|
|
||||||||
|
First published online July 14, 2006; 10.1104/pp.106.084657 Plant Physiology 142:265-279 (2006) © 2006 American Society of Plant Biologists The Medicago truncatula Lysine Motif-Receptor-Like Kinase Gene Family Includes NFP and New Nodule-Expressed Genes1,[W]Laboratoire des Interactions Plantes-Microorganismes, Institut National de la Recherche Agronomique-Centre National de la Recherche Scientifique, Unité Mixte de Recherche 441/2594, 31326 Castanet-Tolosan, France (J.-F.A., B.B.A., A. Bersoult, F.C.-N., E.-P.J., M.G., T.H., J.D., C.G.); Surfaces Cellulaires et Signalisation chez les Végétaux, Centre National de la Recherche Scientifique-Université Paul Sabatier, Unité Mixte de Recherche 5546, Pôle de Biotechnologie Végétale, 31326 Castanet-Tolosan, France (A. Barre, P.R.); Laboratory of Molecular Biology, Wageningen University, 6703 HA Wageningen, The Netherlands (L.C.S., R.M., R.G.); and Laboratoire Biotechnologies et Amélioration des Plantes, Ecole Nationale Supérieure Agronomique Toulouse, 31326 Castanet-Tolosan, France (T.H.)
Rhizobial Nod factors are key symbiotic signals responsible for starting the nodulation process in host legume plants. Of the six Medicago truncatula genes controlling a Nod factor signaling pathway, Nod Factor Perception (NFP) was reported as a candidate Nod factor receptor gene. Here, we provide further evidence for this by showing that NFP is a lysine motif (LysM)-receptor-like kinase (RLK). NFP was shown both to be expressed in association with infection thread development and to be involved in the infection process. Consistent with deviations from conserved kinase domain sequences, NFP did not show autophosphorylation activity, suggesting that NFP needs to associate with an active kinase or has unusual functional characteristics different from classical kinases. Identification of nine new M. truncatula LysM-RLK genes revealed a larger family than in the nonlegumes Arabidopsis (Arabidopsis thaliana) or rice (Oryza sativa) of at least 17 members that can be divided into three subfamilies. Three LysM domains could be structurally predicted for all M. truncatula LysM-RLK proteins, whereas one subfamily, which includes NFP, was characterized by deviations from conserved kinase sequences. Most of the newly identified genes were found to be expressed in roots and nodules, suggesting this class of receptors may be more extensively involved in nodulation than was previously known.
Whereas many interactions between higher plants and microorganisms are beneficial for one of the partners, few such interactions benefit both partners. The association between bacteria called rhizobia and legume plants is a good example of a mutually beneficial interaction. Rhizobia induce nitrogen-fixing nodules on legume plants, thus allowing plant growth to be independent of an added nitrogen source and, in return, the plant provides rhizobia with a carbon source derived from photosynthesis. Rhizobial Nod factors are crucial symbiotic signals responsible for inducing nodule organogenesis and host-specific, controlled infection (Dénarié et al., 1996 -1,4-linked GlcNAc residues that carries an N-acyl chain on the nonreducing end residue. The backbone has four to five residues and diverse substitutions on the nonreducing- and reducing-end GlcNAc residues, which are major molecular determinants of host specificity. At nano- to picomolar concentrations, Nod factors elicit diverse plant symbiotic responses in host roots (Riely et al., 2004
Candidate Nod factor receptor genes have been cloned in model legumes and pea (Pisum sativum). These genes, called LYK3 in Medicago truncatula (Limpens et al., 2003
In Medicago spp., pea, and vetch (Vicia sativa), which form indeterminate nodules, early steps of infection are particularly stringent in terms of Nod factor structure, whereas some other Nod factor-dependent responses are less stringent, suggesting different mechanisms of Nod factor perception (Ardourel et al., 1994
Analysis of the M. truncatula mutant C31 showed that the Nod Factor Perception (NFP) gene plays an essential role in Nod factor perception at early steps of the symbiotic interaction (Ben Amor et al., 2003 In this study, our initial aim was to better define the role and functioning of the NFP gene in the establishment of the Rhizobium-legume interaction. This led us to show that NFP codes for a LysM-RLK that did not show autophosphorylation activity and that is expressed throughout the nodulation process. We then exploited the genomic resources of M. truncatula to identify other LysM-RLK genes. This revealed a relatively large gene family, including several new genes that are expressed in roots and nodules, suggesting that LysM-RLKs may be more extensively involved in nodulation than was previously known.
The NFP Gene of M. truncatula Encodes a LysM-RLK
We had previously suggested that NFP and pea SYM10 could be orthologous genes (Ben Amor et al., 2003
The NFP gene has no introns and is predicted to encode a protein of 595 amino acids, consisting of an N-terminal signal peptide, followed by a LysM-RLK domain structure made up of three predicted LysM domains in the putative extracellular part of the protein, a potential transmembrane helix, and a Ser-Thr kinase domain in the C-terminal part. This predicted protein sequence shows 86% and 72% overall identity with SYM10 and NFR5, respectively (Fig. 1). As previously reported for SYM10 and NFR5, 27 amino acids corresponding to a normally well-conserved part of the kinase domain, the so-called activation loop, are missing in NFP (Fig. 1). All three proteins also lack the so-called P-loop or phosphate anchor (GXGXF/YG) as well as a conserved DFG motif next to the missing activation loops, regions normally highly conserved in protein kinases (Fig. 1).
