|
|
||||||||
|
First published online May 26, 2006; 10.1104/pp.106.079046 Plant Physiology 141:1089-1097 (2006) © 2006 American Society of Plant Biologists
A Conserved Mechanism Controls Translation of Rubisco Large Subunit in Different Photosynthetic Organisms1Department of Life Sciences, Ben-Gurion University of the Negev, Beer-Sheva 84105, Israel
We previously proposed a mechanism for control of Rubisco expression and assembly during oxidative stress in Chlamydomonas reinhardtii. The N terminus of the large subunit (LSU) comprises an RNA recognition motif (RRM) that is normally buried in the protein, but becomes exposed under oxidizing conditions when the glutathione pool shifts toward its oxidized form. Thus, de novo translation and assembly of Rubisco LSU stop with similar kinetics and the unpaired small subunit (SSU) is rapidly degraded. Here we show that the structure of the N-terminal domain is highly conserved throughout evolution, despite its relatively low sequence similarity. Furthermore, Rubisco from a broad evolutionary range of photosynthetic organisms binds RNA under oxidizing conditions, with dissociation constant values in the nanomolar range. In line with these observations, oxidative stress indeed causes a translational arrest in land plants as well as in Rhodospirillum rubrum, a purple bacterium that lacks the SSU. We highlight an evolutionary conserved element located within -helix B, which is located in the center of the RRM and is also involved in the intramolecular interactions between two LSU chains. Thus, assembly masks the N terminus of the LSU hiding the RRM. When assembly is interrupted due to structural changes that occur under oxidizing conditions or in the absence of a dedicated chaperone, the N-terminal domain can become exposed, leading to the translational arrest of Rubisco LSU. Taken together, these results support a model by which LSU translation is governed by its dimerization. In the case that regulation of type I and type II Rubisco is conserved, the SSU does not appear to be directly involved in LSU translation.
Rubisco is the enzyme responsible for CO2 fixation during photosynthesis. In land plants and green algae, Rubisco exists as a holoenzyme composed of eight large subunits (LSUs; 55 kD) encoded by the chloroplast large subunit of Rubisco (rbcL) gene, and eight small subunits (SSU; 1518 kD) produced by a nuclear family of small subunit of Rubisco (rbcS) genes (Spreitzer, 1993
Expression of the two subunits is highly coordinated, and down-regulation of the SSU by antisense RNA causes a parallel reduction in expression of the LSU (Rodermel et al., 1996
We recently proposed an autoregulatory mechanism for control of Rubisco expression and assembly in Chlamydomonas reinhardtii during light-induced oxidative stress (Cohen et al., 2005
The role of the SSU in this proposed mechanism has not been fully elucidated but it can follow several different routes. Oxidative stress can trigger SSU degradation, thus leading to translational arrest of the LSU. Alternatively, oxidative stress could initially arrest LSU translation, resulting in a rapid degradation of the unassembled SSU. Finally, it may be that both subunits and possibly their chaperones are subject to conformational changes that prevent their assembly; hence, translation of the LSU stops and the SSU is degraded. Under oxidizing conditions, translational arrest of the LSU and inhibition of the assembly process occur with similar kinetics, suggesting that the two processes are indeed tightly coupled (Cohen et al., 2005
Oxidative Stress Causes a Translational Arrest of Rubisco LSU in Tobacco and Spinach without Affecting the Level of the rbcL Transcript
We sought to generalize our previous observations in C. reinhardtii that light-induced oxidative stress leads to a dramatic, though transient, arrest in Rubisco LSU translation that is tightly coordinated with cessation of its assembly (Cohen et al., 2005
The Structure of the N-Terminal Domain of Rubisco LSU Is Conserved throughout Evolution Despite Its Relatively Variable Sequence
We recently proposed that exposure of the N-terminal domain (1150 amino acids) of Rubisco LSU from C. reinhardtii to oxidizing conditions, and the consequent binding of RNA in a sequence-independent manner (Yosef et al., 2004
To examine the phylogenetic conservation of RNA-binding activity, we aligned the sequences of the N-terminal domain (positions 1150) of Rubisco LSU from tobacco, spinach, Synechococcus PCC 6301, Galdiera partita, Thermococcus kodakaraensis, and Rhodospirillum rubrum (Table I
