Plant Physiol.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


First published online June 9, 2006; 10.1104/pp.106.082024

Plant Physiology 141:1248-1254 (2006)
© 2006 American Society of Plant Biologists

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow A correction has been published
Right arrow All Versions of this Article:
141/4/1248    most recent
pp.106.082024v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Web of Science (37)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Schuhegger, R.
Right arrow Articles by Glawischnig, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Schuhegger, R.
Right arrow Articles by Glawischnig, E.
Agricola
Right arrow Articles by Schuhegger, R.
Right arrow Articles by Glawischnig, E.
BIOCHEMICAL PROCESSES AND MACROMOLECULAR STRUCTURES

CYP71B15 (PAD3) Catalyzes the Final Step in Camalexin Biosynthesis1

Regina Schuhegger, Majse Nafisi, Madina Mansourova, Bent Larsen Petersen, Carl Erik Olsen, Ales Svatos, Barbara Ann Halkier and Erich Glawischnig*

Lehrstuhl für Genetik, Technische Universität München, D–85350 Freising, Germany (R.S., E.G.); Center for Molecular Plant Physiology, DK–1871 Frederiksberg C, Denmark (M.N., B.L.P., C.E.O., B.A.H.); and Max Planck Institute for Chemical Ecology, Beutenberg Campus, D–07745 Jena, Germany (M.M., A.S.)


    ABSTRACT
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 
Camalexin represents the main phytoalexin in Arabidopsis (Arabidopsis thaliana). The camalexin-deficient phytoalexin deficient 3 (pad3) mutant has been widely used to assess the biological role of camalexin, although the exact substrate of the cytochrome P450 enzyme 71B15 encoded by PAD3 remained elusive. 2-(Indol-3-yl)-4,5-dihydro-1,3-thiazole-4-carboxylic acid (dihydrocamalexic acid) was identified as likely intermediate in camalexin biosynthesis downstream of indole-3-acetaldoxime, as it accumulated in leaves of silver nitrate-induced pad3 mutant plants and it complemented the camalexin-deficient phenotype of a cyp79b2/cyp79b3 double-knockout mutant. Recombinant CYP71B15 heterologously expressed in yeast catalyzed the conversion of dihydrocamalexic acid to camalexin with preference of the (S)-enantiomer. Arabidopsis microsomes isolated from leaves of CYP71B15-overexpressing and induced wild-type plants were capable of the same reaction but not microsomes from induced leaves of pad3 mutants. In conclusion, CYP71B15 catalyzes the final step in camalexin biosynthesis.


Camalexin (3-thiazol-2'-yl-indole), originally isolated from Camelina sativa (Browne et al., 1991Go), is the main phytoalexin of the model plant Arabidopsis (Arabidopsis thaliana; Tsuji et al., 1992Go). Its formation has been studied in detail as part of the highly sophisticated network of plant defense reactions, including hypersensitive response after interaction with incompatible pathogens (for review, see Kliebenstein, 2004Go; Glazebrook, 2005Go). Camalexin has been shown to inhibit growth of particular plant pathogens, e.g. Alternaria brassicicola or some Botrytis cinerea isolates, while others remain unaffected (Rogers et al., 1996Go; Thomma et al., 1999Go; Ferrari et al., 2003Go; Kliebenstein et al., 2005Go).

It was recently shown that camalexin is derived from indole-3-acetaldoxime (IAOx) that is synthesized from Trp by the cytochrome P450 enzymes CYP79B2 and CYP79B3 (Fig. 1 ; Glawischnig et al., 2004Go). IAOx also is an intermediate in the biosynthesis of indole glucosinolates and a precursor for the phytohormone indole-3-acetic acid. This makes IAOx a key branching point between primary and secondary metabolism. In vivo feeding experiments suggest that the thiazole ring of camalexin is derived from Cys that has reacted with a product of IAOx, e.g. indole-3-carbaldehyde (Zook and Hammerschmidt, 1997Go).


Figure 1
View larger version (12K):
[in this window]
[in a new window]
 
Figure 1. The camalexin biosynthetic pathway. Cys-R, Cys or Cys derivative.

 
So far five phytoalexin deficient mutants (pad1pad5) have been isolated in a screen for mutants with reduced camalexin content (Glazebrook and Ausubel, 1994Go; Glazebrook et al., 1997Go). Having consistently low camalexin levels independent of the inducing pathogen or abiotic treatment, pad3 has been widely used to investigate the role of camalexin in various Arabidopsis-pathogen interactions (Glazebrook and Ausubel, 1994Go; Thomma et al., 1999Go; Roetschi et al., 2001Go; Ferrari et al., 2003Go; Mert-Türk et al., 2003Go; Bohman et al., 2004Go). The corresponding PAD3 gene that was identified by positional cloning encodes for the cytochrome P450 enzyme CYP71B15 (Zhou et al., 1999Go). This suggested a function as camalexin biosynthetic gene (Zhou et al., 1999Go), or that CYP71B15 plays an indirect regulatory role, similar to MAX1, a regulatory P450 enzyme involved in flavonoid biosynthesis (Lazar and Goodman, 2006Go). Recently, 2-(indol-3-yl)-4,5-dihydro-1,3-thiazole-4-carboxylic acid (dihydrocamalexic acid) was shown to accumulate in infected pad3 root cultures and was suggested as intermediate in camalexin biosynthesis (Bednarek et al., 2005Go).

