| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
|
First published online June 9, 2006; 10.1104/pp.106.082024 Plant Physiology 141:1248-1254 (2006) © 2006 American Society of Plant Biologists CYP71B15 (PAD3) Catalyzes the Final Step in Camalexin Biosynthesis1 SvatoLehrstuhl für Genetik, Technische Universität München, D–85350 Freising, Germany (R.S., E.G.); Center for Molecular Plant Physiology, DK–1871 Frederiksberg C, Denmark (M.N., B.L.P., C.E.O., B.A.H.); and Max Planck Institute for Chemical Ecology, Beutenberg Campus, D–07745 Jena, Germany (M.M., A.S.)
Camalexin represents the main phytoalexin in Arabidopsis (Arabidopsis thaliana). The camalexin-deficient phytoalexin deficient 3 (pad3) mutant has been widely used to assess the biological role of camalexin, although the exact substrate of the cytochrome P450 enzyme 71B15 encoded by PAD3 remained elusive. 2-(Indol-3-yl)-4,5-dihydro-1,3-thiazole-4-carboxylic acid (dihydrocamalexic acid) was identified as likely intermediate in camalexin biosynthesis downstream of indole-3-acetaldoxime, as it accumulated in leaves of silver nitrate-induced pad3 mutant plants and it complemented the camalexin-deficient phenotype of a cyp79b2/cyp79b3 double-knockout mutant. Recombinant CYP71B15 heterologously expressed in yeast catalyzed the conversion of dihydrocamalexic acid to camalexin with preference of the (S)-enantiomer. Arabidopsis microsomes isolated from leaves of CYP71B15-overexpressing and induced wild-type plants were capable of the same reaction but not microsomes from induced leaves of pad3 mutants. In conclusion, CYP71B15 catalyzes the final step in camalexin biosynthesis.
Camalexin (3-thiazol-2'-yl-indole), originally isolated from Camelina sativa (Browne et al., 1991  ), is the main phytoalexin of the model plant Arabidopsis (Arabidopsis thaliana; Tsuji et al., 1992). Its formation has been studied in detail as part of the highly sophisticated network of plant defense reactions, including hypersensitive response after interaction with incompatible pathogens (for review, see Kliebenstein, 2004; Glazebrook, 2005). Camalexin has been shown to inhibit growth of particular plant pathogens, e.g. Alternaria brassicicola or some Botrytis cinerea isolates, while others remain unaffected (Rogers et al., 1996; Thomma et al., 1999; Ferrari et al., 2003; Kliebenstein et al., 2005).
It was recently shown that camalexin is derived from indole-3-acetaldoxime (IAOx) that is synthesized from Trp by the cytochrome P450 enzymes CYP79B2 and CYP79B3 (Fig. 1
; Glawischnig et al., 2004
So far five phytoalexin deficient mutants (pad1–pad5) have been isolated in a screen for mutants with reduced camalexin content (Glazebrook and Ausubel, 1994 ; Glazebrook et al., 1997). Having consistently low camalexin levels independent of the inducing pathogen or abiotic treatment, pad3 has been widely used to investigate the role of camalexin in various Arabidopsis-pathogen interactions (Glazebrook and Ausubel, 1994; Thomma et al., 1999; Roetschi et al., 2001; Ferrari et al., 2003; Mert-Türk et al., 2003; Bohman et al., 2004). The corresponding PAD3 gene that was identified by positional cloning encodes for the cytochrome P450 enzyme CYP71B15 (Zhou et al., 1999). This suggested a function as camalexin biosynthetic gene (Zhou et al., 1999), or that CYP71B15 plays an indirect regulatory role, similar to MAX1, a regulatory P450 enzyme involved in flavonoid biosynthesis (Lazar and Goodman, 2006). Recently, 2-(indol-3-yl)-4,5-dihydro-1,3-thiazole-4-carboxylic acid (dihydrocamalexic acid) was shown to accumulate in infected pad3 root cultures and was suggested as intermediate in camalexin biosynthesis (Bednarek et al., 2005). In this article, we demonstrate that CYP71B15, expressed heterologously in yeast, catalyzes the conversion of dihydrocamalexic acid to camalexin. The same reaction was obtained with Arabidopsis microsomes isolated from untreated 35S::CYP71B15 and induced wild-type leaves, but not from silver nitrate-induced pad3 plants. In conclusion, CYP71B15 catalyzes the final step in camalexin biosynthesis (Fig. 1).
