Plant Physiol. Drug Metab Dispos
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


First published online July 28, 2006; 10.1104/pp.106.084533

Plant Physiology 142:63-74 (2006)
© 2006 American Society of Plant Biologists

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
142/1/63    most recent
pp.106.084533v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ito, H.
Right arrow Articles by Gray, W. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ito, H.
Right arrow Articles by Gray, W. M.
Agricola
Right arrow Articles by Ito, H.
Right arrow Articles by Gray, W. M.
DEVELOPMENT AND HORMONE ACTION

A Gain-of-Function Mutation in the Arabidopsis Pleiotropic Drug Resistance Transporter PDR9 Confers Resistance to Auxinic Herbicides1

Hironori Ito and William M. Gray*

Department of Plant Biology, University of Minnesota-Twin Cities, St. Paul, Minnesota 55108


    ABSTRACT
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 
Arabidopsis (Arabidopsis thaliana) contains 15 genes encoding members of the pleiotropic drug resistance (PDR) family of ATP-binding cassette transporters. These proteins have been speculated to be involved in the detoxification of xenobiotics, however, little experimental support of this hypothesis has been obtained to date. Here we report our characterization of the Arabidopsis PDR9 gene. We isolated a semidominant, gain-of-function mutant, designated pdr9-1, that exhibits increased tolerance to the auxinic herbicide 2,4-dichlorophenoxyacetic acid (2,4-D). Reciprocally, loss-of-function mutations in PDR9 confer 2,4-D hypersensitivity. This altered auxin sensitivity defect of pdr9 mutants is specific for 2,4-D and closely related compounds as these mutants respond normally to the endogenous auxins indole-3-acetic acid and indole-butyric acid. We demonstrate that 2,4-D, but not indole-3-acetic acid transport is affected by mutations in pdr9, suggesting that the PDR9 transporter specifically effluxes 2,4-D out of plant cells without affecting endogenous auxin transport. The semidominant pdr9-1 mutation affects an extremely highly conserved domain present in all known plant PDR transporters. The single amino acid change results in increased PDR9 abundance and provides a novel approach for elucidating the function of plant PDR proteins.


Auxin regulates numerous aspects of plant growth and development including embryogenesis, lateral root formation, vascularization, and tropic growth responses (Woodward and Bartel, 2005Go). While endogenous auxin plays a critical role in normal plant growth and development, the application of high doses results in phytoxicity. This observation led to the development of several synthetic auxins, including 2-4-dichlorophenoxyacetic acid (2,4-D) as the first successful selective herbicide. 2,4-D and other auxinic herbicides are largely specific to dicots, however, the mechanisms underlying this selectivity are poorly understood. Some 60 years after its discovery, 2,4-D remains the most widely used herbicide worldwide (www.epa.gov). While recent decades have seen the development of several herbicide-resistant crop varieties that have profoundly altered agricultural practices, such is not the case for 2,4-D and other auxinic herbicides. This is complicated in part by the essential role of endogenous auxin (indole-3-acetic acid [IAA]) in plant growth and development. Mutant or transgenic varieties resistant to 2,4-D also display altered response to IAA and consequently exhibit abnormal development. Insight into the mechanism underlying this phenomenon was recently provided by the demonstration that IAA and 2,4-D bind a common receptor to regulate auxin signaling (Dharmasiri et al., 2005aGo; Kepinski and Leyser, 2005Go).

Common strategies to achieve herbicide tolerance through genetic and transgenic approaches are typically aimed at identifying mutant target proteins unaffected by the herbicide or the metabolic detoxification/degradation of the compound. An additional approach was recently suggested by Windsor et al. (2003)Go involving herbicide detoxification by efflux facilitated by plant ATP-binding cassette (ABC) transporters. These proteins, which are found in all living organisms, mediate the translocation of a wide range of structurally unrelated molecules across biological membranes (Higgins, 1992Go). All functional ABC transporters have a basic structural organization consisting of two hydrophobic transmembrane spanning domains (TMDs) and two hydrophilic nucleotide-binding domains (NBDs). The NBDs contain a highly conserved 200-amino acid region consisting of the Walker A and Walker B boxes (Walker et al., 1982Go), separated by approximately 120 amino acids containing the ABC signature motif (Bairoch, 1992Go). Members of ABC transporter family are categorized by the configuration of TMDs and NBDs, and are referred to as half-size or full-size transporters based on the number (one or two) of TMD/NBD modules they contain (Higgins, 1992Go).

In Arabidopsis (Arabidopsis thaliana), approximately 130 genes encoding ABC transporters have been identified in the completed Arabidopsis genome (Sanchez-Fernandez et al., 2001Go; Martinoia et al., 2002Go; Schulz and Kolukisaoglu, 2006Go). Fifty four of these genes belong to the full-size category and are classified into three groups: P glycoproteins (PGPs; also referred to as multidrug resistance [MDR] transporters), MDR-associated proteins (MRPs), and pleiotropic drug resistance (PDR) transporters (Theodoulou, 2000Go; Sanchez-Fernandez et al., 2001Go; van den Brule and Smart, 2002Go; Crouzet et al., 2006Go). Arabidopsis MRP1, MRP2, and MRP3 transport glutathione conjugates of endogenous and artificial substrates into vacuoles (Lu et al., 1997Go, 1998Go; Tommasini et al., 1998Go), and MRP4 and MRP5 have been implicated in the complex regulation of stomatal aperture and guard cell ion flux (Gaedeke et al., 2001Go; Klein et al., 2003Go, 2004Go). The majority of plant PGP/MDRs characterized to date have been implicated in the transport of auxin (Multani et al., 2003Go; Geisler and Murphy, 2006Go). Recently, Arabidopsis PGP1 and PGP19 have been reported to mediate the ATP-dependent cellular efflux of natural and synthetic auxins as well as oxidative auxin breakdown products in Arabidopsis protoplasts and whole plants (Geisler et al., 2003Go, 2005Go). Additionally, Arabidopsis PGP4 has been suggested to function primarily in the uptake of redirected or newly synthesized auxin in epidermal root tip cells (Santelia et al., 2005Go; Terasaka et al., 2005Go).

In contrast to the PGP class of ABC transporters, the plant PDR subfamily has received considerably less attention. Genetic studies on Arabidopsis PDR12 and its likely homologs in Nicotiana plumbaginifolia and Spirodela polyrrhiza have implicated this transporter in the efflux of sclareol, an antifungal diterpene (Jasinski et al., 2001Go; van den Brule et al., 2002Go; Campbell et al., 2003Go; Stukkens et al., 2005Go). An additional connection between PDR-type transporters and defense response is provided by recent studies of atpdr8 mutants, which exhibit increased cell death associated with the hypersensitive response following pathogen infection (Kobae et al., 2006Go; Stein et al., 2006Go). AtPDR12 has also recently been implicated in lead detoxification (Lee et al., 2005Go).