Given that nfp mutants were selected for their null phenotypes, we cannot exclude that NFP is implicated not only for early Nod factor signaling, but also at later stages of the symbiotic interaction. To address this question, we studied the spatiotemporal expression pattern of the NFP gene using promoter-GUS fusions and roots of M. truncatula transformed by A. rhizogenes. The 1.5-kb fragment in these constructions included the same 1.1-kb promoter region used for the functional complementation described above. Noninoculated roots showed strong GUS activity in root hair cells of lateral roots (Fig. 2A ). Older regions of roots showed low or no GUS activity. One day after inoculation with S. meliloti, GUS activity was restricted to discrete areas of the epidermis (Fig. 2B). At 2 d, GUS activity was associated with the inner cortex, forming broad stained regions where cell divisions corresponding to the formation of nodule primordia could be observed. GUS activity subsequently extended to the middle cortex of regions where root hairs could be seen to be undergoing root hair curling, the first step of infection (Fig. 2C). At 3 d, GUS activity was detected in outer cortical cells directly underlying infected root hairs and through which infection threads were subsequently seen to pass (Fig. 2, D and E). At 5 d, GUS staining was very intense in the central nodule tissue of young, emerging nodules, which mainly consists of cells undergoing infection by the highly ramified infection thread network (Fig. 2F). In mature nodules, GUS activity was restricted to the infection zone, showing strongest staining in cell layers directly adjacent to the meristem (Fig. 2, G and H). Much lower expression was visible in interzone II/III and no expression was detected in the nitrogen-fixing zone (Fig. 2, G and H). This is clearly illustrated in nodules in which bacteria were not stained (Fig. 2I).
For mature nodules, we verified by in situ hybridization that this localization of GUS activity accurately reflected NFP expression. NFP transcripts were detected in a relatively broad area of mature nodule apices, with the highest level corresponding to the most distal part of the infection zone, as found with the ProNFP-GUS fusion (Fig. 2, J and K). Consistent with 1.1 kb of this 1.5-kb promoter fragment being sufficient for functional complementation of the nfp mutation, this indicates that the major cis-acting elements required for cell-specific expression of NFP are present in the 1.5-kb NFP promoter fragment. Furthermore, this shows that NFP expression is associated with the infection process.
We investigated the role of NFP in the infection process using RNA interference (RNAi) constructs and A. rhizogenes-mediated root transformation of M. truncatula. We expected to produce roots with a range of knockdown levels, some of which could show weak phenotypes for infection and nodulation. Two independent NFP interference constructs were analyzed, NFPi1 and NFPi2, which correspond to the LysM and kinase domains, respectively. The majority of NFP knockdown roots were Nod following inoculation with S. meliloti: 79% of NFPi1 and 90% of NFPi2 roots (i.e. a total of 21/24 Nod roots). The rare nodules formed showed a wild-type structure when sectioned (data not shown). For control roots, 100% were efficiently nodulated with 11 nodules per root on average. Because the nodulation phenotype for the NFP knockdown roots is, in most cases, similar to the knockout phenotype, it can be assumed that there is efficient silencing in these roots, whereas incomplete silencing has occurred in the three Nod+ roots. When rhizobia were visualized, 37 ± 12 infection threads were seen per control root. These were always tubular structures (Fig. 3A ), but about 10% stopped abruptly in root hair cells. Infection structures were not seen on nonnodulated roots of NFPi plants, but were observed on nodulated NFPi1 roots in regions adjacent to nodules: 12 and six infection threads for the two NFPi1 roots exhibiting 10 and nine nodules, respectively. These infection threads nearly always aborted in root hairs and often had aberrant morphology, consisting of large sac-like structures (Fig. 3, B and C). This type of infection thread was never seen on control roots.
Two lines of evidence support the assumption that silencing in NFP knockdown roots was specific for NFP transcripts. First, within the two regions used for NFP RNAi, there is no 21-bp region showing 100% identity between NFP and any known member of the M. truncatula LysM-RLK gene family described below. Second, RNAi performed on LYR1, the gene most homologous to NFP (see below), did not result in a Nod phenotype and infection threads were normal (data not shown). Taken together, these results suggest a role for NFP in infection thread formation in agreement with NFP gene expression data.
In the NFP kinase domain, deviations were observed in the activation loop and in the P-loop, as well as in the DFG motif (Fig. 1), which are normally highly conserved in Ser-Thr kinases, and play important roles in positioning ATP and the Ser-Thr substrate. The NFP kinase domain might therefore be inactive. In contrast, the LYK3 kinase domain is fully conserved and predicted to be fully active.
To gain further insight into these possibilities, we studied the autophosphorylation abilities of NFP and LYK3. The RLK BAK1 was used as a positive control (Li et al., 2002
The M. truncatula Genome Contains a LysM-RLK Family of at Least 17 Genes
We were intrigued that, although NFP and LYK3 are both candidate Nod factor receptors, they differ in their kinase domains and in the number of predicted LysM domains (three and two, respectively). To determine whether such variations are specific to these two proteins, we characterized the M. truncatula LysM-RLK family. We first performed in silico searches in M. truncatula EST and genomic databases and, given the very large number of kinase-encoding genes in plant genomes (more than 400 RLKs alone in Arabidopsis [Arabidopsis thaliana]), we used LysM domains. Then, because LysM domains are not always associated with kinase domains, we made a preselection among ESTs and only sequenced those most similar to LysM domains of Arabidopsis LysM-kinase proteins. In addition to NFP and the previously identified LYK gene cluster (LYK17; Limpens et al., 2003
All nine corresponding proteins are predicted to have an N-terminal signal peptide, one or more LysM domains in the predicted extracellular regions (Pfam predictions), a transmembrane-spanning segment of 22 to 23 predominantly hydrophobic residues, and a Ser-Thr kinase domain in the predicted cytoplasmic part of the protein. Alignments with NFP and LYK1 to 7 (except LYK5 because LYK5 is probably a pseudogene; Limpens et al., 2003 Sequence conservation is strongest in the putative intracellular kinase domains, but close inspection revealed that, in addition to LYK3, LYR5 and 6 and LYK1, 2, 4, and 6 to 9 have fully conserved kinase domains, whereas those of LYK10, and LYR1 to 4 are like NFP in having deviations in normally conserved residues (Supplemental Fig. 1). In LYK10, the conserved Thr-Ser residue in the activation loop is replaced by a Glu residue. In LYR1 to 4 kinase domains, the P-loop is missing and the DFG motif is substituted. LYR1 also lacks the activation loop. In addition, the catalytic Asp residue is replaced by Asn in LYR1 and 4, and the conserved Thr-Ser residue in the activation loops of LYR3 and 4 is replaced by Asp. Based on this, as well as sequence length, overall homology and structural predictions of the extracellular parts of these proteins (see below), four major groups of M. truncatula LysM-RLKs were distinguished and are represented schematically in Figure 5 .