Dihydrocamalexic Acid Accumulates in Induced pad3 Leaves and Complements the Camalexin-Deficient Phenotype of the cyp79b2/cyp79b3 Knockout Mutant
The level of dihydrocamalexic acid has been shown to be increased in root culture liquid of pad3 and pad5 knockout mutants (Bednarek et al., 2005
cyp79b2/cyp79b3 knockout mutants (Zhao et al., 2002 ) are camalexin deficient due to their inability to synthesize the intermediate IAOx (Glawischnig et al., 2004). When silver nitrate-treated cyp79b2/cyp79b3 rosette leaves were incubated in a 100 µM solution of (S)-dihydrocamalexic acid, wild-type levels (11.6 ± 4.8 µg g–1) of camalexin were synthesized. This shows that dihydrocamalexic acid is a precursor for camalexin. The enantiomer (R)-dihydrocamalexic acid (100 µM), derived from nonproteinogenic D-Cys, also was converted to camalexin but to a lesser extent (4.2 ± 0.6 µg g–1). Only minor camalexin formation in comparison to background level (0.1–0.2 µg g–1) was observed when pad3 mutants were incubated with either enantiomer (approximately 0.5 µg g–1), indicating that PAD3 (CYP71B15) is involved in the conversion of (S)-dihydrocamalexic acid to camalexin.
The enzymatic function of CYP71B15 was investigated by analysis of recombinant CYP71B15 expressed in the yeast strain WAT11, carrying the Arabidopsis cytochrome P450 reductase ATR1 (Pompon et al., 1996
Arabidopsis Microsomes Are Capable of the Same Enzymatic Conversions To address whether this reaction is performed in planta and can be linked to a functional PAD3 gene, three genotypes were analyzed: Columbia (Col)-0 wild type, the pad3 mutant, and 35S::CYP71B15 lines. Seven independent overexpression lines were generated, all of which did not show any obvious morphological changes (data not shown). Line #1 showed a 44- ± 8.8-fold induction of the constitutive CYP71B15 expression in comparison to wild type. Twenty-four hours after silver nitrate spraying, camalexin level in 35S::CYP71B15#1 was 9.4 ± 5.9 µg g–1 fresh weight (FW; n = 10) and differed not significantly from wild-type plants treated the same (7.3 ± 3.2 µg g–1 FW). In untreated 35S::CYP71B15#1 plants, no reproducible camalexin formation was observed. This indicates that in vivo CYP71B15 is not rate limiting, consistent with its role in catalyzing the last biosynthetic step. Microsomes were prepared from untreated leaves and leaves 16 h after silver nitrate spraying of Col-0, pad3, and 35S::CYP71B15#1 plants. NADPH-dependent camalexin formation from dihydrocamalexic acid was determined in the six microsomal preparations (Fig. 5 ). While no activity was detected in microsomes from untreated and silver nitrate-sprayed pad3 leaves, untreated wild-type microsomes showed a low dihydrocamalexic acid turnover, which was strongly enhanced after induction of the camalexin pathway by silver nitrate spraying. 35S::CYP71B15#1 microsomes showed activity without silver nitrate induction (Fig. 5). This demonstrates that Arabidopsis microsomes convert dihydrocamalexic acid to camalexin dependent on functional CYP71B15.