). The highest degree of identity (80%87%) was observed between the green, form I Rubisco polypeptides from tobacco, spinach, Synechococcus PCC 6301, and C. reinhardtii. Red, form I Rubisco LSU from G. partita showed a lower similarity to the polypeptides mentioned above (56.7%) and the lowest conservation values were measured for the archeal protein from T. kodakaraensis (38.2%) and for the bacterial protein from R. rubrum (29.6%). Despite the low conservation between the archeal protein and the green Rubisco, the alignment revealed a distinctive and highly conserved sequence element that corresponded to positions 54 to 65 in form I Rubisco LSUs and to positions 43 to 54 and 42 to 53 in the LSU chains of T. kodakaraensis and R. rubrum, respectively (Fig. 2
). An examination of the three-dimensional structure of Rubisco (Schneider et al., 1986
To evaluate whether the sequence variations in the N terminus could cause alterations in the overall structure, we superimposed the published structures of the N-terminal domains from each organism on that of C. reinhardtii (Taylor et al., 2001 atoms in all N-terminal domains, and their positional root mean square (RMS) deviations. The highest structural resemblance to the LSU of C. reinhardtii was observed for the LSU chains of the protein from the cyanobacterium Synechococcus PCC 6301 (Newman and Gutteridge, 1993![]() ![]() ![]() ![]() ![]() structure was found in all the N termini of the structures, and as previously reported (Yosef et al., 2004
RNA-Binding Activity of Purified Rubisco LSU from Different Organisms In view of the highly conserved structure of the N terminus of Rubisco LSU, we characterized the kinetics of RNA-binding activity of Rubisco from species of different phyla, i.e. from tobacco and from spinach (Magnoliophyta), from C. reinhardtii (Chlorophyta), and from R. rubrum (Proteobacteria), the latter being a phylogenetically remote photosynthetic prokaryote, with the lowest degree of sequence conservation for Rubisco LSU. In these experiments, purified Rubisco was incubated with radiolabeled RNA under oxidizing and normal conditions, i.e. with or without GSSG, respectively. In keeping with our previous observations for C. reinhardtii, RNA-binding activity was observed only under oxidizing conditions for purified Rubisco from land plants and from the species purple bacterium (Fig. 4A ).
As a measure of the binding affinities of different Rubisco holoenzymes to RNA, we determined the dissociation constant (Kd) of purified Rubisco from tobacco, spinach, C. reinhardtii, and R. rubrum. The binding assays were performed in the presence of radiolabeled RNA that was synthesized in vitro from the multiple cloning site of pBluescript (approximately 250 nts; Fig. 4, A and B), and also the 5' untranslated region (UTR) of rbcL RNA of C. reinhardtii (100 nts; data not shown). The Kd values of all Rubisco holoenzymes tested were similar for the two substrates, despite the sequence variations in the N terminus, but in line with the high degree of structural conservation among them. Results with the RNA synthesized on the pBluescript template ranged between 43.6 and 56.5 nM for all the proteins (Fig. 4B). These values are consistent with our previous report on RNA binding by Rubisco LSU and by the recombinant N terminus of C. reinhardtii (Yosef et al., 2004
Rubisco of R. rubrum consists of two LSU chains (L2) and does not contain an SSU. We were thus interested to examine whether in the absence of the SSU, LSU synthesis is subject to regulation by oxidative stress, as observed for C. reinhardtii and land plants. R. rubrum is photosynthetic only when grown under anaerobic conditions (Anderson and Fuller, 1967
In this study, we showed that the regulatory mechanism that directs translational regulation under extreme conditions is conserved throughout evolution. We found that despite extensive variations in the sequence of the N terminus among different photosynthetic organisms, significant conservation of its structure was revealed. Structural conservation is to be expected at the active site of Rubisco, which is located at the C-terminal TIM barrel domain of the LSU. A similar finding for the N terminus could suggest that it too plays an important and conserved role, possibly in the regulation of Rubisco expression. We show here that the RNA-binding activity of Rubisco LSU is conserved throughout evolution. UV cross-linking experiments performed with purified Rubisco from land plants (tobacco and spinach) and from R. rubrum showed similar patterns, namely, that RNA binding occurs only under oxidizing conditions, with Kd values in the same nanomolar range as the value calculated for Rubisco from C. reinhardtii. These findings are in line with the high structural conservation observed for Rubisco LSU, despite the sequence variability in the N-terminal domain.