These results show that the LysM-RLK gene family in M. truncatula consists of at least 17 genes, more than in either of the nonlegume plants Arabidopsis (five genes) or rice (Oryza sativa; six genes), and with six showing variation in conserved kinase residues.
Based on kinase domain phylogeny, Arabidopsis and rice LysM-RLK proteins form two clades, LysM-I and LysM-II (Shiu et al., 2004
Comparison of intron/exon organization (known for all Arabidopsis and rice genes, NFR1 and NFR5, and 13 M. truncatula genes) with clades indicated that LysM-I clade genes have 10 to 12 exons, whereas LysM-II and LysM-III genes have one and two exons, respectively. The nomenclature adopted for the new M. truncatula genes is based on these important and clear differences in gene structure. Thus, the previously adopted LYK (LysM domain-containing RLK) has been used for genes having 10 to 12 exons, and other new genes are called LYR (for LYK-related). Consistent with several deviations from the consensus kinase sequence in NFP and LYR1 to 4, these proteins cluster together in the LysM-II clade, where NFP and LYR1 (both lacking an activation loop) form a distinct subgroup. In both of the other clades (LysM-I and LysM-III), all kinases have classical conserved sequences, except LYK10. The same correlation was found between clade and conservation of key kinase residues for Arabidopsis and rice LysM-RLK kinase domains, with Os03g13080 in LysM-II even missing the activation loop exactly as for NFP and LYR1. The only exceptions involved At1g51940 and Os01g36550 in LysM-I, which, like LYK10, lack a normally conserved Ser-Thr residue in their activation loops. This indicates that all LysM-II clade proteins either have substantially reduced kinase activity or unusual functional characteristics different from classical kinases, whereas the majority of LysM-I and all LysM-III proteins have normal kinase activity.
Finally, according to structural similarity between Ser-Thr kinases and the human Tyr kinase (PDB code IFIN; Jeffrey et al., 1995
We analyzed extracellular domains of M. truncatula LysM-RLK proteins by in silico modeling to determine how many LysM domains are predicted within each protein and whether each LysM domain is likely to be equivalent in terms of potential ligand binding.
Based on positions of the Cys-X-Cys motifs, three potential LysM domains were identified for each protein and used to make 3-D structural models. Hydrophobic cluster analysis (HCA) plots were generated and compared to the HCA plot of the murein hydrolase from E. coli, for which there is an NMR-solved LysM domain structure (Bateman and Bycroft, 2000
For NFP and LYK3, LysM domains differ from their E. coli counterparts in some insertions or deletions occurring in loop regions and by their charges. LysM1 domains are essentially electropositively charged (net charge from 24) or neutral, but LysM2 (net charge from 2 to 4) and LysM3 (net charge from 1 to 5) are predominantly electronegative (illustrated for NFP in Fig. 7). The electropositively (Arg, Lys) or electronegatively (Asp, Glu) charged residues mainly occur in loop regions and there is a strongly electropositive cavity in LysM2 of NFP, but not in LysM2 of LYK3 (Fig. 7; data not shown). Close inspection of the amino acid alignment in Supplemental Figure 1 indicated a certain level of conservation among equivalent LysM domains of different proteins. To study this further, separate alignments were made of domains in the same position of each protein to take into account structurally homologous amino acids. Supplemental Figure 3 shows that LysM1, LysM2, and LysM3 of one protein have several structurally homologous amino acids in common with the same domain of other LysM-RLK proteins, but not with other domains of the same protein. This suggests that, in addition to the overall conserved 3-D structures, and the differences in charge between different domains in NFP and LYK3, certain structural features are unique to each domain.
We performed quantitative reverse transcription (RT)-PCR for the nine new M. truncatula genes, as well as NFP, using RNA extracted from symbiotic (roots and nodules) and nonsymbiotic (leaves and stems) plant tissues (Table I ). As a result, four classes of expression pattern could be distinguished. In the first class, LYR2 and LYK10 were expressed specifically in roots and nodules. In the second class, NFP, LYR3, and LYR6 were expressed in roots and nodules and at a much lower level in leaves or stems. In the third class, LYR1 and LYK8 are expressed mostly or only in roots. Finally, LYR4, LYR5, and LYK9 were expressed in all tested tissues, with the highest levels in leaves. Table I also shows the relative expression levels in roots of new genes compared to NFP, indicating that the majority are more highly expressed than NFP.
These results indicate that NFP, like other previously characterized symbiotic LysM-RLK genes (Limpens et al., 2003
As for RLK gene expansion in Arabidopsis (Shiu and Bleecker, 2003
To further characterize genomic organization of LysM-RLKs, we used the M. truncatula genetic map (Thoquet et al., 2002
This analysis indicates that both tandem duplication and segmental genome duplication events are responsible for the large M. truncatula LysM-RLK gene family. Furthermore, 11 of the 17 identified M. truncatula LysM-RLK genes are now known to be located in clusters or tandem repeats of genes of the same subfamily.