Here we report our characterization of the Arabidopsis PDR9 transporter. We identified the semidominant pdr9-1 mutation as conferring increased 2,4-D tolerance in a genetic screen to isolate mutations enhancing the relatively weak auxin response defect conferred by the tir1-1 mutation (Gray et al., 2003Go; Chuang et al., 2004Go; Quint et al., 2005Go). Reciprocally, recessive loss-of-function alleles of PDR9 result in 2,4-D hypersensitivity, indicating that pdr9-1 is a gain-of-function mutation conferring increased activity to the protein. Further analysis demonstrated that PDR9 is involved in the translocation of not only 2,4-D but also other members of the phenoxyalkanoic acid family of herbicides as well as the polar auxin transport inhibitor, napthylphthalamic acid (NPA). In contrast, we find that PDR9 is not involved in the transport of the native auxin, IAA.


    RESULTS
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 

Identification of the eta4 Mutation

We have previously described a genetic screen designed to identify mutations that enhance the relatively weak auxin resistance phenotype of tir1-1 seedlings. Several enhancer of tir1-1 auxin resistance (eta) mutants were isolated in this screen, including ETA3/SGT1b (Gray et al., 2003Go), ETA2/CAND1 (Chuang et al., 2004Go), and ETA1/AXR6/CUL1 (Quint et al., 2005Go), all three of which encode components of SCFTIR1 pathway. The eta4 tir1-1 M2 plant was backcrossed to Columbia (Col) and eta4 single mutants isolated by PCR-based genotyping of TIR1. When eta4/eta4 TIR1+/TIR1+ plants were backcrossed again to Col, 233/317 F2 seedlings displayed resistant root growth on 0.075 µM 2,4-D, indicating that the eta4 mutation confers a dominant auxin-resistant phenotype (1:3; {chi}2 = 0.85). The amount of 2,4-D-mediated inhibition of root growth varied considerably among the resistant progeny, and 2,4-D dose-response studies revealed that eta4 actually behaves in a semidominant fashion (Fig. 1, A and B ).


Figure 1
View larger version (46K):
[in this window]
[in a new window]
 
Figure 1. Characterization of the eta4 mutant. A, Seedlings were grown on unsupplemented nutrient medium for 4 d and then transferred to medium containing 0.075 µM 2,4-D and grown for an additional 4 d. Asterisks indicate the position of the root tip at the time of transfer. Genotypes were confirmed by sequencing of PCR products. Size bar = 5 mm. B, Inhibition of root elongation by increasing concentrations of 2,4-D. Data points reflect the mean of 10 seedlings. Standard deviations for all data points were ≤10% of the mean. C. Lateral root (LR) initiation was assessed in 10-d-old seedlings grown on unsupplemented nutrient medium (n = 10). D, Inhibition of root elongation by increasing concentrations of IAA and NAA. Data points represent the mean from 10 seedlings. E, Auxin-dependent GUS expression in Col and eta4 seedlings carrying the BA-GUS reporter construct. Each homozygous BA-GUS line was incubated in liquid ATS medium with or without 1 µM auxins for 6 h and then stained for 16 h.

 
Despite the finding that eta4/eta4 seedlings exhibit stronger 2,4-D resistance than tir1-1 mutants (Fig. 1B), unlike tir1-1, the eta4 mutation did not confer a reduction in lateral root development (Fig. 1C). Furthermore, eta4 mutants did not exhibit any of the auxin-related developmental defects, such as reductions in stature and apical dominance characteristic of many auxin-response mutants (Woodward and Bartel, 2005Go). Instead, eta4 plants appeared indistinguishable from wild-type controls at all stages of development (data not shown).

The finding that the eta4 mutation conferred 2,4-D-resistant root growth but no detectable auxin-related phenotypes, suggested that the eta4 defect may be specific to the synthetic auxin, 2,4-D. While no auxin-response mutants have been described that discriminate between native and synthetic biologically active auxins, there are well-characterized differences in the transport of IAA, 2,4-D, and naphthylacetic acid (NAA; Morris et al., 2004Go). For example, while 2,4-D and IAA are taken up by the putative influx carrier AUX1 (Marchant et al., 1999Go), only IAA is an efficient substrate for the efflux carriers of the polar auxin transport system (Morris et al., 2004Go). We compared the effects of exogenous 2,4-D, IAA, and NAA on root growth of eta4 seedlings and found that eta4 auxin resistance was entirely 2,4-D specific (Fig. 1D). Likewise, whereas IAA and NAA promoted lateral root development equally well in eta4 and wild-type seedlings, eta4 mutants exhibited a striking reduction in 2,4-D-induced lateral root formation (data not shown). The 2,4-D-specific auxin resistance of eta4 was also examined at the level of gene expression using the auxin-responsive reporter construct, BA-beta-glucuronidase (GUS; Oono et al., 1998Go). Homozygous Col[BA-GUS] and eta4[BA-GUS] seedlings were treated with 1 µM auxins for 6 h. As reported in Oono et al. (1998)Go, strong induction of GUS activity was observed in the proximal region of the root elongation zone when Col seedlings were treated with auxins (Fig. 1E). While eta4 seedlings exhibited a wild-type-like response to IAA and NAA, only faint GUS staining was detected when eta4 seedlings were treated with 2,4-D (Fig. 1E), further demonstrating the 2,4-D-specific nature of the eta4 mutant.


ETA4 Encodes the PDR9 Protein

A map-based cloning strategy was used to isolate the ETA4 gene. The eta4 mutation was initially mapped between nga162 and nga6 on the south end of chromosome 3. Additional mapping narrowed the location of eta4 to an approximately 200 kb interval. Inspection of candidate loci within this interval revealed the presence of two ABC-type transporter genes, one exhibiting similarity to yeast (Saccharomyces cerevisiae) PDR5 (At3g53480), and a second related to the human breast cancer resistance protein, BCRP (At3g53510). Our finding that the eta4 defect is 2,4-D specific, together with recent findings implicating ABC transporters in auxin transport (Noh et al., 2001Go; Geisler et al., 2005Go; Santelia et al., 2005Go), and studies in yeast demonstrating that loss of pdr5 results in 2,4-D hypersensitive growth arrest (Teixeira and Sa-Correia, 2002Go), led us to sequence the coding regions of these two genes from eta4 plants. We detected no sequence difference between eta4 and wild type for At3g53510, but we did identify a 1-bp substitution (G to A) in the 18th exon of At3g53480 (Fig. 2A ). At3g53480 has been designated as PDR9 among 15 PDR genes identified in Arabidopsis genome (van den Brule and Smart, 2002Go). Thus, we designated eta4 as pdr9-1. PDR9 contains 23 exons and encodes a 1,450-amino acid protein.


Figure 2
View larger version (43K):
[in this window]
[in a new window]
 
Figure 2. ETA4 encodes PDR9. A, Mutation sites of pdr9-1 and pdr9-2. Exons are indicated as boxes and introns are indicated as lines. B, RNA gel-blot analysis using total RNA prepared from Col and pdr9-2 seedlings. Ten micrograms of total RNA was loaded per lane. Ethidium-bromide-stained RNA is shown as a loading control (rRNA). C, Effects of 2,4-D on the root growth in pdr9-2. Data points are averages from 10 seedlings. Standard deviations for all data points were ≤10% of the mean. D, Auxin-dependent expression of the DR5-GUS reporter in wild-type and pdr9-2 roots. Seven-day-old seedlings were transferred to auxin-containing media for 4 h and then stained for 4 h to detect GUS activity. pdr9-2 is on the left and wild type on the right in each image.