In this article, we demonstrate that CYP71B15, expressed heterologously in yeast, catalyzes the conversion of dihydrocamalexic acid to camalexin. The same reaction was obtained with Arabidopsis microsomes isolated from untreated 35S::CYP71B15 and induced wild-type leaves, but not from silver nitrate-induced pad3 plants. In conclusion, CYP71B15 catalyzes the final step in camalexin biosynthesis (Fig. 1).


    RESULTS
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 

Dihydrocamalexic Acid Accumulates in Induced pad3 Leaves and Complements the Camalexin-Deficient Phenotype of the cyp79b2/cyp79b3 Knockout Mutant

The level of dihydrocamalexic acid has been shown to be increased in root culture liquid of pad3 and pad5 knockout mutants (Bednarek et al., 2005Go). To identify potential intermediates in camalexin biosynthesis, methanolic leaf extracts from silver nitrate-treated plants were analyzed by liquid chromatography (LC)-mass spectrometry (MS) for accumulation of metabolites in the pad3 mutant. Dihydrocamalexic acid accumulated approximately 5-fold in pad3 mutant in comparison to wild-type leaves (Fig. 2 ), but was undetectable in control leaves (data not shown). These data are consistent with a role of dihydrocamalexic acid as a camalexin biosynthetic intermediate.


Figure 2
View larger version (6K):
[in this window]
[in a new window]
 
Figure 2. LC-MS analysis of dihydrocamalexic acid in methanol extracts of rosette leaves of pad3 and wild-type plants 18 h after silver nitrate spraying. A and B, Extracted ion chromatogram (m/z = 247) of wild type (A) and pad3 mutants (B) leaf extract is shown. C, Dihydrocamalexic acid standard. One of three independent experiments with comparable results is presented.

 
cyp79b2/cyp79b3 knockout mutants (Zhao et al., 2002Go) are camalexin deficient due to their inability to synthesize the intermediate IAOx (Glawischnig et al., 2004Go). When silver nitrate-treated cyp79b2/cyp79b3 rosette leaves were incubated in a 100 µM solution of (S)-dihydrocamalexic acid, wild-type levels (11.6 ± 4.8 µg g–1) of camalexin were synthesized. This shows that dihydrocamalexic acid is a precursor for camalexin. The enantiomer (R)-dihydrocamalexic acid (100 µM), derived from nonproteinogenic D-Cys, also was converted to camalexin but to a lesser extent (4.2 ± 0.6 µg g–1). Only minor camalexin formation in comparison to background level (0.1–0.2 µg g–1) was observed when pad3 mutants were incubated with either enantiomer (approximately 0.5 µg g–1), indicating that PAD3 (CYP71B15) is involved in the conversion of (S)-dihydrocamalexic acid to camalexin.


Dihydrocamalexic Acid Is the Substrate of CYP71B15

The enzymatic function of CYP71B15 was investigated by analysis of recombinant CYP71B15 expressed in the yeast strain WAT11, carrying the Arabidopsis cytochrome P450 reductase ATR1 (Pompon et al., 1996Go). When CYP71B15-expressing yeast microsomes were incubated with (S)-dihydrocamalexic acid, HPLC analysis of the ethyl acetate extract of the reaction mixture identified a product peak that comigrated with authentic camalexin and showed its typical fluorescence signal and UV absorption spectrum (Fig. 3 ). Gas chromatography (GC)-high-resolution MS analysis confirmed that the reaction product was camalexin based on the product molecular composition (for C11H8N2S calculated 200.04082, found 200.04113) and identical mass spectra with those of the standard. The enzymatic reaction was NADPH dependent, and an apparent Km of 26.8 ± 1.6 µM for the substrate was determined (Fig. 4A ). No activity was observed in yeast transformed with the empty vector control or in boiled enzyme preparations. Similarly, (R)-dihydrocamalexic acid was converted to camalexin and an apparent Km for this substrate of 45.5 ± 5.2 µM was determined. In addition, IAOx, indole-3-carbinol, indole-3-carbaldehyde, and indole-3-carboxylic acid were tested as substrates, but no apparent NADPH-dependent product was detected (data not shown).


Figure 3
View larger version (10K):
[in this window]
[in a new window]
 
Figure 3. Analysis of CYP71B15 activity. A, HPLC profile with fluorescence detection after enzymatic conversion of (S)-dihydrocamalexic acid to camalexin by microsomes from yeast expressing CYP71B15 in the presence and absence of NADPH, or from yeast vector control (with NADPH). The product identity was confirmed by UV spectroscopy (B) and electron ionization MS spectrometry (C).

 

Figure 4
View larger version (10K):
[in this window]
[in a new window]
 
Figure 4. Kinetic properties of CYP71B15. The conversion of the (S)- and (R)-enantiomer of dihydrocamalexic acid to camalexin by microsomes of yeast expressing CYP71B15 (A) and Arabidopsis (B) was determined for different substrate concentrations. Substrate turnover (pmol mg–1 min–1) is plotted against substrate concentration (µM). Squares, (S)-enantiomer; circles, (R)-enantiomer.