The discovery that a new class of plant receptors, the LysM-RLKs, control Nod factor signaling provided a major breakthrough in our understanding of the Rhizobium symbiosis (for review, see Cullimore and Dénarié, 2003
NFP gene expression observed in root hairs before inoculation with S. meliloti is consistent with the role of NFP in controlling a rapid calcium flux, calcium spiking, and inhibition of reactive oxygen efflux within minutes of Nod factor addition to root hairs (Ben Amor et al., 2003
Of the known orthologs of NFP, pea SYM10 but not L. japonicus NFR5, is expressed in mature nodules, which might reflect the different types of nodules formed on M. truncatula and pea (indeterminate) compared to L. japonicus (determinate; Madsen et al., 2003
Functional and expression analysis of DMI1, DMI2, and DMI3, predicted to control Nod factor signaling downstream of NFP, suggests that Nod factor signaling occurs throughout infection in M. truncatula (Bersoult et al., 2005
NFP expression is associated with two concurrent series of events described during establishment of nodulation in M. truncatula (Timmers et al., 1999
LysM domains are probably of prokaryotic origin and are common modules of bacterial surface proteins (Bateman and Bycroft, 2000
Whereas LYK3, LYK4, and L. japonicus NFR1 were described as having two LysM domains each (Limpens et al., 2003
The LysM triplet in plant LysM-RLKs might have originally consisted of the same LysM sequence repeated three times because each LysM domain has an overall 3-D fold similar to that of a bacterial LysM domain. Recent work by Mulder et al. (2006)
A LysM triplet might also be characteristic of plant nonkinase LysM proteins. During this work, we identified two M. truncatula genes predicted to encode such proteins with three LysM domains structurally predicted for each and showing strong homology to the glycosylphosphatidylinositol-anchored proteins AtLYM1 (At1g21880) and AtLYM2 (At2g17120; Borner et al., 2003
Compared to LysM domains, there is higher conservation among the kinase domains of LysM-RLKs, illustrated by the conserved predicted 3-D structures for NFP and LYK3. Despite this, we distinguished kinase domains of distinct evolutionary origin and only LysM-RLKs in clades I and III were predicted to have classically functional kinase domains. In clade II, accumulated mutations in generally conserved residues probably predated dicot/monocot divergence. For example, M. truncatula NFP, M. truncatula LYR1, and Os03g13080 have key residues not conserved and no activation loop. A similar such gene was recently identified in Populus trichocarpa (Stacey et al., 2006
Amino acid replacements in conserved protein domains can be expected to contribute to functional diversity. Different plant LysM-RLKs may consequently have distinct modes of functioning for signal transduction, with some potentially having inactive or so-called dead kinase domains. This is supported by the absence of detectable in vitro autophosphorylation activity for the NFP kinase domain. Moreover, although we cannot exclude ligand-activated autophosphorylation, the long-lasting conservation of this type of kinase with a predicted typical 3-D structure supports an important role in signal transduction. A similar conclusion can be drawn for NFP orthologs in L. japonicus and pea, based on the null phenotypes of certain kinase domain mutants (Madsen et al., 2003
Increasing evidence suggests that some dead kinase receptor kinases are signal-transducing molecules without kinase activity. Examples in animals include ErbB3 and H-Ryk, which both form heterodimers with kinase-active receptors (Kroiher et al., 2001
Approximately 60% of the gene-rich region of the M. truncatula genome is sequenced and 16 expressed LysM-RLK genes have been identified. Compared to Arabidopsis and rice, with five and six LysM-RLK genes, respectively, duplication of these genes in M. truncatula raises many questions. Some putative orthologs can be identified across plant species, suggesting related functions, and there are some potentially M. truncatula-specific LYK and LYR proteins. By analogy with the role of LysM domains in recognizing N-acetyl-glucosamine (Steen et al., 2003
According to Shiu et al. (2004) The finding that many M. truncatula LysM-RLK genes, like NFP and LYK3, are expressed in nodules suggests that expansion of the LysM-RLK gene family in M. truncatula is connected with nodulation. Seven newly identified genes (LYR2, LYR3, LYR4, LYR5, LYR6, LYK9, and LYK10) are expressed in nodules, and six (LYR1, LYR2, LYR3, LYR6, LYK8, and LYK10) are expressed exclusively or almost exclusively in roots and/or nodules. At least the first group of genes must fulfill roles in nodulation. The different expression patterns of the tandemly repeated genes LYR5/6 suggest that specialization for symbiotic functions can follow gene duplication.