 
A search of the SALK Institute's SIGnAL T-DNA database (Alonso et al., 2003Go) identified multiple lines containing a T-DNA insertion within the PDR9 locus (Fig. 2A). We confirmed the T-DNA insertion site in the third exon of SALK_050885, which we designated as pdr9-2. RNA gel-blot analysis detected a 4.5 kb transcript present in RNA prepared from wild-type seedlings and absent from homozygous pdr9-2 samples, suggesting that pdr9-2 is a likely null allele (Fig. 2B). We next examined the affect of 2,4-D on root growth of pdr9-2 seedlings. As shown in Figure 2C, pdr9-2 plants showed clear hypersensitivity to 2,4-D, with root growth almost completely inhibited at 0.01 µM. Consistent with this finding, pdr9-2 seedlings also exhibited increased sensitivity to the 2,4-D-induced expression of the DR5-GUS (Ulmasov et al., 1997Go) reporter of auxin-regulated gene expression (Fig. 2D). IAA-mediated DR5-GUS expression, however, was unaffected in the pdr9-2 mutant (Fig. 2D). The contrasting 2,4-D phenotypes conferred by the semidominant pdr9-1 mutation and recessive pdr9-2 null mutation demonstrate that pdr9-1 is a gain-of-function mutation. Like the pdr9-1 mutant, however, pdr9-2 plants exhibited no detectable growth or developmental phenotype.

PDR proteins are characterized by the possession of two predicted cytosolically oriented NBD domains linked to two multiple-pass hydrophobic TMDs in the arrangement NH2-NBD1-TMD1-NBD2-TMD2-COOH. A search of the ARAMEMON database predicted that PDR9 contains two sets of six-pass TMDs (Fig. 3A ). The mutation identified in pdr9-1 causes an Ala to Thr substitution at position 1,034 within the highly conserved plant PDR signature sequence adjacent to the Walker B motif of NBD2 (Fig. 3B). The Walker A and Walker B motifs, which are needed for ATP binding and hydrolysis, are highly conserved, even in distinct types of ABC transporter family members. The entire adjacent 12-amino acid PDR signature motif encompassing the Ala-1,034 residue affected in pdr9-1 (Fig. 3B) is absolutely conserved in all 15 Arabidopsis PDR proteins as well as in nearly all other plant PDR proteins present in available databases including 20 of the 23 rice PDRs. In contrast, this domain is not highly conserved between plant PDRs and other types of plant ABC transporters, or even between plant and fungal PDR proteins (Fig. 3B). This extreme sequence conservation strongly suggests that this motif plays an important role in plant PDR function.


Figure 3
View larger version (54K):
[in this window]
[in a new window]
 
Figure 3. The pdr9-1 mutation affects a highly conserved residue in NBD2. A, Schematic presentation illustrating PDR9 secondary structure and topology modified from the output from the ARAMENON database (see http://aramenon.botanik.uni-koeln.de) using 11 protein modeling algorithms. Double line indicates lipid bilayer. B, Amino acid alignment of the subregion of NBD2 surrounding the pdr9-1 mutation site (asterisk). The ABC signature, Walker B, and PDR signature 3 motifs (van den Brule and Smart, 2002Go) are overlined. Amino acid identity and similarity to AtPDR9 are indicated by black and gray shading, respectively. The second and third lines represent sequences from all 15 Arabidopsis and 22 rice PDR family members. Two dots indicate residues conserved in the majority of PDR proteins but with conservative substitutions in one or more family members. Single dots indicate residues conserved in the majority of PDR proteins but with nonconservative substitutions in one or more family members. ScPDR5 is a PDR protein from yeast. AtCER5 and AtPGP4 are two non-PDR members of the Arabidopsis family of ABC transporters.

 

Expression Analysis of PDR9

We next analyzed PDR9 expression patterns by RNA gel-blot analysis of RNA prepared from various organs. The PDR9 mRNA was exclusively detected in roots (Fig. 4A ). It has been reported that the expression of some ABC transporters, including the previously characterized Arabidopsis PDR12, is strongly induced by the application of their putative substrates (van den Brule and Smart, 2002Go; Lee et al., 2005Go). We therefore tested the possibility that PDR9 expression is induced by auxins (Fig. 4B). However, PDR9 expression was not affected by 2,4-D, IAA, or NAA treatments. The effect of auxin treatment was confirmed by the clear induction of IAA5 (Fig. 4B). We also examined the tissue-specific expression of PDR9 using transgenic plants carrying the PDR9 promoter fused with the GUS reporter. Strong GUS activity was observed throughout the root, with expression highest in the cells of the lateral root cap and epidermal cells at the root tip (Fig. 4, C and D). The only shoot expression that was detectable was in the stipules (Fig. 4C, inset). Consistent with our reverse transcription (RT)-PCR studies, exogenous auxins did not result in increased PPDR9-GUS expression (data not shown).


Figure 4
View larger version (29K):
[in this window]
[in a new window]
 
Figure 4. Expression analysis of PDR9. A, Organ-specific expression of PDR9. Ten micrograms of total RNA were loaded per lane. Ethidium-bromide-stained RNA is shown as a loading control (rRNA). B, Effect of IAA, NAA, and 2,4-D on PDR9 expression. RT-PCR was performed using total RNA prepared from Col seedlings treated with or without 10 µM IAA, NAA, or 2,4-D for 6 h. Expression of IAA5 was assessed as a positive control for the auxin treatment. ETA2 (Chuang et al., 2004Go) was used as a loading control. C and D, Localization of PPDR9-GUS in Arabidopsis seedlings. C, Seven-day-old seedling. Inset indicates the expression in stipules. D, Root tip of 7-d-old seedling.

 

Characterization of the PDR9 Protein

To characterize the PDR9 protein, we raised polyclonal antisera against a recombinant 6xHis fusion protein containing the N-terminal 98 amino acids of PDR9. The {alpha}-PDR9 antisera detected a single band of approximately 160 kD in wild-type and pdr9-1 extracts prepared from Arabidopsis roots (Fig. 5A ). This band was completely absent in pdr9-2 microsomal extracts, confirming that the antiserum recognizes the PDR9 protein and that pdr9-2 is a likely null allele. Consistent with a predicted membrane localization, PDR9 was only detected in microsomal fractions. Interestingly, we observed a slight but consistent increase in PDR9 abundance in microsomal extracts prepared from pdr9-1 roots than from wild type (Fig. 5, A and B). Analysis of western blots of four independent sets of microsomal membrane preparations indicated that pdr9-1 roots contain approximately 1.8- ± 0.2-fold more PDR9 protein than wild-type controls. In contrast, we could detect no difference in PDR9 mRNA levels between wild type and pdr9-1 (Fig. 5B), suggesting that the mutation might confer increased protein stability, which could potentially account for its semidominant nature.