A Km of approximately 26.7 ± 2.5 µM was determined for this reaction by Col-0 microsomes (Fig. 4B). For the (R)-enantiomer, an apparent Km of 67.7 ± 3.6 µM was determined and the catalytic efficiency was approximately 36% in comparison to the (S)-enantiomer, which clearly shows the preference for the assumed natural substrate originated from conjugation with L-Cys.
To confirm that the expression pattern of CYP71B15 is in accordance with its role as a camalexin biosynthetic gene, CYP71B15p::
We have demonstrated that CYP71B15 (PAD3) catalyzes the final step in camalexin biosynthesis. Large data sets exist on CYP71B15 induction upon infection with camalexin-inducing pathogens and abiotic treatments (Zhou et al., 1999 ; Glazebrook et al., 2003; Eulgem et al., 2004; Glawischnig et al., 2004; https://www.genevestigator.ethz.ch). We showed that CYP71B15 expression is induced locally, which is in accordance with its role in the biosynthesis of a phytoalexin. This expression pattern matches accumulation of camalexin and expression of other biosynthetic genes (Schuhegger et al., 2006) indicating that the whole biosynthetic pathway is colocalized and no transport of a biosynthetic intermediate occurs.
The pad3 mutant has been a valuable tool to study the effect of camalexin on pathogen growth. Being mutated in the last biosynthetic step with the precursor dihydrocamalexic acid still being synthesized, it is now clear that the enhanced susceptibilities of pad3 are the specific results of camalexin deficiency. In some cases where no enhanced susceptibility of pad3 is observed, the effect of dihydrocamalexic acid accumulation might mask the effect of camalexin deficiency. Dihydrocamalexic acid is an intermediate in camalexin biosynthesis and, in addition, is released from roots (Bednarek et al., 2005
PAD3 belongs to the large CYP71B family of P450 genes consisting of 37 members (Werck-Reichhart et al., 2002
CYP71B15 catalyzes an oxidative decarboxylation of both enantiomers of dihydrocamalexic acid. To our knowledge, this is the only cytochrome P450 reaction described in plants that results in simultaneous decarboxylation and introduction of a C–C– double bond. For this unusual reaction, we propose that the pentavalent oxoiron in the reaction center of CYP71B15 initially abstracts a hydrid ion from C-5 of the thiazole ring. The formed intermediate liberates carbon dioxide in a fast spontaneous process forming a C-4/C-5 carbon-carbon double bond in the thiazole ring of camalexin (Fig. 7
). In this model, the rate-determining process is the CYP71B15-catalyzed hydride abstraction, and the subsequent decarboxylation is not under enzymatic control. In addition to the (S)-enantiomer, the binding pocket of CYP71B15 can accommodate "unnatural" (R)-enantiomer, although with lower relative catalytic efficiency. We expect that the mechanism is similar to the one described for isovalerate decarboxylation (Fukuda et al., 1994
The camalexin biosynthetic pathway from IAOx to dihydrocamalexic acid remains to be resolved. In analogy to indole glucosinolate biosynthesis, it has been hypothesized that the IAOx-metabolizing step is catalyzed by a cytochrome P450 enzyme (Glawischnig et al., 2004 ). The product of this reaction is unknown. Indole-3-carbaldehyde has been suggested to condensate with Cys in the camalexin biosynthetic pathway (Zook and Hammerschmidt, 1997). This intermediate remains speculative, as external application of indole-3-carbaldehyde did not complement the camalexin-deficient phenotype of the cyp79b2/cyp79b3 knockout mutant (E. Glawischnig, unpublished data). In bacteria, the introduction of thiazoline rings into secondary products is catalyzed by nonribosomal peptide synthetases with Cys as substrate (for review, see Crosa and Walsh, 2002). As no nonribosomal peptide synthetase genes have been described in Arabidopsis, the challenging task remains to demonstrate to which family the enzyme belongs that condensates the indolic and Cys-related intermediate and to identify the corresponding gene(s).