Large-scale genomic studies have explored why rhizobia nodulate legumes (Weidner et al., 2003
The molecular identity of NFP supports genetic evidence that this protein is an essential part of a Nod factor receptor. In this scenario, Nod factor structure would be recognized by the extracellular LysM domains. The identification of a new nfp allele, nfp-2, mutated in the first LysM domain supports a crucial role for this domain in Nod factor recognition. Furthermore, this predicted amino acid change in LysM1 leads to strong defective phenotypes, suggesting no redundancy among the three LysM domains of NFP. Instead, only LysM1 may be needed or, consistent with the conservation of the three domains, all three may be required for optimal activity as shown for an N-acetylglucosaminidase of Lactococcus lactis (Steen et al., 2005
In L. japonicus, the ortholog of NFP, NFR5, is hypothesized to dimerize with NFR1, the probable ortholog of LYK3 (Madsen et al., 2003
Different LysM-RLK complexes might be implicated at different symbiotic steps (Cullimore and Dénarié, 2003
In conclusion, it can be recalled that forward genetics screens of model legumes for mutants exhibiting no response to Nod factors identified NFR1 and NFR5 in L. japonicus and NFP in M. truncatula. Comparative genetics and RNAi led to the identification of LYK3 and LYK4 in M. truncatula. These genetic approaches thus suggested that there are at least three Nod factor receptor genes in M. truncatula. In this study, a genomic approach identified seven new M. truncatula LysM-RLK genes that are expressed in roots and nodules, suggesting a higher number of Nod factor receptor genes. This can be explained if different Nod factor receptor complexes act at different steps of the symbiotic process in such a way that mutants in Nod factor receptor genes not previously identified would not have null phenotypes, or if there is functional redundancy, suggested by the fact that no mutants other than nfp mutants were found with the same null phenotype (equivalent to nfr1 mutants of L. japonicus; Geurts et al., 2005
Plant Material and Growth Conditions
Medicago truncatula Jemalong A17 was used in expression and RNAi studies using growth conditions as described by Catoira et al. (2000)
Plasmid introduction into Agrobacterium rhizogenes ARqua1, hairy root transformation, and inoculation with Sinorhizobium meliloti were carried out as described by Lévy et al. (2004)
The candidate NFP gene was identified by the EST BE204912 and the BAC clone mth2-34m14 (Oklahoma University M. truncatula genome-sequencing project). For mapping, a cleaved-amplified polymorphic sequence (CAPS) was made with the primers GGTTGTTCTCGGAATCTTCG and CTGCCAAAGAAGCCAAACTT, and a PCR cycle of 94°C for 4 min, then 40 cycles of 94°C for 30 s, 50°C for 30 s, 72°C for 30 s, and, finally, 72°C for 6 min. The 456-bp products were digested with DdeI before loading on 2% agarose gel. For in planta complementation, a 4.6-kb EcoRV fragment, containing the wild-type NFP gene plus a 1,137-bp promoter region and a 1,665-bp 3' region was cloned in the binary vector pCambia2201 (www.cambia.org).
For promoter-GUS fusions, the 1.5-kb region upstream of NFP was amplified (94°C for 6 min, 40 cycles at 94°C for 30 s, 55°C for 30 s, and 72°C for 1 min, and then 72°C for 5 min) with the primers GTAGGTCGAC (SalI) AGAAGGGAGACGGAGAGAGG and AGCGGATCC (BamHI) TTGTTGTGAGGAAATGCAAA and cloned into the binary vectors pLP100 (Szabados et al., 1995
Two NFP inverted-repeat binary constructs were cloned into pREDROOT as described in Limpens et al. (2004)
Roots were observed for bacterial infection by histochemical staining of
The sequences encoding the predicted NFP and LYK3 intracellular regions were amplified by PCR using forward primers GAATTCAAAATGAAGAGATTGAATAGAAG and GAATTCAAGAAGGAAGAAGAGAAAACT and reverse primers GTCGACTTAACGAGCTATTACAGAAGT and CTCGAGTCATCTAGTTGACAACAGATT, using the NFP gene and LYK3 cDNA, respectively, as templates. PCR products were digested with EcoRI/SalI for NFP or EcoRI/XhoI for LYK3 and cloned in the pGEX-6P-1 vector (Amersham Biosciences) to produce the GST-NFP and GST-LYK3 constructs. The GST-BAK1 construct is described in Li et al. (2002)
To search for DNA sequences of M. truncatula LysM domains, a database of plant peptides was first compiled, consisting of 44,509 Arabidopsis (Arabidopsis thaliana) proteins from Swiss-Prot TrEMBL and 28,657 M. truncatula peptides predicted from EST clusters in the MENS database (http://medicago.toulouse.inra.fr/MENS). The ehmmsearch program of the EMBOSS package was then used to search the database of plant peptides with the seed HMM Pfam LysM domain (accession no. PF01476). The 65 potential LysM domains thus identified were put into a fasta database, which was then used to BLAST (BLASTX with parameters F F G 6 E 2 e 0.1), nucleic acid sequence databases of M. truncatula, both genomic (http://www.genome.ou.edu/medicago.html) and EST clusters (http://medicago.toulouse.inra.fr/MENS). Domain structure was analyzed with Pfam (http://www.sanger.ac.uk/Software/Pfam) and SUPERFAMILY (http://supfam.mrc-lmb.cam.ac.uk/SUPERFAMILY). Signal peptides and transmembrane domains were predicted (using http://www.cbs.dtu.dk/services/SignalP and http://www.cbs.dtu.dk/services/TMHMM, respectively). Rice (Oryza sativa) and Arabidopsis LysM-RLKs were identified by BLAST against http://www.ncbi.nlm.nih.gov/BLAST/Genome/PlantBlast.shtml?7 using M. truncatula LysM domains and standard parameters. Among the candidate LysM-RLKs identified, the occurrence of the conserved Cys-X-Cys motif twice in potential extracellular domains was found to be a useful criterion for selection. Amino acid sequence alignments were made with ClustalX (Thompson et al., 1997
Amino acid sequence alignment was performed using ClustalX. Distances between proteins were calculated by neighbor joining with the phylo_win program using the algorithm of the PROTDIST program of the PHYLIP package. One thousand bootstrap replicates were calculated. TreeView was used to construct trees.
EST clusters corresponding to newly identified genes are MtD10160 (LYR2), MtD20757 (LYR3), MtC93221 (LYR4), MtD13882 (LYR5), MtC90998 (LYR6), MtD06512 (LYK8), MtD04912 (LYK9), and MtD15867 (LYK10). BAC clones identified were mth2-34m14 (NFP and LYR3), mth2-14m21 (LYR1), mth4-1f18 (LYR4), and mth2-3c7 (LYR5 and LYR6). For MtLYM1, the EST MtD01600 and the BAC clone mth2-77f21 were identified. For MtLYM2, the EST MtC30180 was identified.