Figure 5
View larger version (43K):
[in this window]
[in a new window]
 
Figure 5. Characterization of the PDR9 protein. A, Western-blot analysis of microsomal and supernatant fractions prepared from 8-d-old Arabidopsis roots. Eight micrograms of extract were loaded/lane. B, Western-blot (top) and RT-PCR (bottom) analyses of PDR9 levels. For the western blots, lanes 1 and 2 contain 8 µg of root microsomal extract, whereas lane 3 contains 4 µg. {alpha}-SEC12 was used as a loading control. For RT-PCR, 1 µg of total RNA were used to generate cDNAs in reverse transcriptase reactions. One microliter of the cDNAs were then used as template in lanes 1 and 2, while 0.5 µL was used in lane 3 (PDR9, 27 cycles; ETA2, 26 cycles). C, Aqueous two-phase fractionation of Arabidopsis microsomes prepared from wild-type roots. Crude microsomes (cMS): upper phase enriched in PMs; lower phase enriched in other membranes (OM).

 
To further investigate the subcellular localization of PDR9, microsomal extracts were subjected to aqueous two-phase partitioning. PDR9 fractionated almost exclusively to the plasma membrane (PM) enriched upper phase (Fig. 5C), as did the known PM protein PGP4 (Terasaka et al., 2005Go). In contrast, the endoplasmic reticulum-associated protein, SEC12, was highly enriched in the lower phase. We obtained identical results in two-phase fractionations with pdr9-1 microsomes, suggesting that the mutant protein is not altered in its membrane localization (data not shown).


Effects of Additional Auxinic Compounds on pdr9 Mutants

The finding that ETA4 encodes a PDR-type ABC transporter that localizes to the PM and affects sensitivity to 2,4-D but not the endogenous auxin IAA suggested that PDR9 might be involved in the cellular detoxification of xenobiotics. This led us to test the effects of several additional herbicides on our pdr9 mutants to further examine specificity. Because of its widespread usage in the agricultural and horticultural fields, several 2,4-D-related compounds have been developed that exhibit auxin-like activities. For example, 2,4-D, 4-chlorophenoxy-acetic acid, 4-chloro-2-methylphenoxy acetic acid, and 2,4,5-trichlorophenoxyacetic acid all share a 4-chloro-phenoxy ring, but differ in terms of the number of chloride or methyl groups present. As observed with 2,4-D, the gain-of-function and loss-of-function pdr9 alleles conferred opposing phenotypes in root growth inhibition assays with these 2,4-D-related herbicides (Fig. 6, A–C ). In contrast, wild-type and the pdr9 mutants exhibited similar sensitivity toward p-chlorophenoxyisobutyric acid, which has a 4-chloro-phenoxy ring with an isobutyric rather than an acetic acid group at position 1. This finding suggests that the acidic side chain may be an important determinant of specificity, however, it should be noted that the concentration of p-chlorophenoxyisobutyric acid necessary to inhibit root growth is considerably higher than these other auxins (Fig. 6D).


Figure 6
View larger version (29K):
[in this window]
[in a new window]
 
Figure 6. Inhibition of root elongation by various auxin-related compounds. Seedlings were grown on unsupplemented nutrient medium for 4 d and then transferred to medium containing various compounds as indicated and grown for an additional 4 d. The structures of chlorophenoxyl compounds are superimposed on graphs (A to D). Data points are averages from 10 seedlings. SDs for all data points were ≤12% of the mean.

 
We also examined sensitivities to the IAA derivatives indole-butyric acid, 4-Cl-IAA, and 4,5-Cl-IAA. The responsiveness to these IAA-related compounds in pdr9-2 plants was essentially the same as wild type, suggesting that PDR9 is not involved in their transport. However, while pdr9-1 plants responded normally to IAA and indole-butyric acid, they were slightly resistant to 4-Cl-IAA and even more so to 4,5-Cl-IAA (Fig. 6, E–H). These results suggest that the gain-of-function pdr9-1 mutation might affect substrate recognition and confer a broader range of substrate specificity. We also tested several concentrations of NAA, dicamba, picloram, abscisic acid, cycloheximide, Cu2+, Co2+, and Zn2+, but detected no significant differences between the pdr9 mutants and wild type (data not shown).


pdr9-2 Is Hypersensitive to NPA

Although neither pdr9 allele conferred any change in sensitivity to IAA or NAA, we wanted to further examine the possibility that PDR9 might be involved in auxin transport since several recent studies have implicated PGP/MDR subfamily members of ABC transporters in polar auxin flow (Geisler et al., 2003Go, 2005Go; Terasaka et al., 2005Go). We analyzed the gravitropic response of both pdr9 alleles by plate rotation and root curling assays, but could detect no significant changes from wild type in the gravitropism response (data not shown). However, when pdr9-2 seedlings were grown in the presence of the polar auxin transport inhibitor NPA, we observed a dramatic increase in sensitivity compared to wild type. pdr9-2 seedlings exhibited agravitropic root and hypocotyl growth on concentrations of NPA as low as 0.05 µM, whereas wild-type and pdr9-1 seedlings were largely unaffected at this concentration (Fig. 7, A–F ). We also examined the effect of NPA on root growth in quantitative root inhibition assays. pdr9-2 seedlings exhibited an approximately 100-fold increase in sensitivity compared to wild type and pdr9-1 (Fig. 7G).


Figure 7
View larger version (42K):
[in this window]
[in a new window]
 
Figure 7. pdr9-2 plants are hypersensitive to NPA treatment. A to F, Effects of NPA on seedling growth. Seedlings were grown in dark for 5 d with (B, D, and F) or without (A, C, and E) 0.05 µM NPA. A and B, Wild type. C and D, pdr9-1. E and F, pdr9-2. Size bar = 1 cm. G, Inhibition of root elongation by NPA. Seedlings were grown on unsupplemented nutrient medium for 4 d and then transferred to medium containing different concentration of NPA and grown for an additional 4 d. Data points are averages from 10 seedlings. SDs for all data points were <10% of the mean.

 

Altered 2,4-D and NPA Accumulation in pdr9 Mutants

To confirm that the physiological responses observed in the pdr9 mutants were due to the altered transport of 2,4-D or NPA, we conducted accumulation assays using [14C]-2,4-D and [3H]-NPA. Based on the expression analysis of PDR9 (Fig. 4), root tips (apical 5 mm) were collected from 5-d-old seedlings and incubated in buffer containing labeled 2,4-D or NPA for 60 min. Following a brief rinse, the root tips were collected and radioactivity levels measured by liquid scintillation counting. Consistent with our physiological assays indicating that the pdr9 mutations confer altered 2,4-D sensitivity but do not affect IAA sensitivity, we observed significant hyperaccumulation and hypoaccumulation of [14C]-2,4-D in pdr9-2 and pdr9-1 roots, respectively (Fig. 8A ), but no difference in [3H]-IAA accumulation (Fig. 8B). When incubated with [3H]-NPA, pdr9-2 roots accumulated dramatically more label than wild-type roots (Fig. 8C). pdr9-1 root tips exhibited a slight, albeit statistically insignificant, reduction in [3H]-NPA. However, this minor difference between wild type and pdr9-1 was also seen with shorter labeling periods (15 or 30 min; data not shown), suggesting that NPA transport may also be affected by the pdr9-1 mutation.


Figure 8
View larger version (21K):
[in this window]
[in a new window]
 
Figure 8. Altered transport of 2,4-D and NPA in pdr9 mutants. Root tips from 5-d-old Arabidopsis seedlings were excised and incubated in buffer containing radiolabeled [14C]-2,4-D (A), [3H]-IAA (B), or [3H]-NPA (C), rinsed briefly, and analyzed by scintillation counting. Values are the means from four or five independent experiments, each performed in duplicate.