 

Arabidopsis Microsomes Are Capable of the Same Enzymatic Conversions

To address whether this reaction is performed in planta and can be linked to a functional PAD3 gene, three genotypes were analyzed: Columbia (Col)-0 wild type, the pad3 mutant, and 35S::CYP71B15 lines. Seven independent overexpression lines were generated, all of which did not show any obvious morphological changes (data not shown). Line #1 showed a 44- ± 8.8-fold induction of the constitutive CYP71B15 expression in comparison to wild type. Twenty-four hours after silver nitrate spraying, camalexin level in 35S::CYP71B15#1 was 9.4 ± 5.9 µg g–1 fresh weight (FW; n = 10) and differed not significantly from wild-type plants treated the same (7.3 ± 3.2 µg g–1 FW). In untreated 35S::CYP71B15#1 plants, no reproducible camalexin formation was observed. This indicates that in vivo CYP71B15 is not rate limiting, consistent with its role in catalyzing the last biosynthetic step. Microsomes were prepared from untreated leaves and leaves 16 h after silver nitrate spraying of Col-0, pad3, and 35S::CYP71B15#1 plants. NADPH-dependent camalexin formation from dihydrocamalexic acid was determined in the six microsomal preparations (Fig. 5 ). While no activity was detected in microsomes from untreated and silver nitrate-sprayed pad3 leaves, untreated wild-type microsomes showed a low dihydrocamalexic acid turnover, which was strongly enhanced after induction of the camalexin pathway by silver nitrate spraying. 35S::CYP71B15#1 microsomes showed activity without silver nitrate induction (Fig. 5). This demonstrates that Arabidopsis microsomes convert dihydrocamalexic acid to camalexin dependent on functional CYP71B15.


Figure 5
View larger version (18K):
[in this window]
[in a new window]
 
Figure 5. Camalexin formation from (S)-dihydrocamalexic acid by Arabidopsis microsomes. Camalexin formation was compared from microsomes of wild type, 35S::CYP71B15, and pad3 mutant. Left, Fluorescence chromatogram (using microsomes of the named genotypes with and without 16 h silver nitrate induction). For all preparations, NADPH-independent background was observed. Right, NADPH-dependent enzymatic activity of the six preparations (designated left, each average of three tests).

 
A Km of approximately 26.7 ± 2.5 µM was determined for this reaction by Col-0 microsomes (Fig. 4B). For the (R)-enantiomer, an apparent Km of 67.7 ± 3.6 µM was determined and the catalytic efficiency was approximately 36% in comparison to the (S)-enantiomer, which clearly shows the preference for the assumed natural substrate originated from conjugation with L-Cys.


CYP71B15 Expression Is Locally Induced in Leaves and Roots

To confirm that the expression pattern of CYP71B15 is in accordance with its role as a camalexin biosynthetic gene, CYP71B15p::beta-glucuronidase (GUS) plants were generated. For B. cinerea and Alternaria alternata, it was shown that camalexin accumulation was induced locally at the infection sites (Kliebenstein et al., 2005Go; Schuhegger et al., 2006Go). Enhanced CYP79B2p::GUS activity was detected at the site of silver nitrate exposure or pathogen infection (Glawischnig et al., 2004Go; Schuhegger et al., 2006Go), demonstrating localized induction of the biosynthetic gene CYP79B2. The spatial distribution of CYP71B15 induction was investigated in rosette leaves of CYP71B15p::GUS reporter plants exposed to silver nitrate as abiotic camalexin inducer, and A. alternata and Pseudomonas syringae as eukaryotic and prokaryotic plant pathogens, respectively. Induction of CYP71B15 expression localized to the site of treatment was observed (Fig. 6, A–E ). Roots also showed CYP71B15p::GUS activity that was enhanced by exposure to silver nitrate (Fig. 6, F–H).


Figure 6
View larger version (157K):
[in this window]
[in a new window]
 
Figure 6. Analysis of CYP71B15 expression in CYP71B15p::GUS plants. A to E, GUS staining after challenging leaves with droplets of A. alternata spore suspension (A), P. syringae DC3000/Rps4 cell suspension (C), and 5 mM silver nitrate solution (E). Localized CYP71B15 induction was observed. Corresponding control treatments with buffer are shown in B and D, respectively, indicating that tween-containing buffer induces a minor CYP71B15 induction. Scale bars = 2 mm. F to H, GUS staining in roots, untreated (F and G) or 16 h after challenging with 5 mM silver nitrate (H). Scale bars = 0.2 mm.

 

    DISCUSSION
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 
We have demonstrated that CYP71B15 (PAD3) catalyzes the final step in camalexin biosynthesis. Large data sets exist on CYP71B15 induction upon infection with camalexin-inducing pathogens and abiotic treatments (Zhou et al., 1999Go; Glazebrook et al., 2003Go; Eulgem et al., 2004Go; Glawischnig et al., 2004Go; https://www.genevestigator.ethz.ch). We showed that CYP71B15 expression is induced locally, which is in accordance with its role in the biosynthesis of a phytoalexin. This expression pattern matches accumulation of camalexin and expression of other biosynthetic genes (Schuhegger et al., 2006Go) indicating that the whole biosynthetic pathway is colocalized and no transport of a biosynthetic intermediate occurs.

The pad3 mutant has been a valuable tool to study the effect of camalexin on pathogen growth. Being mutated in the last biosynthetic step with the precursor dihydrocamalexic acid still being synthesized, it is now clear that the enhanced susceptibilities of pad3 are the specific results of camalexin deficiency. In some cases where no enhanced susceptibility of pad3 is observed, the effect of dihydrocamalexic acid accumulation might mask the effect of camalexin deficiency. Dihydrocamalexic acid is an intermediate in camalexin biosynthesis and, in addition, is released from roots (Bednarek et al., 2005Go), where it possibly exhibits antimicrobial activity in the soil. This suggests that, in roots, all enzymes of the dihydrocamalexic acid-forming metabolon are tightly coregulated, but that PAD3 is regulated independently. Similar to pad3, the pad5 mutant also releases elevated amounts of dihydrocamalexic acid into the soil (Bednarek et al., 2005Go). In contrast to PAD3, the PAD5 protein, which remains to be identified, is unlikely to be involved in the conversion of dihydrocamalexic acid to camalexin, as yeast-expressed PAD3 (CYP71B15) is fully functional. Possible functions of PAD5 include regulation of PAD3 or integrity of a camalexin biosynthetic metabolon at the level of dihydrocamalexic acid.