Plants of wild-type M. truncatula Jemalong A17 were grown aeroponically as described (Catoira et al., 2000
CAPS or microsatellite markers were generated after nucleotide sequence comparison of a PCR-amplified region from both parents of the mapping population, Jemalong and DZA315.16 (Supplemental Table II). For CAPS markers, PCR products were digested with restriction enzymes (Supplemental Table II). Markers were analyzed on 199 F6 recombinant inbred lines derived from the mapping population and positioned between bordering microsatellite markers by MAPMAKER (T. Huguet, unpublished data; Supplemental Table III; Lander et al., 1987 Sequence data from this article can be found in the GenBank/EMBL data libraries under accession number DQ496250.
We are very grateful to Jérome Gouzy for help with in silico sequence searches and to Julie Cullimore for sequencing of LYR4, help with the autophosphorylation tests, and critical reading of the manuscript. We thank Françoise de Billy for advice in studying the ProNFP-GUS expression pattern; Jean-Jacques Bono and Charles Rosenberg for useful comments on the manuscript; Maria Harrison for provision of the mutagenized seeds from which the nfp-2 mutant was isolated; Joseph Garcia for genetic crosses; Professor Jia Li for providing the GST-BAK1 plasmid, and Joe Clouse and Deborah Samac for cDNA clones. Received June 4, 2006; accepted July 8, 2006.
1 This work was supported by the French Ministère de l'Education Nationale, de l'Enseignement Supérieur et de la Recherche (doctoral grants to J.F.A. and A. Bersoult), by the French government in the frame of Tunisian cooperation (doctoral grant to B.B.A.), and by the Agence Nationale de la Recherche (project NT05442720).
2 Present address: Institut des Sciences du Végétal, Centre National de la Recherche Scientifique, 91198 Gif sur Yvette, France. The author responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors (www.plantphysiol.org) is: Clare Gough (gough{at}toulouse.inra.fr).
[W] The online version of this article contains Web-only data. www.plantphysiol.org/cgi/doi/10.1104/pp.106.084657 * Corresponding author; e-mail gough{at}toulouse.inra.fr; fax 33561285061.
Amon P, Haas E, Sumper M (1998) The sex-inducing pheromone and wounding trigger the same set of genes in the multicellular green alga Volvox. Plant Cell 10: 781789 Ané JM, Kiss GB, Riely BK, Penmetsa RV, Oldroyd GE, Ayax C, Lévy J, Debellé F, Baek JM, Kalo P, et al (2004) Medicago truncatula DMI1 required for bacterial and fungal symbioses in legumes. Science 30: 13641367 Ardourel M, Demont N, Debelle F, Maillet F, de Billy F, Promé JC, Dénarié J, Truchet G (1994) Rhizobium meliloti lipooligosaccharide nodulation factors: different structural requirements for bacterial entry into target root hair cells and induction of plant symbiotic developmental responses. Plant Cell 6: 13571374[Abstract] Bateman A, Bycroft M (2000) The structure of a LysM domain from E. coli membrane-bound lytic murein transglycosylase D (MltD). J Mol Biol 299: 11131119[CrossRef][Web of Science][Medline] Ben Amor B, Shaw SL, Oldroyd GE, Maillet F, Penmetsa RV, Cook D, Long SR, Dénarié J, Gough C (2003) The NFP locus of Medicago truncatula controls an early step of Nod factor signal transduction upstream of a rapid calcium flux and root hair deformation. Plant J 34: 495506[CrossRef][Web of Science][Medline] Bersoult A, Camut S, Perhald A, Kereszt A, Kiss GB, Cullimore JV (2005) Expression of the Medicago truncatula DM12 gene suggests roles of the symbiotic nodulation receptor kinase in nodules and during early nodule development. Mol Plant Microbe Interact 18: 869876[Web of Science][Medline] Borner GH, Lilley KS, Stevens TJ, Dupree P (2003) Identification of glycosylphosphatidylinositol-anchored proteins in Arabidopsis: a proteomic and genomic analysis. Plant Physiol 132: 568577 Catoira R, Galera C, de Billy F, Penmetsa RV, Journet EP, Maillet F, Rosenberg C, Cook D, Gough C, Dénarié J (2000) Four genes of Medicago truncatula controlling components of a Nod factor transduction pathway. Plant Cell 12: 16471666 Catoira R, Timmers AC, Maillet F, Galera C, Penmetsa RV, Cook D, Dénarié J, Gough C (2001) The HCL gene of Medicago truncatula controls Rhizobium-induced root hair curling. Development 128: 15071518[Abstract] Charron D, Pingret JL, Chabaud M, Journet EP, Barker DG (2004) Pharmacological evidence that multiple phospholipid signaling pathways link Rhizobium nodulation factor perception in Medicago truncatula root hairs to intracellular responses, including Ca2+ spiking and specific ENOD gene expression. Plant Physiol 136: 35823593 Cullimore J, Dénarié J (2003) Plant sciences: how legumes select their sweet talking symbionts. Science 302: 575578 Dénarié J, Debellé F, Promé JC (1996) Rhizobium lipo-chitooligosaccharide nodulation factors: signaling molecules mediating recognition and morphogenesis. Annu Rev Biochem 6: 503535 El Yahyaoui F, Kuster H, Ben Amor B, Hohnjec N, Puhler A, Becker A, Gouzy