 

    DISCUSSION
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 

Mutations in PDR9 Alter 2,4-D, But Not IAA Sensitivity

In the past 20 years, numerous mutants exhibiting altered auxin sensitivity have been described. Since both IAA and the synthetic auxin 2,4-D are recognized by the same receptors, the TIR1/AFB family of F-box proteins (Dharmasiri et al., 2005aGo, 2005bGo), all auxin signaling mutants described to date exhibit altered response to both of these auxins. In contrast, several studies have demonstrated that major differences exist in the transport of IAA and 2,4-D, with the latter being a poor substrate for the polar auxin transport system (Delbarre et al., 1996Go; Morris et al., 2004Go). Our complementary findings with gain- and loss-of-function alleles of PDR9 indicate that this PDR-type ABC transporter specifically affects 2,4-D transport, resulting in altered sensitivity without affecting transport or sensitivity to the endogenous auxin, IAA.

Using several physiological and molecular assays, we demonstrate that the pdr9-1 gain-of-function mutation specifically confers increased 2,4-D resistance. Reciprocally, the pdr9-2 null mutation confers 2,4-D hypersensitivity. These findings correlate precisely with [14C]-2,4-D accumulation assays that demonstrate the gain- and loss-of-function pdr9 mutants accumulate less or more 2,4-D, respectively, than wild-type controls. Given these findings, together with the likely PM localization of PDR9 suggested by our microsome fractionation studies, it is likely that PDR9 acts as a 2,4-D pump capable of effluxing 2,4-D out of plant cells. While our 2,4-D accumulation assays do not directly discriminate between 2,4-D influx and efflux, since the pdr9-2 null mutant hyperaccumulates 2,4-D resulting in increased sensitivity to the herbicide, one would need to invoke a mechanism whereby PDR9 normally negatively regulates a protein that imports 2,4-D in order for influx to be altered in the pdr9 mutants. 2,4-D can enter plant root cells via the putative auxin influx carrier AUX1 (Marchant et al., 1999Go). However, PDR9-mediated negative regulation of AUX1 activity seems highly unlikely given that [3H]-IAA accumulation was identical in wild type and the pdr9 mutants.

We attempted to demonstrate that PDR9 can directly transport 2,4-D by expression in heterologous systems, but these experiments were unsuccessful, largely due to technical complications. First, we expressed PDR9 in yeast to try and complement the 2,4-D hypersensitivity conferred by a pdr5 mutation. However, PDR9 expression was somewhat toxic to yeast, conferring a severe slow-growth phenotype that made complementation difficult to ascertain. Additionally, membrane fractionation studies and expression of a PDR9-GFP construct both indicated that PDR9 did not localize to the PM properly in yeast. Other investigators have encountered similar difficulties in expressing plant PDR proteins in yeast (van den Brule et al., 2002Go; Crouzet et al., 2006Go). We also expressed PDR9 in Xenopus oocytes. Although we did observe a low level of PDR9 expression, we were unable to convincingly demonstrate any difference in 2,4-D efflux between injected and uninjected oocytes.

Several recent findings have implicated members of the PGP/MDR subfamily of ABC transporters in polar auxin transport. However, none of our findings suggest that PDR9 plays a role in this important process. The pdr9 mutants exhibit normal IAA sensitivity, and are unaffected in auxin-mediated processes such as lateral root development and tropic growth responses. Furthermore, we show that the pdr9 mutations specifically affect the transport of 2,4-D and closely related synthetic auxins without altering IAA transport. Although the pdr9-2 mutant exhibits heightened sensitivity to the polar auxin transport inhibitor NPA, this is almost certainly due to the fact that this mutant hyperaccumulates NPA as we demonstrate in uptake assays with [3H]-NPA. This latter finding also demonstrates that plants can transport NPA and should be considered by those employing this inhibitor in auxin transport studies.


What Is the Cellular Role of PDR9?

A significant unresolved question from our study regards the normal cellular function of PDR9. Neither the pdr9-1 nor pdr9-2 mutants exhibit any growth or developmental phenotype. We addressed the possibility that this might be attributable to genetic redundancy by examining T-DNA insertion mutants of the most closely related Arabidopsis PDR family member, PDR5. Like the pdr9 mutants, neither pdr5 mutant (SALK_002380 and SALK_035106) exhibited a discernible growth phenotype (H. Ito and W.M. Gray, unpublished data). However, unlike pdr9-2, the pdr5 mutants did not exhibit altered sensitivity to 2,4-D or NPA. Furthermore, pdr5 pdr9-2 double mutants behaved exactly like pdr9-2 single mutants in 2,4-D dose-response assays, suggesting the two proteins are functionally distinct (H. Ito and W.M. Gray, unpublished data).

Several recent findings have implicated AtPDR8, AtPDR12, and NpPDR1 in plant defense responses (Campbell et al., 2003Go; Stukkens et al., 2005Go; Kobae et al., 2006Go; Stein et al., 2006Go). These studies suggest that these transporters may extrude secondary metabolites with antimicrobial activity as part of the plant's response to pathogen infection. Most notably, atpdr8/pen3 mutants were isolated in a genetic screen for mutations conferring reduced resistance to the barley powdery mildew Blumeria graminis, while NpPDR1-silenced tobacco (Nicotiana tabacum) plants exhibit reduced resistance to Botrytis cinerea (Stukkens et al., 2005Go). Such studies suggest that PDR9 might also be involved in defense responses. We note that numerous cis-acting elements implicated in defense responses, including nine putative WRKY transcription factor-binding sites, are present within 650 bases of sequence upstream of the PDR9 transcription start site (W box; http://www.dna.affrc.go.jp/PLACE/). Strong expression in the lateral root cap and epidermis also suggests that PDR9 might function in communication processes between plant roots and other organisms in the rhizosphere. Additionally, PDR9 has been identified as being strongly inducible by the defense elicitor salicylic acid (https://www.genevestigator.ethz.ch; Zimmermann et al., 2004Go), however we were unable to verify this result in RT-PCR assays or with our PPDR9-GUS reporter lines (H. Ito and W.M. Gray, unpublished data).

If the ability to act as a transporter of 2,4-D and related phenoxy acids is indicative of the endogenous substrate of PDR9, several phenolic secondary metabolites with antimicrobial activity including trans-cinnamic, ferulic, o-coumaric, and vanillic acid have all been identified in Arabidopsis root exudates following treatment with various pathogen elicitors (Walker et al., 2003Go). All of these compounds inhibit root growth at micromolar concentrations, however, we could detect no significant difference in response between wild type and the pdr9 mutants (H. Ito and W.M. Gray, unpublished data). Unfortunately, the root-specific expression pattern of PDR9 combined with the absence of an established quantitative assay for susceptibility to root-invading pathogens preclude us from readily examining the pdr9 mutants for altered pathogen resistance.