PAD3 belongs to the large CYP71B family of P450 genes consisting of 37 members (Werck-Reichhart et al., 2002Go). The pad3 mutant synthesizes only minor amounts of camalexin, which shows that no other expressed CYP71B enzyme efficiently catalyzes the same reaction. A search for gene expression data revealed that most CYP71B genes are not significantly expressed. Only a few were markedly induced after pathogen challenge or under abiotic stress (e.g. CYP71B6, CYP71B7, and CYP71B20; Narusaka et al., 2004Go; https://www.genevestigator.ethz.ch). These expressed genes showed less than 60% identity to CYP71B15 on the amino acid level. As there are a number of examples of plant P450 enzymes with higher homology catalyzing different enzymatic reactions, it is not surprising that none of these genes can complement the pad3 mutant phenotype.

CYP71B15 catalyzes an oxidative decarboxylation of both enantiomers of dihydrocamalexic acid. To our knowledge, this is the only cytochrome P450 reaction described in plants that results in simultaneous decarboxylation and introduction of a C–C– double bond. For this unusual reaction, we propose that the pentavalent oxoiron in the reaction center of CYP71B15 initially abstracts a hydrid ion from C-5 of the thiazole ring. The formed intermediate liberates carbon dioxide in a fast spontaneous process forming a C-4/C-5 carbon-carbon double bond in the thiazole ring of camalexin (Fig. 7 ). In this model, the rate-determining process is the CYP71B15-catalyzed hydride abstraction, and the subsequent decarboxylation is not under enzymatic control. In addition to the (S)-enantiomer, the binding pocket of CYP71B15 can accommodate "unnatural" (R)-enantiomer, although with lower relative catalytic efficiency. We expect that the mechanism is similar to the one described for isovalerate decarboxylation (Fukuda et al., 1994Go), and that it also resembles related desaturation or hydroxylation reactions (Buist, 2004Go). An alternative model includes hydroxylation at C-5 of the thiazole ring, also resulting in spontaneous formation of a double bond and decarboxylation.


Figure 7
View larger version (6K):
[in this window]
[in a new window]
 
Figure 7. Proposed mechanism for CYP71B15. The pentavalent oxoiron in the reaction center initially abstracts a hydrid ion from C-5 of the thiazole ring. The formed intermediate liberates carbon dioxide in a fast spontaneous process forming a C-4/C-5 double bond.

 
The camalexin biosynthetic pathway from IAOx to dihydrocamalexic acid remains to be resolved. In analogy to indole glucosinolate biosynthesis, it has been hypothesized that the IAOx-metabolizing step is catalyzed by a cytochrome P450 enzyme (Glawischnig et al., 2004Go). The product of this reaction is unknown. Indole-3-carbaldehyde has been suggested to condensate with Cys in the camalexin biosynthetic pathway (Zook and Hammerschmidt, 1997Go). This intermediate remains speculative, as external application of indole-3-carbaldehyde did not complement the camalexin-deficient phenotype of the cyp79b2/cyp79b3 knockout mutant (E. Glawischnig, unpublished data). In bacteria, the introduction of thiazoline rings into secondary products is catalyzed by nonribosomal peptide synthetases with Cys as substrate (for review, see Crosa and Walsh, 2002Go). As no nonribosomal peptide synthetase genes have been described in Arabidopsis, the challenging task remains to demonstrate to which family the enzyme belongs that condensates the indolic and Cys-related intermediate and to identify the corresponding gene(s).


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 

Plant Material and Growth Conditions

Arabidopsis (Arabidopsis thaliana) ecotype Col-0 and pad3 plants were obtained from Lehle Seeds and the Nottingham Arabidopsis Stock Center, respectively. Plants were grown in soil mixed with sand (3:1) in a growth chamber at 12/12-h photoperiod at 80 to 100 µmol m–2 s–1, 21°C, and 40% relative humidity.


Generation and Analysis of CYP71B15-Overexpressing Plants

The CYP71B15 gene (At3g26830) was PCR amplified, sequenced, and cloned into the binary plant transformation vector pCAMBIA2300 under the control of 35S promoter (for details, see http://www.cambia.org). Agrobacterium-mediated transformation of Arabidopsis Col-0 plants was performed using the floral-dipping method, and successful transformation was confirmed by kanamycin resistance of the seedlings and by PCR analysis. RNA extraction and cDNA synthesis has been described by Schuhegger et al. (2006)Go. Quantitative real-time PCR was performed with the CyberGreen/Light Cycler system (Roche) using the following primers: Actin1, tggaactggaatggttaaggctgg/tctccagagtcgagcacaataccg; and CYP71B15, gatctcggacatatttgtagcag/acccatcgcataaacgttgact. Camalexin extraction from leaf material has been described previously (Glawischnig et al., 2004Go).