J, Vernié T, Gough C, Niebel A (2004) Expression profiling in Medicago truncatula identifies more than 750 genes differentially expressed during nodulation, including many potential regulators of the symbiotic program. Plant Physiol 136: 31593176 Endre G, Kereszt A, Kevei Z, Mihacea S, Kalo P, Kiss GB (2002) A receptor kinase gene regulating symbiotic nodule development. Nature 417: 962966[CrossRef][Medline] Esseling JJ, Lhuissier FG, Emons AM (2004) A nonsymbiotic root hair tip growth phenotype in NORK-mutated legumes: implications for nodulation factor-induced signaling and formation of a multifaceted root hair pocket for bacteria. Plant Cell 16: 933944 Geurts R, Fedorova E, Bisseling T (2005) Nod factor signaling genes and their function in the early stages of Rhizobium infection. Curr Opin Plant Biol 8: 346352[CrossRef][Web of Science][Medline] Geurts R, Heidstra R, Hadri AE, Downie JA, Franssen H, Van Kammen A, Bisseling T (1997) Sym2 of pea is involved in a nodulation factor-perception mechanism that controls the infection process in the epidermis. Plant Physiol 115: 351359[Abstract] Goedhart J, Bono JJ, Bisseling T, Gadella TWJ (2003) Identical accumulation and immobilization of sulfated and nonsulfated Nod factors in host and nonhost root hair cell walls. Mol Plant Microbe Interact 16: 884892[Web of Science][Medline] Gualtieri G, Bisseling T (2002) Microsynteny between the Medicago truncatula SYM2-orthologous genomic region and another region located on the same chromosome arm. Theor Appl Genet 105: 771779[CrossRef][Web of Science][Medline] Hogg BV, Cullimore JV, Ranjeva R, Bono JJ (2006) The DMI1 and DMI2 early symbiotic genes of Medicago truncatula are required for a high-affinity nodulation factor-binding site associated to a particulate fraction of roots. Plant Physiol 140: 365373 Horn MA, Walker JC (1994) Biochemical properties of the autophosphorylation of RLK5, a receptor-like protein kinase from Arabidopsis thaliana. Biochim Biophys Acta 1208: 6574[CrossRef][Medline] Jefferson RA, Kavanagh TA, Bevan MW (1987) GUS fusions: Jeffrey PD, Russo AA, Polyak K, Gibbs E, Hurwitz J, Massague J, Pavletich NP (1995) Mechanism of CDK activation revealed by the structure of a cyclinA-CDK2 complex. Nature 376: 313320[CrossRef][Medline] Jeong S, Trotochaud AE, Clark SE (1999) The Arabidopsis CLAVATA2 gene encodes a receptor-like protein required for the stability of the CLAVATA1 receptor-like kinase. Plant Cell 11: 19251934 Johnson KL, Ingram GC (2005) Sending the right signals: regulating receptor kinase activity. Curr Opin Plant Biol 8: 648656[CrossRef][Web of Science][Medline] Kalo P, Gleason C, Edwards A, Marsh J, Mitra RM, Hirsch S, Jakab J, Sims S, Long SR, Rogers J, et al (2005) Nodulation signaling in legumes requires NSP2, a member of the GRAS family of transcriptional regulators. Science 308: 17861789 Kroiher M, Miller MA, Steele RE (2001) Deceiving appearances: signaling by "dead" and "fractured" receptor protein-tyrosine kinases. Bioessays 23: 6976[CrossRef][Web of Science][Medline] Lander ES, Green P, Abrahamson J, Barlow A, Daly MJ, Lincoln SE, Newburg L (1987) MAPMAKER: an interactive computer package for constructing primary genetic linkage maps of experimental and natural populations. Genomics 1: 174181[CrossRef][Medline] Lévy J, Bres C, Geurts R, Chalhoub B, Kulikova O, Duc G, Journet EP, Ané JM, Lauber E, Bisseling T, et al (2004) A putative Ca2+ and calmodulin-dependent protein kinase required for bacterial and fungal symbioses. Science 303: 13611364 Li J, Wen J, Lease KA, Doke JT, Tax FE, Walker JC (2002) BAK1, an Arabidopsis LRR receptor-like protein kinase, interacts with BRI1 and modulates brassinosteroid signaling. Cell 110: 213222[CrossRef][Web of Science][Medline] Limpens E, Franken C, Smit P, Willemse J, Bisseling T, Geurts R (2003) LysM domain receptor kinases regulating rhizobial Nod factor-induced infection. Science 302: 630633 Limpens E, Mirabella R, Fedorova E, Franken C, Franssen H, Bisseling T, Geurts R (2005) Formation of organelle-like N2-fixing symbiosomes in legume root nodules is controlled by DMI2. Proc Natl Acad Sci USA 102: 1037510380 Limpens E, Ramos J, Franken C, Raz V, Compaan B, Franssen H, Bisseling T, Geurts R (2004) RNA interference in Agrobacterium rhizogenes-transformed roots of Arabidopsis and Medicago truncatula. J Exp Bot 55: 983992 Madsen EB, Madsen LH, Radutoiu S, Olbryt M, Rakwalska M, Szczyglowski K, Sato S, Kaneko T, Tabata S, Sandal N, et al (2003) A receptor kinase gene of the LysM type is involved in legume perception of rhizobial signals. Nature 425: 637640[CrossRef][Medline] Mitra RM, Gleason CA, Edwards A, Hadfield J, Downie JA, Oldroyd GE, Long SR (2004a) A Ca2+/calmodulin-dependent protein kinase required for symbiotic nodule development: gene identification by transcript-based cloning. Proc Natl Acad Sci USA 101: 47014705 Mitra RM, Shaw SL, Long SR (2004b) Six nonnodulating plant mutants defective for Nod factor-induced transcriptional changes