It has previously been shown that the SSU is not required for assembly of Aspergillus nidulans LSU chains into the L8 octomer core in Escherichia coli and that the SSU could be added to preformed cores to generate an active enzyme. It was therefore suggested that a face-to-bottom structure of two LSU chains could be the basic and common step involved in Rubisco assembly (Goloubinoff et al., 1989
Sequence comparison of the N-terminal domain of LSUs from different organisms reveals a highly conserved region of 12 amino acids (corresponding to positions 5465 in the C. reinhardtii protein; see Fig. 1) found in all photosynthetic organisms, from purple bacteria to land plants. Conserved amino acids that are located in this hydrophobic region have been implicated in the interactions between the N terminus of one subunit and the C terminus of a counterpart chain, allowing the formation of the L2 dimer in R. rubrum (Schneider et al., 1990a -helix B, which is part of the ![]() ![]() ![]() ![]() ![]() ferredoxin-like domain at the N terminus that is predicted to be responsible for the RNA-binding activity (Yosef et al., 2004
Expression of both the LSU and SSU depends on their mutual compatibility to assemble. The SSU stabilizes the holoenzyme complex, generating fully active and functional Rubisco particles. However, prokaryotes and eukaryotes have different requirements for an SSU to form an active complex. While the cyanobacterial LSU can assemble into a fully active particle even in the absence of an endogenous SSU (Andrews, 1988
In higher plants and in green algae, expression of subunits that are part of large protein complexes is highly coordinated by CES (Choquet et al., 1998
Strains and Growth Conditions for Microorganisms and Plants
Cultures of Chlamydomonas reinhardtii wild-type strain CC-125 were cultivated in 300 mL of high-salt reduced sulfate medium (Schmidt et al., 1985
Rhodospirillum rubrum was cultured in 25-mL screw-cap tubes or filled to the top (anaerobic conditions) at 30°C in Ormerod synthetic medium containing malate and 0.2% ammonium sulfate (Bose, 1963 Wild-type tobacco (Nicotiana tabacum) and spinach (Spinacia oleracea) were grown in a commercial soil mixture for 10 to 12 weeks from germination and fertigated with a commercial nutrient solution (Ecogan). The plants were maintained in a controlled environment chamber at 25°C under a photoperiodic illumination regime of 8 h light and 16 h dark.
In vivo pulse labeling of total cell proteins in tobacco plants was performed essentially as described (Whitney and Andrews, 2001b To enhance the expression of Rubisco in R. rubrum the cells were grown anaerobically in the presence of butyrate. A culture of R. rubrum was grown under anaerobic conditions for 48 h and used to inoculate a butyrate-based medium that was further grown for 3 d. Exposure to atmospheric air was achieved by transferring samples (5 mL) of the logarithmic cultures into open 50-mL test tubes, with extensive stirring. These aliquots were labeled by the addition of 75 µCi of 35S cell-labeling mix for 5 min. Labeling was performed both under anaerobic conditions and after exposure of the cultures to atmospheric air for 0, 2, and 4 h. The labeled cells were collected by centrifugation (5 min, 8,000g at 4°C), resuspended in SDS sample buffer, and boiled for 10 min. Equal protein loads were separated by 7.5% to 12.5% SDS-PAGE. The gels were stained, dried, and analyzed by phosphorimager. Migration of Rubisco LSU was monitored on parallel western blots.