Generation of CYP71B15p::GUS Plants and GUS Analysis

A 2.9-kb promoter region of CYP71B15 was PCR amplified with the primer pair gaattcgcgctcttatactgtggctatatatgttatagac/cgccatggtccttgccctgttcttgtgttt and cloned into pGEM-T Easy (Promega) according to the manufacturer's instructions. The fragment was then excised and inserted into the GUS reporter vector pCAMBIA 1305.1 (for details, see http://www.cambia.org). Hygromycin-resistant transformants were selected and checked for positive GUS staining. GUS staining after silver nitrate spraying or challenge with Pseudomonas syringae or Alternaria alternata, respectively, was performed as described previously (Glawischnig et al., 2004Go; Schuhegger et al., 2006Go).


Synthesis of Dihydrocamalexic Acid

For (–)-(4S)-enantiomer, a solution of 1H-indole-3-carbonitrile (40 mg, 0.28 mmol) in degassed MeOH (2 mL) was added to L-Cys (150 mg) dissolved in MeOH (1 mL), phosphate buffer (pH 8, 1 mL). Powdered NaHCO3 (130 mg) was added and the reaction mixture was stirred at 77°C for 4 d under argon atmosphere. After cooling to ambient temperature, solvents were removed on a rotary evaporator. The residue was mixed with NaHCO3 solution (8% [w/v], 10 mL) and washed with ethyl acetate (2 x 10 mL). The aqueous phase was acidified with 2 M HCl to pH 3, and extracted into ethyl acetate (3 x 10 mL). The combined organic extracts were washed with brine (10 mL), dried over Na2SO4, and concentrated in vacuum. The product was obtained after crystallization from a hexane-ethyl acetate mixture as a beige-rose powder (50 mg, 72%).

1H NMR (CD3OD, 400 MHz): {delta} = 8.40 (1H, s, indol-H-2), 8.02 (1H, s, indol-H-4), 7.62 (1H, d, indol-H-7, J = 8 Hz), 7.40 (2H, m, indol-H-5,6), 5.40 (1H, m, CH-4), 3.95 (1H, dd, J = 11 Hz, 9 Hz, CH-5a), 3.80 (1H, dd, J = 11 Hz, 8 Hz, CH-5b). Electron ionization MS: (m/z, relative intensities) 246 (M+, 24), 201 (M+.-COOH, 100), 160 (23), 144 (63), 142 (68), 115 (28). [{alpha}]58920 –55 (0.2, MeOH); [{alpha}]58920 –50 (0.2, H2O).

For (+)-(4R)-enantiomer, the optical isomer (11 mg) was prepared from D-Cys hydrate hydrochloride as described above. Electron ionization MS: (m/z, relative intensities) 246 (M+, 24), 201 (M+.-COOH, 100), 160 (23), 144 (63), 142 (68), 115 (28). [{alpha}]58920 +50 (0.2, MeOH); [{alpha}]58920 +45 (0.2, H2O).


Mass Spectroscopy

Electron ionization and high-resolution mass spectra were obtained on a MasSpec 2 instrument (Micromass) in positive ion mode using 70-eV ionization energy and direct insertion probe. Perfluorokerosine mixture was used as an internal standard. For GC-high-resolution MS, analyses were performed with a Hewlett-Packard HP6890 gas chromatograph interfaced to a MasSpec 2. Separation was achieved on a J&W Scientific DB-5 capillary column, 30 m x 0.25 mm, 0.25-µm film thickness using helium (30 mL s–1) as carrier gas.


In Vivo Feeding

The camalexin-deficient cyp79b2/cyp79b3 knockout and pad3 mutants were sprayed with 5 mM silver nitrate to test complementation of the pathway with dihydrocamalexic acid. After 8 h, rosette leaves were cut at the petiole and incubated in 100 µL of 100 µM (S)- or (R)-dihydrocamalexic acid for an additional 16 h.


Metabolite Profiling

Leaf material (200 mg) was harvested 18 or 24 h after silver nitrate spraying and frozen in liquid nitrogen. The samples were kept at –80°C until processing. For extraction, the leaves were ground in liquid nitrogen, 1 mL of 50% aqueous MeOH (v/v) was added, and the samples were centrifuged for 15 min at 20,000g. The pellets were re-extracted with 600 µL of 50% MeOH, centrifuged again, and the supernatants were combined. The solvent was removed using a Speed-Vac and the residue was redissolved in 80% aqueous MeOH (1 µL per 5 mg initial fresh weight). The solutions were filtered through a 0.22-µm filter (Millipore) and LC-MS was performed as done by Glawischnig et al. (2004)Go. For specific monitoring of dihydrocamalexic acid, extracted ion chromatograms (m/z = 247) were analyzed.


Yeast Expression, Arabidopsis Microsomes, and Product Analysis

Using recombinant PCR and the primer sets actggatccatggctgttttcctctgtttcctcgtc/caatccctgctacaaatatgtccgagatcattcctttgagatgatc and gatcatctcaaaggaatgatctcggacatatttgtagcagggattg/tacgaattctcagtggtgaagaacttgaaaga, corresponding to exon 1 and 2, respectively, on Arabidopsis ecotype Col-0 genomic DNA, a PCR fragment of the coding region of CYP71B15 was obtained and cloned into the binary vector pYeDP60 (Pompon et al., 1996Go), using the 5' and 3' restriction sites BamHI and EcoRI, respectively. The insert was sequenced to exclude PCR errors. Transformation of the yeast Saccharomyces cerevisiae WAT11, yeast growth, and microsomal preparations were performed according to the method of Pompon et al. (1996)Go.