associated with the legume-rhizobia symbiosis. Proc Natl Acad Sci USA 101: 1021710222 Mulder L, Lefebvre B, Cullimore J, Imberty A (2006) LysM domains of Medicago truncatula NFP protein involved in Nod factor perception: glycosylation state, molecular modeling and docking of chitooligosaccharides and Nod factors. Glycobiology 16: 801809 Oldroyd GED, Long SR (2003) Identification and characterization of Nodulation-Signaling Pathway 2, a gene of Medicago truncatula involved in Nod factor signaling. Plant Physiol 131: 10271032 Parniske M, Downie JA (2003) Plant biology: locks, keys and symbioses. Nature 425: 569570[CrossRef][Medline] Radutoiu S, Madsen LH, Madsen EB, Felle HH, Umehara Y, Gronlund M, Sato S, Nakamura Y, Tabata S, Sandal N, et al (2003) Plant recognition of symbiotic bacteria requires two LysM receptor-like kinases. Nature 425: 585592[CrossRef][Medline] Riely BK, Ané JM, Penmetsa RV, Cook DR (2004) Genetic and genomic analysis in model legumes bring Nod-factor signaling to center stage. Curr Opin Plant Biol 7: 408413[CrossRef][Web of Science][Medline] Schlaman HR, Horvath B, Vijgenboom E, Okker RJ, Lugtenberg BJ (1991) Suppression of nodulation gene expression in bacteroids of Rhizobium leguminosarum biovar viciae. J Bacteriol 173: 42774287 Sharma SB, Signer ER (1990) Temporal and spatial regulation of the symbiotic genes of Rhizobium meliloti in planta revealed by transposon Tn5-gusA. Genes Dev 4: 344356 Shaw SL, Long SR (2003) Nod factor inhibition of reactive oxygen efflux in a host legume. Plant Physiol 132: 21962204 Shiu SH, Bleecker AB (2003) Expansion of the receptor-like kinase/Pelle gene family and receptor-like proteins in Arabidopsis. Plant Physiol 132: 530543 Shiu SH, Karlowski WM, Pan R, Tzeng YH, Mayer KF, Li WH (2004) Comparative analysis of the receptor-like kinase family in Arabidopsis and rice. Plant Cell 16: 12201234 Silverstein KAT, Graham MA, VandeBosch KA (2006) Novel paralogous gene families with potential function in legume nodules and seeds. Curr Opin Plant Biol 9: 142146[CrossRef][Web of Science][Medline] Smit P, Raedts J, Portyanko V, Debelle F, Gough C, Bisseling T, Geurts R (2005) NSP1 of the GRAS protein family is essential for rhizobial Nod factor-induced transcription. Science 308: 17891791 Stacey G, Libault M, Brechenmacher L, Wan J, May GD (2006) Genetics and functional genomics of legume nodulation. Curr Opin Plant Biol 9: 110121[CrossRef][Web of Science][Medline] Steen A, Buist G, Horsburgh GJ, Venema G, Kuipers OP, Foster SJ, Kok J (2005) AcmA of Lactococcus lactis is an N-acetylglucosamininidase with an optimal number of LysM domains for proper functioning. FEBS J 272: 28542868[CrossRef][Medline] Steen A, Buist G, Leenhouts KJ, El Khattabi M, Grijpstra F, Zomer AL, Venema G, Kuipers OP, Kok J (2003) Cell wall attachment of a widely distributed peptidoglycan binding domain is hindered by cell wall constituents. J Biol Chem 278: 2387423881 Szabados L, Charrier B, Kondorosi A, de Bruijn FJ, Ratet P (1995) New plant promoter and enhancer testing vectors. Mol Breed 1: 419423 Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG (1997) The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res 15: 48764882 Thoquet P, Ghérardi M, Journet EP, Kereszt A, Ané JM, Prosperi JM, Huguet T (2002) The molecular genetic linkage map of the model legume Medicago truncatula: an essential tool for comparative legume genomics and the isolation of agronomically important genes. BMC Plant Biol 2: 1[Medline] Timmers AC, Auriac MC, de Billy F, Truchet G (1998) Nod factor internalization and microtubular cytoskeleton changes occur concomitantly during nodule differentiation in alfalfa. Development 125: 339349[Abstract] Timmers AC, Auriac MC, Truchet G (1999) Refined analysis of early symbiotic steps of the Rhizobium-Medicago interaction in relationship with microtubular cytoskeleton rearrangements. Development 126: 36173628[Abstract] Voorips RE (2002) MapChart: software for the graphical presentation of linkage maps and QTLs. J Hered 93: 7778 Wais RJ, Galera C, Oldroyd G, Catoira R, Penmetsa RV, Cook D, Gough C, Dénarié J, Long SR (2000) Genetic analysis of calcium spiking responses in nodulation mutants of Medicago truncatula. Proc Natl Acad Sci USA 97: 1340713412 Walker SA, Downie JA (2000) Entry of Rhizobium leguminosarum bv. viciae into root hairs requires minimal Nod factor specificity, but subsequent infection thread growth requires nodO or nodE. Mol Plant Microbe Interact 13: 754762[Web of Science][Medline] Weidner S, Pühler A, Küster H (2003) Genomics insights into symbiotic nitrogen fixation. Curr Opin Biotech 14: 200205[CrossRef][Medline] Zhu H, Riely BK, Burns NJ, Ané JM (2006) Tracing non-legume orthologs of legume genes required for nodulation and arbuscular mycorrhizal symbioses. Genetics 172: 24912499 This article has been cited by other articles:
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ASPB Publications | PLANT PHYSIOLOGY® | THE PLANT CELL | |
|---|---|---|---|