Plant Material and Growth Conditions Arabidopsis (Arabidopsis thaliana) ecotype Col-0 and pad3 plants were obtained from Lehle Seeds and the Nottingham Arabidopsis Stock Center, respectively. Plants were grown in soil mixed with sand (3:1) in a growth chamber at 12/12-h photoperiod at 80 to 100 µmol m–2 s–1, 21°C, and 40% relative humidity.
The CYP71B15 gene (At3g26830) was PCR amplified, sequenced, and cloned into the binary plant transformation vector pCAMBIA2300 under the control of 35S promoter (for details, see http://www.cambia.org). Agrobacterium-mediated transformation of Arabidopsis Col-0 plants was performed using the floral-dipping method, and successful transformation was confirmed by kanamycin resistance of the seedlings and by PCR analysis. RNA extraction and cDNA synthesis has been described by Schuhegger et al. (2006)
A 2.9-kb promoter region of CYP71B15 was PCR amplified with the primer pair gaattcgcgctcttatactgtggctatatatgttatagac/cgccatggtccttgccctgttcttgtgttt and cloned into pGEM-T Easy (Promega) according to the manufacturer's instructions. The fragment was then excised and inserted into the GUS reporter vector pCAMBIA 1305.1 (for details, see http://www.cambia.org). Hygromycin-resistant transformants were selected and checked for positive GUS staining. GUS staining after silver nitrate spraying or challenge with Pseudomonas syringae or Alternaria alternata, respectively, was performed as described previously (Glawischnig et al., 2004
For (–)-(4S)-enantiomer, a solution of 1H-indole-3-carbonitrile (40 mg, 0.28 mmol) in degassed MeOH (2 mL) was added to L-Cys (150 mg) dissolved in MeOH (1 mL), phosphate buffer (pH 8, 1 mL). Powdered NaHCO3 (130 mg) was added and the reaction mixture was stirred at 77°C for 4 d under argon atmosphere. After cooling to ambient temperature, solvents were removed on a rotary evaporator. The residue was mixed with NaHCO3 solution (8% [w/v], 10 mL) and washed with ethyl acetate (2 x 10 mL). The aqueous phase was acidified with 2 M HCl to pH 3, and extracted into ethyl acetate (3 x 10 mL). The combined organic extracts were washed with brine (10 mL), dried over Na2SO4, and concentrated in vacuum. The product was obtained after crystallization from a hexane-ethyl acetate mixture as a beige-rose powder (50 mg, 72%).
1H NMR (CD3OD, 400 MHz):
For (+)-(4R)-enantiomer, the optical isomer (11 mg) was prepared from D-Cys hydrate hydrochloride as described above. Electron ionization MS: (m/z, relative intensities) 246 (M+, 24), 201 (M+.-COOH, 100), 160 (23), 144 (63), 142 (68), 115 (28). [
Electron ionization and high-resolution mass spectra were obtained on a MasSpec 2 instrument (Micromass) in positive ion mode using 70-eV ionization energy and direct insertion probe. Perfluorokerosine mixture was used as an internal standard. For GC-high-resolution MS, analyses were performed with a Hewlett-Packard HP6890 gas chromatograph interfaced to a MasSpec 2. Separation was achieved on a J&W Scientific DB-5 capillary column, 30 m x 0.25 mm, 0.25-µm film thickness using helium (30 mL s–1) as carrier gas.
The camalexin-deficient cyp79b2/cyp79b3 knockout and pad3 mutants were sprayed with 5 mM silver nitrate to test complementation of the pathway with dihydrocamalexic acid. After 8 h, rosette leaves were cut at the petiole and incubated in 100 µL of 100 µM (S)- or (R)-dihydrocamalexic acid for an additional 16 h.