Arabidopsis microsomes were prepared using a modified protocol from Du et al. (1995)Go. Approximately 1.2 g of rosette leaves untreated or 16 h after spraying with 5 mM AgNO3 were ground with sea sand and Polyclar AT in ice-cold extraction buffer (100 mM ascorbate, 1 mM EDTA, 5 mM dithiothreitol, 100 mM Tris, 20% [w/v] Suc, 20% [v/v] glycerol, pH 7.5), 20 mL g–1 FW, and centrifuged twice 15,000g, 10 min. The supernatant was centrifuged at 200.000g for 40 min. Then the pellet was resuspended in 50 mM KPi, 1 mM dithiothreitol, 20% (v/v) glycerol; centrifuged at 200,000g for 40 min; and resuspended in 1.5 mL of the same buffer.

Enzyme tests with yeast and Arabidopsis microsomes were performed for 30 min at 25°C in 200 µL of 50 mM Tris, pH 7.5 ± 1 mM NADPH, 20 µg microsomal protein, and 200 µM substrate (variable concentration for Km determination), extracted twice with 1 vol of ethyl acetate, which was then evaporated under reduced pressure. The pellet was redissolved in ethanol and analyzed for camalexin by HPLC. Samples were analyzed by reverse-phase HPLC (LiChroCART 250-4, RP-18, 5 µm [Merck]; 1 mL min–1; MeOH/water [1:1; v/v] for 2 min, followed by a 10-min linear gradient to 100% MeOH, followed by 3 min 100% MeOH). The peak at 10.6 min was identified as camalexin by comparison with authentic standard with respect to retention time and UV spectrum (photodiode array detector; Dionex) and quantified using a Shimadzu F-10AXL fluorescence detector (318 nm excitation, 370 nm emission) and by UV absorption at 318 nm. To confirm the identity of the product, the corresponding HPLC peak was collected, the MeOH was evaporated, and the remaining water phase was extracted with ethyl acetate and analyzed by GC-MS.


    ACKNOWLEDGMENTS
 
We thank Prof. A. Gierl for his continuous support, Dr. Y. Zhao for providing cyp79b2/cyp79b3 knockout mutants, and Dr. P. Bednarek for helpful suggestions.

Received April 13, 2006; returned for revision May 18, 2006; accepted May 24, 2006.


    FOOTNOTES
 
1 This work was supported by the Deutsche Forschungsgemeinschaft (GL346/1) and the Max-Planck Gesellschaft. Back

The author responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors (www.plantphysiol.org) is: Erich Glawischnig (egl{at}wzw.tum.de).

Article, publication date, and citation information can be found at www.plantphysiol.org/cgi/doi/10.1104/pp.106.082024.

* Corresponding author; e-mail egl{at}wzw.tum.de; fax 49–8161–71–5636.


    LITERATURE CITED
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 
Bednarek P, Schneider B, Svatos A, Oldham NJ, Hahlbrook K (2005) Structural complexity, differential response to infection, and tissue specificity of indolic and phenylpropanoid secondary metabolism in Arabidopsis roots. Plant Physiol 138: 1058–1070[Abstract/Free Full Text]

Bohman S, Staal J, Thomma BP, Wang M, Dixelius C (2004) Characterisation of an Arabidopsis-Leptosphaeria maculans pathosystem: Resistance partially requires camalexin biosynthesis and is independent of salicylic acid, ethylene and jasmonic acid signalling. Plant J 37: 9–20[CrossRef][Web of Science][Medline]

Browne LM, Conn KL, Ayer WA, Tewari JP (1991) The camalexins: new phytoalexins produced in the leaves of Camelina sativa (Cruciferae). Tetrahedron 47: 3909–3914[CrossRef][Web of Science]

Buist PH (2004) Catalytic diversity of fatty acid desaturases. Tetrahedron Asymmetry 15: 2779–2785[CrossRef][Web of Science]

Crosa JH, Walsh CT (2002) Genetics and assembly line enzymology of siderophore biosynthesis in bacteria. Microbiol Mol Biol Rev 66: 223–249[Abstract/Free Full Text]

Du L, Lykkesfeldt J, Olsen CE, Halkier BA (1995) Involvement of cytochrome P450 in oxime production in glucosinolate biosynthesis as demonstrated by an in vitro microsomal enzyme system isolated from jasmonic acid-induced seedlings of Sinapis alba L. Proc Natl Acad Sci USA 92: 12505–12509[Abstract/Free Full Text]

Eulgem T, Weigman VJ, Chang H-S, McDowell JM, Holub EB, Glazebrook J, Zhu T, Dangl JL (2004) Gene expression signatures from three genetically separable resistance gene signaling pathways for downy mildew resistance. Plant Physiol 135: 1129–1144[Abstract/Free Full Text]

Ferrari S, Plotnikova JM, De Lorenzo G, Ausubel FM (2003) Arabidopsis local resistance to Botrytis cinerea involves salicylic acid and camalexin and requires EDS4 and PAD2, but not SID2, EDS5 or PAD4. Plant J 35: 193–205[CrossRef][Web of Science][Medline]

Fukuda H, Fujii T, Sukita E, Tazaki M, Nagahama S, Ogawa T (1994) Reconstitution of the isobutene-forming reaction catalyzed by cytochrome P450 and P450 reductase from Rhodotorula minuta: decarboxylation with the formation of isobutene. Biochem Biophys Res Commun 201: 516–522[CrossRef][Web of Science][Medline]