The Gain-of-Function pdr9-1 Mutation

The gain-of-function pdr9-1 mutation is highly intriguing given that it affects a domain that is extremely highly conserved in all plant PDR proteins identified to date. The proximity of this domain to the Walker motifs in the second NBD suggests that the mutation might act by increasing ATP binding or hydrolysis rates. We attempted to address this possibility using Escherichia coli expressed recombinant NBD2 in ATP hydrolysis assays as described for other ABC proteins (Jha et al., 2003Go). However, we could detect no activity with either the wild-type or mutant proteins.

An alternative explanation was suggested by our {alpha}-PDR9 antibody studies, in which we observed a modest (approximately 1.8-fold) but consistent increase in PDR9 protein abundance in microsomal extracts prepared from pdr9-1 roots compared to wild type. Although the precise mechanism by which the pdr9-1 mutation acts requires further study, this result suggests that the mutation may confer increased protein stability. It should be noted that several ABC transporters, including the closely related yeast PDR5p, are relatively short-lived proteins subject to ubiquitin-mediated vacuolar proteolysis (Egner et al., 1995Go; Egner and Kuchler, 1996Go). Thus, an increase in PDR9 protein levels due to enhanced stability could account for the increased 2,4-D resistance observed in pdr9-1. Overexpression of AtPDR12 and its putative Spirodela ortholog, SpTUR2, in Arabidopsis confer increased resistance to the potential substrates lead and sclareol, respectively (van den Brule et al., 2002Go; Lee et al., 2005Go). We attempted to overexpress PDR9 from the cauliflower mosaic virus 35S promoter to further address this possibility but were unable to recover any transgenic lines expressing elevated levels of PDR9 (data not shown).

Regardless of the mode of action of the pdr9-1 mutation, the fact that it occurs in the extremely highly conserved PDR signature sequence suggests that the gain-of-function affects might be transferable to other plant PDR transporters. If so, this could provide a novel means for engineering plants with increased xenobiotic resistance. Such an approach may be particularly effective if transporter activity can be increased to an even greater extent by more dramatic mutations of the PDR signature motif and/or in conjunction with overexpression.

Recently, the ABC transporter encoded by the AtWBC19 gene was shown to confer kanamycin resistance when overexpressed in plants (Mentewab and Stewart, 2005Go). The authors noted that the development of AtWBC19 as a selectable marker provides an alternative to the bacterial-derived nptII gene, thus reducing the potential of horizontal transfer of resistance genes. The dominant nature of the pdr9-1 mutation suggests the potential for PDR9 to be similarly developed as a plant-derived selectable marker for 2,4-D resistance, as well as the development of crops resistant to the phenoxyalkanoic acid class of herbicides, yet which exhibit normal sensitivity to endogenous auxin. Little is known regarding the function of the vast majority of plant ABC transporters. As more is learned regarding the natural substrates of these transporters as well as their capacity to mobilize various xenobiotics, this family of proteins may develop into an important genetic resource for engineering plants with increased resistance to contaminated soils and potentially for the development of phytoremediation strategies.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 

Plant Materials and Growth Conditions

All Arabidopsis (Arabidopsis thaliana) lines used in this study are in the Col ecotype. Seedlings were grown under sterile conditions on ATS nutrient medium (Lincoln et al., 1990Go) under long-day lighting. Conditions for the mutagenesis and screen for eta mutants have been previously described (Gray et al., 2003Go). Chemicals used in root growth assays were purchased from Sigma-Aldrich and dissolved in ethanol or dimethylsulfoxide as 1,000x stocks. For root growth assays, seedlings were grown on ATS nutrient media for 4 to 5 d, transferred to ATS media containing 2,4-D, NPA, 4-chloro-2-methylphenoxy acetic acid, etc., the position of the root tip marked, and then incubated an additional 4 d. The amount of root growth was measured and percent inhibition calculated versus growth on unsupplemented media.


Map-Based Cloning of PDR9

Since the eta4/pdr9-1 mutation was semidominant, a total of 237 2,4-D-sensitive F2 seedlings from a cross between the mutant and ecotype Landsberg erecta (Ler) were used to map the eta4/pdr9-1 mutation using cleaved amplified polymorphic sequences and simple sequence length polymorphism markers. The mutation was initially mapped to an interval between markers nga162 and nga6 (http://www.arabidopsis.org). Additional markers were generated using the Cereon Arabidopsis polymorphism collection (Jander et al., 2002Go). Markers defining our final mapping interval were CER470292, which amplifies 144 and 135 bp fragments from Col and Ler, and CER470334, which amplifies 101 and 116 bp fragments from Col and Ler, respectively.


Northern-Blot Analysis and RT-PCR

Total RNA was isolated from various Arabidopsis organs as described by Chomczynski and Sacchi (1987)Go. For RT-PCR, total RNA was extracted from seedlings using RNeasy plant kits (Qiagen) according to the manufacturer's instructions. Northern blots were performed with 10 µg total RNA/sample using standard techniques. For RT-PCR analysis, first-strand cDNA synthesis was performed using 1 µg RNA and M-MLV-RTase (Promega) following the manufacturer's instructions. Gene-specific primers were designed to allow detection of amplification products from contaminant genomic DNA using primers spanning one or more introns. The specific primers used in this study were PDR9-F4: GCGAAACTCAGAGCTTGTGA; PDR9-R1: AATGATGATTGATGAAGACT; ETA2-7F: GTGCTGTTGGTTACCGGTTTGGC; and ETA2-14R: CAGGAGGCGCATGTGATGCCAA.


GUS Histochemical Staining

A 2.3 kb fragment containing genomic sequence from upstream of the PDR9 locus through the first 33 bp of coding sequence was cloned in frame with the GUS coding sequence of pBI101.2 (CLONTECH). Seedlings were stained for GUS activity as previously described (Stomp, 1991Go).


Antibodies

A cDNA fragment encoding PDR9 amino acids 1 to 98 was cloned as an EcoRI-XhoI fragment into the pET30A Escherichia coli expression vector (Novagen). Expression was induced with isopropylthio-beta-galactoside and the fusion protein purified on nickel-nitrilotriacetic acid agarose using standard protocols (Gray et al., 1999Go). The recombinant protein was eluted with imidazole and used to immunize a New Zealand white rabbit (Cocalico Biological). SEC12 and PGP4 antibodies were kindly provided by Drs. Tony Sanderfoot (University of Minnesota) and Angus Murphy (Purdue University).


Microsomal Purification and Immunoblot Analysis

Five hundred milligrams of root tissue from 8-d-old seedlings were homogenized on ice in 2 mL of buffer (250 mM sorbitol, 50 mM Tris-HCl, pH 8.0, 2 mM EDTA, 7 g/L polyvinylpyrrolidone, 5 mM dithiotoreitol, 0.5x proteinase inhibitor mix [Calbiochemistry], and 1 mM phenylmethylsulfonyl fluoride; Stukkens et al., 2005Go). The homogenate was centrifuged for 5 min at 10,000g at 4°C and the supernatant centrifuged again under the same conditions to remove cell debris. The resulting supernatant was spun 1.5 h at 20,000g at 4°C, and the final pellet suspended in 100 µL resuspension buffer (5 mM potassium phosphate buffer, pH 7.8, 330 mM Suc, 3 mM KCl, 0.5x proteinase inhibitor mix, and 1 mM phenylmethylsulfonyl fluoride). For the aqueous two-phase partitioning experiments, microsomes were prepared from 10-d-old roots (5g fresh weight) and fractionated according to Larsson et al. (1994)Go. For immunoblotting, 5 µg of each protein sample solubilized for 15 min at 37°C in SDS sample buffer were subjected to SDS-PAGE (7.5% polyacrylamide) and transferred electrophoretically to nitrocellulose membranes (Amersham). Immunoblot procedures have been described previously (Gray et al., 1999Go). The antibody dilutions were 1:4,000 for {alpha}-PDR9, 1:4,000 for {alpha}-AtSEC12, and 1:3,000 for {alpha}-PGP4 antisera. Where indicated, quantification of immunoblots was performed using ImageJ with enhanced chemiluminescence exposures on preflashed autoradiography film.