Affinity-purified rabbit antibodies raised against a synthetic peptide of Rubisco (Agrisera) were used to detect Rubisco forms I and II. Alternatively, Rubisco form I was identified by rabbit antibodies that were raised against the purified holoenzyme from tobacco.
Rubisco from C. reinhardtii (CC-125) was purified as previously described (Cohen et al., 2005
Oxidative stress was induced by vacuum infiltration of MeV (2 µM) for 90 s, followed by incubation for up to12 h with illumination conditions of 300 µmol m2s1. The harvested leaves were immersed immediately in 5 mL of Murashige and Skoog nutrient solution (pH 7.2) containing 10 mM NaHCO3 and 0.25% (v/v) Silwet-L77 (see above). Total RNA was extracted from whole tobacco leaves (0.50.7 g) with the EZ-RNA isolation kit (Biological Industries). Northern blots were hybridized with an rbcL probe that was amplified from tobacco genomic DNA using the sense TobaccoLSUfwd (121) primer ATGTCACCACAAACAGAGACTAA and the antisense TobaccoLSUrev (1,4111,434) primer TTACTTATCCAAAACGTCCACTG. UV cross-linking assays were performed as previously described (Yosef et al., 2004
We are grateful to Zippora Gromet-Elhanan, Weizmann Institute of Science, Israel, for providing us with Rhodospirillum rubrum and with instructions on how to grow it. We thank Robert Tabita, Ohio State University, for the antibodies directed against Rubisco form II, and Yedidia Gafni, Agricultural Research Institute, Israel, for providing us with spinach seeds. Received February 9, 2006; returned for revision April 30, 2006; accepted May 4, 2006.
1 This work was supported by the Israel Science Foundation (grant no. 587/02). The author responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors (www.plantphysiol.org) is: Michal Shapira (shapiram{at}bgu.ac.il). Article, publication date, and citation information can be found at www.plantphysiol.org/cgi/doi/10.1104/pp.106.079046. * Corresponding author; e-mail shapiram{at}bgu.ac.il; fax 97286479185.
Anderson L, Fuller RC (1967) Photosynthesis in Rhodospirillum rubrum. I. Autotrophic carbon dioxide fixation. Plant Physiol 42: 487490 Andrews TJ (1988) Catalysis by cyanobacterial ribulose-bisphosphate carboxylase large subunits in the complete absence of small subunits. J Biol Chem 263: 1221312219 Bose SK (1963) Media for anaerobic growth of photosynthetic bacteria. In H H Gest, A San Petro, LP Vernon, eds, Bacterial Photosynthesis. Antioch Press, Yellow Springs, OH Brutnell TP, Sawers RJ, Mant A, Langdale JA (1999) BUNDLE SHEATH DEFECTIVE2, a novel protein required for post-translational regulation of the rbcL gene of maize. Plant Cell 11: 849864 Choquet Y, Stern DB, Wostrikoff K, Kuras R, Girard-Bascou J, Wollman FA (1998) Translation of cytochrome f is autoregulated through the 5' untranslated region of petA mRNA in Chlamydomonas chloroplasts. Proc Natl Acad Sci USA 95: 43804385 Choquet Y, Wostrikoff K, Rimbault B, Zito F, Girard-Bascou J, Drapier D, Wollman FA (2001) Assembly-controlled regulation of chloroplast gene translation. Biochem Soc Trans 29: 421426[CrossRef][Web of Science][Medline] Choquet Y, Zito F, Wostrikoff K, Wollman FA (2003) Cytochrome f translation in Chlamydomonas chloroplast is autoregulated by its carboxyl-terminal domain. Plant Cell 15: 14431454 Cohen I, Knopf JA, Irihimovitch V, Shapira M (2005) A proposed mechanism for the inhibitory effects of oxidative stress on Rubisco assembly and its subunit expression. Plant Physiol 