Glawischnig E, Hansen BG, Olsen CE, Halkier BA (2004) Camalexin is synthesized from indole-3-acetaldoxime, a key branching point between primary and secondary metabolism in Arabidopsis. Proc Natl Acad Sci USA 101: 8245–8250[Abstract/Free Full Text]

Glazebrook J (2005) Contrasting mechanisms of defense against biotrophic and necrotrophic pathogens. Annu Rev Phytopathol 43: 205–227[CrossRef][Web of Science][Medline]

Glazebrook J, Ausubel FM (1994) Isolation of phytoalexin-deficient mutants of Arabidopsis thaliana and characterization of their interactions with bacterial pathogens. Proc Natl Acad Sci USA 91: 8955–8959[Abstract/Free Full Text]

Glazebrook J, Chen W, Estes B, Chang HS, Nawrath C, Metraux JP, Zhu T, Katagiri F (2003) Topology of the network integrating salicylate and jasmonate signal transduction derived from global expression phenotyping. Plant J 34: 217–228[CrossRef][Web of Science][Medline]

Glazebrook J, Zook M, Mert F, Kagan I, Rogers EE, Crute IR, Holub EB, Hammerschmidt R, Ausubel FM (1997) Phytoalexin-deficient mutants of Arabidopsis reveal that PAD4 encodes a regulatory factor and that four PAD genes contribute to downy mildew resistance. Genetics 146: 381–392[Abstract]

Kliebenstein DJ (2004) Secondary metabolites and plant/environment interactions: a view through Arabidopsis thaliana tinged glasses. Plant Cell Environ 27: 675–684[CrossRef]

Kliebenstein DJ, Rowe HC, Denby KJ (2005) Secondary metabolites influence Arabidopsis/Botrytis interactions: variation in host production and pathogen sensitivity. Plant J 44: 25–36[Web of Science][Medline]

Lazar G, Goodman HM (2006) MAX1, a regulator of the flavonoid pathway, controls vegetative axillary bud outgrowth in Arabidopsis. Proc Natl Acad Sci USA 103: 472–476[Abstract/Free Full Text]

Mert-Türk F, Bennet MH, Mansfield JW, Holub EB (2003) Camalexin accumulation in Arabidopsis thaliana following abiotic elicitation or inoculation with virulent or avirulent Hyaloperonospora parasitica. Physiol Mol Plant Pathol 62: 137–145[CrossRef]

Narusaka Y, Narusaka M, Seki M, Umezawa T, Ishida J, Nakajima M, Enju A, Shinozaki K (2004) Crosstalk in the responses to abiotic and biotic stresses in Arabidopsis: analysis of gene expression in cytochrome P450 gene superfamily by cDNA microarray. Plant Mol Biol 55: 327–342[CrossRef][Web of Science][Medline]

Pompon D, Louerat B, Bronine A, Urban P (1996) Yeast expression of animal and plant P450s in optimized redox environment. Methods Enzymol 272: 51–64[CrossRef][Web of Science][Medline]

Roetschi A, Si-Ammour A, Belbahri L, Mauch F, Mauch-Mani B (2001) Characterization of an Arabidopsis-Phytophthora pathosystem: resistance requires a functional PAD2 gene and is independent of salicylic acid, ethylene and jasmonic acid signalling. Plant J 28: 293–305[CrossRef][Web of Science][Medline]

Rogers EE, Glazebrook J, Ausubel FM (1996) Mode of action of the Arabidopsis thaliana phytoalexin camalexin and its role in Arabidopsis-pathogen interactions. Mol Plant Microbe Interact 9: 748–757[Web of Science][Medline]

Schuhegger R, Rauhut T, Glawischnig E (2006) Regulatory variability of camalexin biosynthesis. J Plant Physiol (in press)

Thomma BP, Nelissen I, Eggermont K, Broekaert WF (1999) Deficiency in phytoalexin production causes enhanced susceptibility of Arabidopsis thaliana to the fungus Alternaria brassicicola. Plant J 19: 163–171[CrossRef][Web of Science][Medline]

Tsuji J, Jackson EP, Gage DA, Hammerschmidt R, Somerville SC (1992) Phytoalexin accumulation in Arabidopsis thaliana during the hypersensitive reaction to Pseudomonas syringae pv. syringae. Plant Physiol 98: 1304–1309[Abstract/Free Full Text]

Werck-Reichhart D, Bak S, Paquette S (2002) Cytochromes P450. In CR Somerville, EM Meyerowitz, eds, The Arabidopsis Book. American Society of Plant Biologists, Rockville, MD, doi/10.1199/tab.0009, www.aspb.org/publications/arabidopsis/

Zhao Y, Hull AK, Gupta NR, Goss KA, Alonso J, Ecker JR, Normanly J, Chory J, Celenza JL (2002) Trp-dependent auxin biosynthesis in Arabidopsis: involvement of cytochrome P450s CYP79B2 and CYP79B3. Genes Dev 16: 3100–3112[Abstract/Free Full Text]

Zhou N, Tootle TL, Glazebrook J (1999) Arabidopsis PAD3, a gene required for camalexin biosynthesis, encodes a putative cytochrome P450 monooxygenase. Plant Cell 11: 2419–2428[Abstract/Free Full Text]

Zook M, Hammerschmidt R (1997) Origin of the thiazole ring of camalexin, a phytoalexin from Arabidopsis thaliana. Plant Physiol 113: 463–468[Abstract]




This article has been cited by other articles:


Home page
Plant CellHome page
C. Bottcher, L. Westphal, C. Schmotz, E. Prade, D. Scheel, and E. Glawischnig
The Multifunctional Enzyme CYP71B15 (PHYTOALEXIN DEFICIENT3) Converts Cysteine-Indole-3-Acetonitrile to Camalexin in the Indole-3-Acetonitrile Metabolic Network of Arabidopsis thaliana
PLANT CELL, June 1, 2009; 21(6): 1830 - 1845.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. ProteomicsHome page
F. Kaschani, C. Gu, S. Niessen, H. Hoover, B. F. Cravatt, and R. A. L. van der Hoorn
Diversity of Serine Hydrolase Activities of Unchallenged and Botrytis-infected Arabidopsis thaliana
Mol. Cell. Proteomics, May 1, 2009; 8(5): 1082 - 1093.
[Abstract] [Full Text] [PDF]


Home page
ScienceHome page
N. K. Clay, A. M. Adio, C. Denoux, G. Jander, and F. M. Ausubel
Glucosinolate Metabolites Required for an Arabidopsis Innate Immune Response
Science, January 2, 2009; 323(5910): 95 - 101.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
S. Malitsky, E. Blum, H. Less, I. Venger, M. Elbaz, S. Morin, Y. Eshed, and A. Aharoni
The Transcript and Metabolite Networks Affected by the Two Clades of Arabidopsis Glucosinolate Biosynthesis Regulators
Plant Physiology, December 1, 2008; 148(4): 2021 - 2049.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
R. Galletti, C. Denoux, S. Gambetta, J. Dewdney, F. M. Ausubel, G. De Lorenzo, and S. Ferrari
The AtrbohD-Mediated Oxidative Burst Elicited by Oligogalacturonides in Arabidopsis Is Dispensable for the Activation of Defense Responses Effective against Botrytis cinerea
Plant Physiology, November 1, 2008; 148(3): 1695 - 1706.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Xu, Y. Li, Y. Wang, H. Liu, L. Lei, H. Yang, G. Liu, and D. Ren
Activation of MAPK Kinase 9 Induces Ethylene and Camalexin Biosynthesis and Enhances Sensitivity to Salt Stress in Arabidopsis
J. Biol. Chem., October 3, 2008; 283(40): 26996 - 27006.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
D. Ren, Y. Liu, K.-Y. Yang, L. Han, G. Mao, J. Glazebrook, and S. Zhang
A fungal-responsive MAPK cascade regulates phytoalexin biosynthesis in Arabidopsis
PNAS, April 8, 2008; 105(14): 5638 - 5643.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
M. de Vos, K. L. Kriksunov, and G. Jander
Indole-3-Acetonitrile Production from Indole Glucosinolates Deters Oviposition by Pieris rapae
Plant Physiology, March 1, 2008; 146(3): 916 - 926.
[Abstract] [Full Text] [PDF]


Home page
Plant CellHome page
B. Dombrecht, G. P. Xue, S. J. Sprague, J. A. Kirkegaard, J. J. Ross, J. B. Reid, G. P. Fitt, N. Sewelam, P. M. Schenk, J. M. Manners, et al.
MYC2 Differentially Modulates Diverse Jasmonate-Dependent Functions in Arabidopsis
PLANT CELL, July 1, 2007; 19(7): 2225 - 2245.
[Abstract] [Full Text] [PDF]


Home page
Plant CellHome page
M. Nafisi, S. Goregaoker, C. J. Botanga, E. Glawischnig, C. E. Olsen, B. A. Halkier, and J. Glazebrook
Arabidopsis Cytochrome P450 Monooxygenase 71A13 Catalyzes the Conversion of Indole-3-Acetaldoxime in Camalexin Synthesis
PLANT CELL, June 1, 2007; 19(6): 2039 - 2052.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
S. Ferrari, R. Galletti, C. Denoux, G. De Lorenzo, F. M. Ausubel, and J. Dewdney
Resistance to Botrytis cinerea Induced in Arabidopsis by Elicitors Is Independent of Salicylic Acid, Ethylene, or Jasmonate Signaling But Requires PHYTOALEXIN DEFICIENT3
Plant Physiology, May 1, 2007; 144(1): 367 - 379.
[Abstract] [Full Text] [PDF]


Home page
Plant CellHome page
S. E. Sattler, L. Mene-Saffrane, E. E. Farmer, M. Krischke, M. J. Mueller, and D. DellaPenna
Nonenzymatic Lipid Peroxidation Reprograms Gene Expression and Activates Defense Markers in Arabidopsis Tocopherol-Deficient Mutants
PLANT CELL, December 1, 2006; 18(12): 3706 - 3720.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
H. Wei, S. Persson, T. Mehta, V. Srinivasasainagendra, L. Chen, G. P. Page, C. Somerville, and A. Loraine
Transcriptional Coordination of the Metabolic Network in Arabidopsis
Plant Physiology, October 1, 2006; 142(2): 762 - 774.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow A correction has been published
Right arrow All Versions of this Article:
141/4/1248    most recent
pp.106.082024v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Web of Science (37)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Schuhegger, R.
Right arrow Articles by Glawischnig, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Schuhegger, R.
Right arrow Articles by Glawischnig, E.
Agricola
Right arrow Articles by Schuhegger, R.
Right arrow Articles by Glawischnig, E.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
ASPB Publications PLANT PHYSIOLOGY® THE PLANT CELL
Copyright © 2006 by the American Society of Plant Biologists