Labeling Assays

Root tips (apical –5 mm) were excised from 5-d-old Arabidopsis seedlings and preincubated in uptake buffer (20 mM MES-KOH, pH 5.6, 10 mM Suc, 0.5 mM calcium sulfate). Then, tips were incubated in uptake buffer containing 250 nM [14C]-2,4-D, 250 nM [3H]-IAA, or 34 nM [3H]-NPA, respectively. After 60 min incubation, root tips were rinsed with same buffer and placed directly into liquid scintillation fluid. [5-3H]-IAA (20 Ci/mmol), [ring-14C (U)]-2,4-D (80 mCi/mmol), and [2,3,4,5-3H]-NPA (58 Ci/mmol) were obtained from American Radiolabeled Chemicals.

Sequence data from this article can be found in the GenBank/EMBL data libraries under accession number BK001008 (PDR9).


    ACKNOWLEDGMENTS
 
We thank Cereon Genomics for access to its Arabidopsis Polymorphism Collection, Dr. John Ward, the Salk Institute Genomic Analysis Laboratory, and the Arabidopsis Biological Resource Center for providing seed stocks, Drs. Anthony Sanderfoot and Angus Murphy for providing antibodies, technical advice, and thoughtful discussion. We are also grateful to Drs. Neil Olszewski, Paul Overvoorde, and John Ward for helpful comments on the manuscript.

Received June 2, 2006; accepted July 26, 2006.


    FOOTNOTES
 
1 This work was supported by the National Institutes of Health (grant no. GM067203 to W.M.G.) and a Japanese Society for the Promotion of Science Postdoctoral Fellowship for Research Abroad (to H.I.). Back

The author responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors (www.plantphysiol.org) is: William M. Gray (grayx051{at}tc.umn.edu).

www.plantphysiol.org/cgi/doi/10.1104/pp.106.084533

* Corresponding authors e-mail grayx051{at}tc.umn.edu; fax 612–625–1738.


    LITERATURE CITED
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 
Alonso JM, Stepanova AN, Leisse TJ, Kim CJ, Chen H, Shinn P, Stevenson DK, Zimmerman J, Barajas P, Cheuk R, et al (2003) Genome-wide insertional mutagenesis of Arabidopsis thaliana. Science 301: 653–657[Abstract/Free Full Text]

Bairoch A (1992) PROSITE: a dictionary of sites and patterns in proteins. Nucleic Acids Res 20 (Suppl): 2013–2018[ISI][Medline]

Campbell EJ, Schenk PM, Kazan K, Penninckx IA, Anderson JP, Maclean DJ, Cammue BP, Ebert PR, Manners JM (2003) Pathogen-responsive expression of a putative ATP-binding cassette transporter gene conferring resistance to the diterpenoid sclareol is regulated by multiple defense signaling pathways in Arabidopsis. Plant Physiol 133: 1272–1284[Abstract/Free Full Text]

Chomczynski P, Sacchi N (1987) Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162: 156–159[ISI][Medline]

Chuang HW, Zhang W, Gray WM (2004) Arabidopsis ETA2, an apparent ortholog of the human cullin-interacting protein CAND1, is required for auxin responses mediated by the SCF(TIR1) ubiquitin ligase. Plant Cell 16: 1883–1897[Abstract/Free Full Text]

Crouzet J, Trombik T, Fraysse AS, Boutry M (2006) Organization and function of the plant pleiotropic drug resistance ABC transporter family. FEBS Lett 580: 1123–1130[Medline]

Delbarre A, Muller P, Imhoff V, Guern J (1996) Comparison of mechanisms controlling uptake and accumulation of 2,4-dichlorophenoxy acetic acid, naphthalene-1-acetic acid, and indole-3-acetic acid in suspension-cultured tobacco cells. Planta 198: 532–541[ISI]

Dharmasiri N, Dharmasiri S, Estelle M (2005a) The F-box protein TIR1 is an auxin receptor. Nature 435: 441–445[CrossRef][Medline]

Dharmasiri N, Dharmasiri S, Weijers D, Lechner E, Yamada M, Hobbie L, Ehrismann JS, Jurgens G, Estelle M (2005b) Plant development is regulated by a family of auxin receptor F box proteins. Dev Cell 9: 109–119[CrossRef][ISI][Medline]

Egner R, Kuchler K (1996) The yeast multidrug transporter Pdr5 of the plasma membrane is ubiquitinated prior to endocytosis and degradation in the vacuole. FEBS Lett 378: 177–181[CrossRef][ISI][Medline]

Egner R, Mahe Y, Pandjaitan R, Kuchler K (1995) Endocytosis and vacuolar degradation of the plasma membrane-localized Pdr5 ATP-binding cassette multidrug transporter in Saccharomyces cerevisiae. Mol Cell Biol 15: 5879–5887[Abstract]

Gaedeke N, Klein M, Kolukisaoglu U, Forestier C, Muller A, Ansorge M, Becker D, Mamnun Y, Kuchler K, Schulz B, et al (2001) The Arabidopsis thaliana ABC transporter AtMRP5 controls root development and stomata movement. EMBO J 20: 1875–1887[CrossRef][ISI][Medline]

Geisler M, Blakeslee JJ, Bouchard R, Lee OR, Vincenzetti V, Bandyopadhyay A, Titapiwatanakun B, Peer WA, Bailly A, Richards EL, et al (2005) Cellular efflux of auxin catalyzed by the Arabidopsis MDR/PGP transporter AtPGP1. Plant J 44: 179–194[CrossRef][ISI][Medline]

Geisler M, Kolukisaoglu HU, Bouchard R, Billion K, Berger J, Saal B, Frangne N, Koncz-Kalman Z, Koncz C, Dudler R, et al (2003) TWISTED DWARF1, a unique plasma membrane-anchored immunophilin-like protein, interacts with Arabidopsis multidrug resistance-like transporters AtPGP1 and AtPGP19. Mol Biol Cell 14: 4238–4249[Abstract/Free Full Text]

Geisler M, Murphy AS (2006) The ABC of auxin transport: the role of p-glycoproteins in plant development. FEBS Lett 580: 1094–1102[CrossRef][ISI][Medline]

Gray WM, del Pozo JC, Walker L, Hobbie L, Risseeuw E, Banks T, Crosby WL, Yang M, Ma H, Estelle M (1999) Identification of an SCF ubiquitin-ligase complex required for auxin response in Arabidopsis thaliana. Genes Dev 13: 1678–1691[Abstract/Free Full Text]