137: 738746 Cook LS, Tabita FR (1988) Oxygen regulation of ribulose 1,5-bisphosphate carboxylase activity in Rhodospirillum rubrum. J Bacteriol 170: 54685472 Duff AP, Andrews TJ, Curmi PM (2000) The transition between the open and closed states of rubisco is triggered by the inter-phosphate distance of the bound bisphosphate. J Mol Biol 298: 903916[CrossRef][Web of Science][Medline] Goloubinoff P, Gatenby AA, Lorimer GH (1989) GroE heat-shock proteins promote assembly of foreign prokaryotic ribulose biphosphate carboxylase oligomers in Escherichia coli. Nature 337: 4447[CrossRef][Medline] Kitano K, Maeda N, Fukui T, Atomi H, Imanaka T, Miki K (2001) Crystal structure of a novel-type archaeal rubisco with pentagonal symmetry. Structure 9: 473481[Medline] Luo S, Wang ZY, Kobayashi M, Nozawa T (2001) The dimerization of folded monomers of ribulose 1,5-bisphosphate carboxylase/oxygenase. J Biol Chem 276: 70237026 Minai L, Wostrikoff K, Wollman FA, Choquet Y (2006) Chloroplast biogenesis of Photosystem II cores involves a series of assembly-controlled steps that regulate translation. Plant Cell 18: 159175 Murashige T, Skoog F (1962) A revised medium for rapid growth and bioassays with tobacco tissue culture. Physiol Plant 15: 473497[CrossRef] Nagai K (1996) RNA-protein complexes. Curr Opin Struct Biol 6: 5361[CrossRef][Web of Science][Medline] Newman J, Gutteridge S (1993) The x-ray structure of Synechococcus ribulose-bisphosphate carboxylase/oxygenase-activated quaternary complex at 2.2-A resolution. J Biol Chem 268: 2587625886 Rodermel S, Haley J, Jiang CZ, Tsai CH, Bogorad L (1996) A mechanism for intergenomic integration: abundance of ribulose bisphosphate carboxylase small-subunit protein influences the translation of the large-subunit mRNA. Proc Natl Acad Sci USA 93: 38813885 Sarles L, Tabita R (1983) Derepression of the synthesis of D-ribulose 1,5-bisphosphate carboxylase/oxygenase from Rhodospirillum rubrum. J Bacteriol 153: 458464 Schmidt RJ, Gillham NW, Boynton JE (1985) Processing of the precursor to a chloroplast ribosomal protein made in the cytosol occurs in two steps, one of which depends on a protein made in the chloroplast. Mol Cell Biol 5: 10931099 Schneider G, Knight S, Andersson I, Branden CI, Lindqvist Y, Lundqvist T (1990a) Comparison of the crystal structures of L2 and L8S8 Rubisco suggests a functional role for the small subunit. EMBO J 9: 20452050[Web of Science][Medline] Schneider G, Lindqvist Y, Brandedn C-I, Lorimer G (1986) Three dimensional structure of ribulose-1,5-bisphosphate carboxylase/oxygenase from Rhodospirillum rubrum at 2.9 A resolution. EMBO J 5: 34093415[Web of Science][Medline] Schneider G, Lindqvist Y, Lundqvist T (1990b) Crystallographic refinement and structure of ribulose-1,5-bisphosphate carboxylase from Rhodospirillum rubrum at 1.7 A resolution. J Mol Biol 211: 9891008[CrossRef][Web of Science][Medline] Shapira M, Lers A, Heifetz P, Yrihimovitz V, Osmond BC, Gillham NW, Boynton JE (1997) Differential regulation of chloroplast gene expression in Chlamydomonas reinhardtii during photoacclimation: light stress suppresses synthesis of the Rubisco LSU protein while enhancing synthesis of the PSII D1 protein. Plant Mol Biol 33: 10011011[CrossRef][Web of Science][Medline] Siomi H, Dreyfuss G (1997) RNA-binding proteins as regulators of gene expression. Curr Opin Genet Dev 7: 345353[CrossRef][Web of Science][Medline] Spreitzer R (1999) Questions about the complexity