Leaf material (200 mg) was harvested 18 or 24 h after silver nitrate spraying and frozen in liquid nitrogen. The samples were kept at –80°C until processing. For extraction, the leaves were ground in liquid nitrogen, 1 mL of 50% aqueous MeOH (v/v) was added, and the samples were centrifuged for 15 min at 20,000g. The pellets were re-extracted with 600 µL of 50% MeOH, centrifuged again, and the supernatants were combined. The solvent was removed using a Speed-Vac and the residue was redissolved in 80% aqueous MeOH (1 µL per 5 mg initial fresh weight). The solutions were filtered through a 0.22-µm filter (Millipore) and LC-MS was performed as done by Glawischnig et al. (2004)
Using recombinant PCR and the primer sets actggatccatggctgttttcctctgtttcctcgtc/caatccctgctacaaatatgtccgagatcattcctttgagatgatc and gatcatctcaaaggaatgatctcggacatatttgtagcagggattg/tacgaattctcagtggtgaagaacttgaaaga, corresponding to exon 1 and 2, respectively, on Arabidopsis ecotype Col-0 genomic DNA, a PCR fragment of the coding region of CYP71B15 was obtained and cloned into the binary vector pYeDP60 (Pompon et al., 1996
Arabidopsis microsomes were prepared using a modified protocol from Du et al. (1995) Enzyme tests with yeast and Arabidopsis microsomes were performed for 30 min at 25°C in 200 µL of 50 mM Tris, pH 7.5 ± 1 mM NADPH, 20 µg microsomal protein, and 200 µM substrate (variable concentration for Km determination), extracted twice with 1 vol of ethyl acetate, which was then evaporated under reduced pressure. The pellet was redissolved in ethanol and analyzed for camalexin by HPLC. Samples were analyzed by reverse-phase HPLC (LiChroCART 250-4, RP-18, 5 µm [Merck]; 1 mL min–1; MeOH/water [1:1; v/v] for 2 min, followed by a 10-min linear gradient to 100% MeOH, followed by 3 min 100% MeOH). The peak at 10.6 min was identified as camalexin by comparison with authentic standard with respect to retention time and UV spectrum (photodiode array detector; Dionex) and quantified using a Shimadzu F-10AXL fluorescence detector (318 nm excitation, 370 nm emission) and by UV absorption at 318 nm. To confirm the identity of the product, the corresponding HPLC peak was collected, the MeOH was evaporated, and the remaining water phase was extracted with ethyl acetate and analyzed by GC-MS.
We thank Prof. A. Gierl for his continuous support, Dr. Y. Zhao for providing cyp79b2/cyp79b3 knockout mutants, and Dr. P. Bednarek for helpful suggestions. Received April 13, 2006; returned for revision May 18, 2006; accepted May 24, 2006.
1 This work was supported by the Deutsche Forschungsgemeinschaft (GL346/1) and the Max-Planck Gesellschaft.  The author responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors (www.plantphysiol.org) is: Erich Glawischnig (egl{at}wzw.tum.de). Article, publication date, and citation information can be found at www.plantphysiol.org/cgi/doi/10.1104/pp.106.082024. * Corresponding author; e-mail egl{at}wzw.tum.de; fax 49–8161–71–5636.
