K, Hiratsu K, Shinshi H, Ohme-Takagi M (2001) Repression domains of class II ERF transcriptional repressors share an essential motif for active repression. Plant Cell 13: 1959–1968 Oka A, Sakai H, Iwakoshi S (2002) His-Asp phosphorelay signal transduction in higher plants: receptors and response regulators for cytokinin signaling in Arabidopsis thaliana. Genes Genet Syst 77: 383–391[CrossRef][Web of Science][Medline] Ramalho-Santos M, Yoon S, Matsuzaki Y, Mulligan RC, Melton DA (2002) "Stemness": transcriptional profiling of embryonic and adult stem cells. Science 298: 597–600 Rashotte AM, Carson SD, To JP, Kieber JJ (2003) Expression profiling of cytokinin action in Arabidopsis. Plant Physiol 132: 1998–2011 Riechmann JL, Heard J, Martin G, Reuber L, Jiang C, Keddie J, Adam L, Pineda O, Ratcliffe OJ, Samaha RR, et al (2000) Arabidopsis transcription factors: genome-wide comparative analysis among eukaryotes. Science 290: 2105–2110 Riechmann JL, Meyerowitz EM (1998) The AP2/EREBP family of plant transcription factors. Biol Chem 379: 633–646[Web of Science][Medline] Sakai H, Aoyama T, Bono H, Oka A (1998) Two-component response regulators from Arabidopsis thaliana contain a putative DNA-binding motif. Plant Cell Physiol 39: 1232–1239 Sakai H, Aoyama T, Oka A (2000) Arabidopsis ARR1 and ARR2 response regulators operate as transcriptional activators. Plant J 24: 703–711[CrossRef][Web of Science][Medline] Sakai H, Honma T, Aoyama T, Sato S, Kato T, Tabata S, Oka A (2001) ARR1, a transcription factor for genes immediately responsive to cytokinins. Science 294: 1519–1521 Sakuma Y, Liu Q, Dubouzet JG, Abe H, Shinozaki K, Yamaguchi-Shinozaki K (2002) DNA-binding specificity of the ERF/AP2 domain of Arabidopsis DREBs, transcription factors involved in dehydration- and cold-inducible gene expression. Biochem Biophys Res Commun 290: 998–1009[CrossRef][Web of Science][Medline] Schmulling T (2001) CREam of cytokinin signalling: receptor identified. Trends Plant Sci 6: 281–284[CrossRef][Web of Science][Medline] Sheen J (2002) Phosphorelay and transcription control in cytokinin signal transduction. Science 296: 1650–1652 Skoog F, Miller CO (1957) Chemical regulation of growth and organ formation in plant tissue cultured in vitro. Symp Soc Exp Biol 11: 118–131 Staswick PE, Serban B, Rowe M, Tiryaki I, Maldonado MT, Maldonado MC, Suza W (2005) Characterization of an Arabidopsis enzyme family that conjugates amino acids to indole-3-acetic acid. Plant Cell 17: 616–627 Storey JD, Tibshirani R (2003) Statistical significance for genomewide studies. Proc Natl Acad Sci USA 100: 9440–9445 Suzuki T, Ishikawa K, Yamashino T, Mizuno T (2002) An Arabidopsis histidine-containing phosphotransfer (HPt) factor implicated in phosphorelay signal transduction: overexpression of AHP2 in plants results in hypersensitiveness to cytokinin. Plant Cell Physiol 43: 123–129 Suzuki T, Miwa K, Ishikawa K, Yamada H, Aiba H, Mizuno T (2001) The Arabidopsis sensor His-kinase, AHk4, can respond to cytokinins. Plant Cell Physiol 42: 107–113 Takada S, Hibara K, Ishida T, Tasaka M (2001) The CUP-SHAPED COTYLEDON1 gene of Arabidopsis regulates shoot apical meristem formation. Development 128: 1127–1135[Abstract] To JP, Haberer G, Ferreira FJ, Deruere J, Mason MG, Schaller GE, Alonso JM, Ecker JR, Kieber JJ (2004) Type-A Arabidopsis response regulators are partially redundant negative regulators of cytokinin signaling. Plant Cell 16: 658–671 Urao T, Yakubov B, Satoh R, Yamaguchi-Shinozaki K, Seki M, Hirayama T, Shinozaki K (1999) A transmembrane hybrid-type histidine kinase in Arabidopsis functions as an osmosensor. Plant Cell 11: 1743–1754 Valvekens D, Van Montagu M, Lijsebettens MV (1988) Agrobacterium tumefaciens-mediated transformation of Arabidopsis thaliana root explants by using kanamycin selection. Proc Natl Acad Sci USA 85: 5536–5540 Yamada H, Suzuki T, Terada K, Takei K, Ishikawa K, Miwa K, Mizuno T (2001) The Arabidopsis AHK4 histidine kinase is a cytokinin-binding receptor that transduces cytokinin signals across the membrane. Plant Cell Physiol 42: 1017–1023 This article has been cited by other articles:
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ASPB Publications | PLANT PHYSIOLOGY® | THE PLANT CELL | |
|---|---|---|---|
TOP
ABSTRACT
RESULTS
2 = 0.895, P = 0.639), consistent with the expected pattern for a single mutant locus. To determine if the shoot regeneration phenotype cosegregated with the T-DNA, root explants from F2 progeny were sorted into categories (wild type, T-DNA homozygotes, and heterozygotes) based on PCR genotyping, and explants groups were scored for percent explants forming shoots and for greenness of shoots. In the wild-type group, 80% (24/30) of explants formed shoots all of which were dark green; in the T-DNA heterozygote group, 96% (28/29) formed shoots, all of which were also dark green; in the T-DNA homozygote group, 45% (15/33) formed shoots, all of which were smaller and light green. We conclude from these observations that the mutant is recessive and the phenotype cosegregates with the T-DNA, indicating that the T-DNA insertion in the RAP2.6L gene is most likely responsible for the shoot regeneration trait. 