of chloroplast ribulose-1.5-biphosphate carboxylase/oxygenase. Photosynth Res 60: 2942 Spreitzer RJ (1993) Genetic dissection of Rubisco structure and function. Annu Rev Plant Physiol Plant Mol Biol 44: 149[CrossRef][Web of Science] Spreitzer RJ (2003) Role of the small subunit in ribulose-1,5-bisphosphate carboxylase/oxygenase. Arch Biochem Biophys 414: 141149[CrossRef][Web of Science][Medline] Spreitzer RJ, Thow G, Zhu G (1995) Pseudoreversion substitution at large-subunit residue 54 influences the CO2/O2 specificity of chloroplast ribulose-bisphosphate carboxylase/oxygenase. Plant Physiol 109: 681685[Abstract] Sugawara H, Yamamoto H, Shibata N, Inoue T, Okada S, Miyake C, Yokota A, Kai Y (1999) Crystal structure of carboxylase reaction-oriented ribulose 1, 5-bisphosphate carboxylase/oxygenase from a thermophilic red alga, Galdieria partita. J Biol Chem 274: 1565515661 Tabita FR (1999) Microbial ribulose 1,5-bisphosphate carboxylase/oxygenase: a different perspective. Photosynth Res 60: 128[CrossRef][Web of Science] Tabita FR, McFadden BA (1974) D-Ribulose 1,5 diphosphate carboxylase from Rhodospirillum rubrum. I. Levels, purification and effects of metallic ions. J Biol Chem 249: 34533458 Taylor TC, Andersson I (1996) Structural transitions during activation and ligand binding in hexadecameric Rubisco inferred from the crystal structure of the activated unliganded spinach enzyme. Nat Struct Biol 3: 95101[CrossRef][Web of Science][Medline] Taylor TC, Backlund A, Bjorhall K, Spreitzer RJ, Andersson I (2001) First crystal structure of Rubisco from a green alga-Chlamydomonas reinhardtii. J Biol Chem 276: 4815948164 Thow G, Spreitzer RJ (1992) Missense mutations in the chloroplast rbcL gene that affect Rubisco holoenzyme assembly. In N Murata, ed, Research in Photosynthesis, Vol 3. Kluwer Academic Publishers, Dordrecht, The Netherlands, pp 633636 van der Vies SM, Bradley D, Gatenby AA (1986) Assembly of cyanobacterial and higher-plant ribulose-bisphosphate carboxylase subunits into functional homologous and heterologous enzyme enzyme molecules in Escherichia-coli. EMBO J 5: 24392444[Web of Science][Medline] Whitney SM, Andrews TJ (2001a) Plastome-encoded bacterial ribulose-1,5-bisphosphate carboxylase/oxygenase (RubisCO) supports photosynthesis and growth in tobacco. Proc Natl Acad Sci USA 98: 1473814743 Whitney SM, Andrews TJ (2001b) The gene for the ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) small subunit relocated to the plastid genome of tobacco directs the synthesis of small subunits that assemble into Rubisco. Plant Cell 13: 193205 Wostrikoff K, Girard-Bascou J, Wollman FA, Choquet Y (2004) Biogenesis of PSI involves a cascade of translational autoregulation in the chloroplast of Chlamydomonas. EMBO J 23: 26962705[CrossRef][Web of Science][Medline] Yosef I, Irihimovitch V, Knopf JA, Cohen I, Orr-Dahan I, Nahum E, Keasar C, Shapira M (2004) RNA binding activity of the ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit from Chlamydomonas reinhardtii. J Biol Chem 279: 1014810156 Youssefian S, Nakamura M, Orudgev E, Kondo N (2001) Increased cysteine biosynthesis capacity of transgenic tobacco overexpressing an O-acetylserine (thiol) lyase modifies plant responses to oxidative stress. Plant Physiol 126: 10011011 This article has been cited by other articles:
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ASPB Publications | PLANT PHYSIOLOGY® | THE PLANT CELL | |
|---|---|---|---|