Bednarek P, Schneider B, Svatos A, Oldham NJ, Hahlbrook K (2005) Structural complexity, differential response to infection, and tissue specificity of indolic and phenylpropanoid secondary metabolism in Arabidopsis roots. Plant Physiol 138: 1058–1070 Bohman S, Staal J, Thomma BP, Wang M, Dixelius C (2004) Characterisation of an Arabidopsis-Leptosphaeria maculans pathosystem: Resistance partially requires camalexin biosynthesis and is independent of salicylic acid, ethylene and jasmonic acid signalling. Plant J 37: 9–20[CrossRef][Web of Science][Medline] Browne LM, Conn KL, Ayer WA, Tewari JP (1991) The camalexins: new phytoalexins produced in the leaves of Camelina sativa (Cruciferae). Tetrahedron 47: 3909–3914[CrossRef][Web of Science] Buist PH (2004) Catalytic diversity of fatty acid desaturases. Tetrahedron Asymmetry 15: 2779–2785[CrossRef][Web of Science] Crosa JH, Walsh CT (2002) Genetics and assembly line enzymology of siderophore biosynthesis in bacteria. Microbiol Mol Biol Rev 66: 223–249 Du L, Lykkesfeldt J, Olsen CE, Halkier BA (1995) Involvement of cytochrome P450 in oxime production in glucosinolate biosynthesis as demonstrated by an in vitro microsomal enzyme system isolated from jasmonic acid-induced seedlings of Sinapis alba L. Proc Natl Acad Sci USA 92: 12505–12509 Eulgem T, Weigman VJ, Chang H-S, McDowell JM, Holub EB, Glazebrook J, Zhu T, Dangl JL (2004) Gene expression signatures from three genetically separable resistance gene signaling pathways for downy mildew resistance. Plant Physiol 135: 1129–1144 Ferrari S, Plotnikova JM, De Lorenzo G, Ausubel FM (2003) Arabidopsis local resistance to Botrytis cinerea involves salicylic acid and camalexin and requires EDS4 and PAD2, but not SID2, EDS5 or PAD4. Plant J 35: 193–205[CrossRef][Web of Science][Medline] Fukuda H, Fujii T, Sukita E, Tazaki M, Nagahama S, Ogawa T (1994) Reconstitution of the isobutene-forming reaction catalyzed by cytochrome P450 and P450 reductase from Rhodotorula minuta: decarboxylation with the formation of isobutene. Biochem Biophys Res Commun 201: 516–522[CrossRef][Web of Science][Medline] Glawischnig E, Hansen BG, Olsen CE, Halkier BA (2004) Camalexin is synthesized from indole-3-acetaldoxime, a key branching point between primary and secondary metabolism in Arabidopsis. Proc Natl Acad Sci USA 101: 8245–8250 Glazebrook J (2005) Contrasting mechanisms of defense against biotrophic and necrotrophic pathogens. Annu Rev Phytopathol 43: 205–227[CrossRef][Web of Science][Medline] Glazebrook J, Ausubel FM (1994) Isolation of phytoalexin-deficient mutants of Arabidopsis thaliana and characterization of their interactions with bacterial pathogens. Proc Natl Acad Sci USA 91: 8955–8959 Glazebrook J, Chen W, Estes B, Chang HS, Nawrath C, Metraux JP, Zhu T, Katagiri F (2003) Topology of the network integrating salicylate and jasmonate signal transduction derived from global expression phenotyping. Plant J 34: 217–228[CrossRef][Web of Science][Medline] Glazebrook J, Zook M, Mert F, Kagan I, Rogers EE, Crute IR, Holub EB, Hammerschmidt R, Ausubel FM (1997) Phytoalexin-deficient mutants of Arabidopsis reveal that PAD4 encodes a regulatory factor and that four PAD genes contribute to downy mildew resistance. Genetics 146: 381–392[Abstract] Kliebenstein DJ (2004) Secondary metabolites and plant/environment interactions: a view through Arabidopsis thaliana tinged glasses. Plant Cell Environ 27: 675–684[CrossRef] Kliebenstein DJ, Rowe HC, Denby KJ (2005) Secondary metabolites influence Arabidopsis/Botrytis interactions: variation in host production and pathogen sensitivity. Plant J 44: 25–36[Web of Science][Medline] Lazar G, Goodman HM (2006) MAX1, a regulator of the flavonoid pathway, controls vegetative axillary bud outgrowth in Arabidopsis. Proc Natl Acad Sci USA 103: 472–476 Mert-Türk F, Bennet MH, Mansfield JW, Holub EB (2003) Camalexin accumulation in Arabidopsis thaliana following abiotic elicitation or inoculation with virulent or avirulent Hyaloperonospora parasitica. Physiol Mol Plant Pathol 62: 137–145[CrossRef] Narusaka Y, Narusaka M, Seki M, Umezawa T, Ishida J, Nakajima M, Enju A, Shinozaki K (2004) Crosstalk in the responses to abiotic and biotic stresses in Arabidopsis: analysis of gene expression in cytochrome P450 gene superfamily by cDNA microarray. Plant Mol Biol 55: 327–342[CrossRef][Web of Science][Medline] Pompon D, Louerat B, Bronine A, Urban P (1996) Yeast expression of animal and plant P450s in optimized redox environment. Methods Enzymol 272: 51–64[CrossRef][Web of Science][Medline] Roetschi A, Si-Ammour A, Belbahri L, Mauch F, Mauch-Mani B (2001) Characterization of an Arabidopsis-Phytophthora pathosystem: resistance requires a functional PAD2 gene and is independent of salicylic acid, ethylene and jasmonic acid signalling. Plant J 28: 293–305[CrossRef][Web of Science][Medline] Rogers EE, Glazebrook J, Ausubel FM (1996) Mode of action of the Arabidopsis thaliana phytoalexin camalexin and its role in Arabidopsis-pathogen interactions. Mol Plant Microbe Interact 9: 748–757[Web of Science][Medline] Schuhegger R, Rauhut T, Glawischnig E (2006) Regulatory variability of camalexin biosynthesis. J Plant Physiol (in press) Thomma BP, Nelissen I, Eggermont K, Broekaert WF (1999) Deficiency in phytoalexin production causes enhanced susceptibility of Arabidopsis thaliana to the fungus Alternaria brassicicola. Plant J 19: 163–171[CrossRef][Web of Science][Medline] Tsuji J, Jackson EP, Gage DA, Hammerschmidt R, Somerville SC (1992) Phytoalexin accumulation in Arabidopsis thaliana during the hypersensitive reaction to Pseudomonas syringae pv. syringae. Plant Physiol 98: 1304–1309 Werck-Reichhart D, Bak S, Paquette S (2002) Cytochromes P450. In CR Somerville, EM Meyerowitz, eds, The Arabidopsis Book. American Society of Plant Biologists, Rockville, MD, doi/10.1199/tab.0009, www.aspb.org/publications/arabidopsis/ Zhao Y, Hull AK, Gupta NR, Goss KA, Alonso J, Ecker JR, Normanly J, Chory J, Celenza JL (2002) Trp-dependent auxin biosynthesis in Arabidopsis: involvement of cytochrome P450s CYP79B2 and CYP79B3. Genes Dev 16: 3100–3112 Zhou N, Tootle TL, Glazebrook J (1999) Arabidopsis PAD3, a gene required for camalexin biosynthesis, encodes a putative cytochrome P450 monooxygenase. Plant Cell 11: 2419–2428 Zook M, Hammerschmidt R (1997) Origin of the thiazole ring of camalexin, a phytoalexin from Arabidopsis thaliana. Plant Physiol 113: 463–468[Abstract] This article has been cited by other articles:
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ASPB Publications | PLANT PHYSIOLOGY® | THE PLANT CELL | |
|---|---|---|---|
TOP
ABSTRACT
RESULTS
-glucuronidase (GUS) plants were generated. For B. cinerea and Alternaria alternata, it was shown that camalexin accumulation was induced locally at the infection sites (Kliebenstein et al., 2005
= 8.40 (1H, s, indol-H-2), 8.02 (1H, s, indol-H-4), 7.62 (1H, d, indol-H-7, J = 8 Hz), 7.40 (2H, m, indol-H-5,6), 5.40 (1H, m, CH-4), 3.95 (1H, dd, J = 11 Hz, 9 Hz, CH-5a), 3.80 (1H, dd, J = 11 Hz, 8 Hz, CH-5b). Electron ionization MS: (m/z, relative intensities) 246 (M+, 24), 201 (M+.-COOH, 100), 160 (23), 144 (63), 142 (68), 115 (28). [
]58920 –55 (0.2, MeOH); [