Gray WM, Muskett PR, Chuang HW, Parker JE (2003) Arabidopsis SGT1b is required for SCF(TIR1)-mediated auxin response. Plant Cell 15: 1310–1319[Abstract/Free Full Text]

Higgins CF (1992) ABC transporters: from microorganisms to man. Annu Rev Cell Biol 8: 67–113[CrossRef][ISI][Medline]

Jander G, Norris SR, Rounsley SD, Bush DF, Levin IM, Last RL (2002) Arabidopsis map-based cloning in the post-genome era. Plant Physiol 129: 440–450[Abstract/Free Full Text]

Jasinski M, Stukkens Y, Degand H, Purnelle B, Marchand-Brynaert J, Boutry M (2001) A plant plasma membrane ATP binding cassette-type transporter is involved in antifungal terpenoid secretion. Plant Cell 13: 1095–1107[Abstract/Free Full Text]

Jha S, Karnani N, Dhar SK, Mukhopadhayay K, Shukla S, Saini P, Mukhopadhayay G, Prasad R (2003) Purification and characterization of the N-terminal nucleotide binding domain of an ABC drug transporter of Candida albicans: uncommon cysteine 193 of Walker A is critical for ATP hydrolysis. Biochemistry 42: 10822–10832[CrossRef][Medline]

Kepinski S, Leyser O (2005) The Arabidopsis F-box protein TIR1 is an auxin receptor. Nature 435: 446–451[CrossRef][Medline]

Klein M, Geisler M, Suh SJ, Kolukisaoglu HU, Azevedo L, Plaza S, Curtis MD, Richter A, Weder B, Schulz B, et al (2004) Disruption of AtMRP4, a guard cell plasma membrane ABCC-type ABC transporter, leads to deregulation of stomatal opening and increased drought susceptibility. Plant J 39: 219–236[CrossRef][ISI][Medline]

Klein M, Perfus-Barbeoch L, Frelet A, Gaedeke N, Reinhardt D, Mueller-Roeber B, Martinoia E, Forestier C (2003) The plant multidrug resistance ABC transporter AtMRP5 is involved in guard cell hormonal signalling and water use. Plant J 33: 119–129[Medline]

Kobae Y, Sekino T, Yoshioka H, Nakagawa T, Martinoia E, Maeshima M (2006) Loss of AtPDR8, a plasma membrane ABC transporter of Arabidopsis thaliana, causes hypersensitive cell death upon pathogen infection. Plant Cell Physiol 47: 309–318[Abstract/Free Full Text]

Larsson C, Sommarin M, Widell S (1994) Isolation of highly purified plant plasma membranes and the separation of inside-out and right-side-out vesicles. Methods Enzymol 228: 451–469

Lee M, Lee K, Lee J, Noh EW, Lee Y (2005) AtPDR12 contributes to lead resistance in Arabidopsis. Plant Physiol 138: 827–836[Abstract/Free Full Text]

Lincoln C, Britton JH, Estelle M (1990) Growth and development of the axr1 mutants of Arabidopsis. Plant Cell 2: 1071–1080[Abstract/Free Full Text]

Lu YP, Li ZS, Drozdowicz YM, Hortensteiner S, Martinoia E, Rea PA (1998) AtMRP2, an Arabidopsis ATP binding cassette transporter able to transport glutathione S-conjugates and chlorophyll catabolites: functional comparisons with Atmrp1. Plant Cell 10: 267–282[Abstract/Free Full Text]

Lu YP, Li ZS, Rea PA (1997) AtMRP1 gene of Arabidopsis encodes a glutathione S-conjugate pump: isolation and functional definition of a plant ATP-binding cassette transporter gene. Proc Natl Acad Sci USA 94: 8243–8248[Abstract/Free Full Text]

Marchant A, Kargul J, May ST, Muller P, Delbarre A, Perrot-Rechenmann C, Bennett MJ (1999) AUX1 regulates root gravitropism in Arabidopsis by facilitating auxin uptake within root apical tissues. EMBO J 18: 2066–2073[CrossRef][ISI][Medline]

Martinoia E, Klein M, Geisler M, Bovet L, Forestier C, Kolukisaoglu U, Muller-Rober B, Schulz B (2002) Multifunctionality of plant ABC transporters—more than just detoxifiers. Planta 214: 345–355[CrossRef][ISI][Medline]

Mentewab A, Stewart CN Jr (2005) Overexpression of an Arabidopsis thaliana ABC transporter confers kanamycin resistance to transgenic plants. Nat Biotechnol 23: 1177–1180[CrossRef][ISI][Medline]

Morris DA, Friml J, Zazimalova E (2004) Auxin transport. In PJ Davies, ed, Plant Hormones: Biosynthesis, Signal Transduction, Action! Kluwer Academic Publishers, Dordrecht, The Netherlands, pp 437–470

Multani DS, Briggs SP, Chamberlin MA, Blakeslee JJ, Murphy AS, Johal GS (2003) Loss of an MDR transporter in compact stalks of maize br2 and sorghum dw3 mutants. Science 302: 81–84[Abstract/Free Full Text]

Noh B, Murphy AS, Spalding EP (2001) Multidrug resistance-like genes of Arabidopsis required for auxin transport and auxin-mediated development. Plant Cell 13: 2441–2454[Abstract/Free Full Text]

Oono Y, Chen QG, Overvoorde PJ, Kohler C, Theologis A (1998) Age mutants of Arabidopsis exhibit altered auxin-regulated gene expression. Plant Cell 10: 1649–1662[Abstract/Free Full Text]

Quint M, Ito H, Zhang W, Gray WM (2005) Characterization of a novel temperature-sensitive allele of the CUL1/AXR6 subunit of SCF ubiquitin-ligases. Plant J 43: 371–383[CrossRef][ISI][Medline]

Sanchez-Fernandez R, Davies TG, Coleman JO, Rea PA (2001) The Arabidopsis thaliana ABC protein superfamily, a complete inventory. J Biol Chem 276: 30231–30244[Abstract/Free Full Text]

Santelia D, Vincenzetti V, Azzarello E, Bovet L, Fukao Y, Duchtig P, Mancuso S, Martinoia E, Geisler M (2005) MDR-like ABC transporter AtPGP4 is involved in auxin-mediated lateral root and root hair development. FEBS Lett 579: 5399–5406[CrossRef][ISI][Medline]

Schulz B, Kolukisaoglu HU (2006) Genomics of plant ABC transporters: the alphabet of photosynthetic life forms or just holes in membranes? FEBS Lett 580: 1010–1016[Medline]

Stein M, Dittgen J, Sanchez-Rodriguez C, Hou BH, Molina A, Schulze-Lefert P, Lipka V, Somerville S (2006) Arabidopsis PEN3/PDR8, an ATP binding cassette transporter, contributes to nonhost resistance to inappropriate pathogens that enter by direct penetration. Plant Cell 18: 731–746[Abstract/Free Full Text]

Stomp A-M (1991) Histochemical localization of beta-glucuronidase. In SR Gallagher, ed, GUS Protocols. Academic Press, London, pp 103–113

Stukkens Y, Bultreys A, Grec S, Trombik T, Vanham D, Boutry M (2005) NpPDR1, a pleiotropic drug resistance-type ATP-binding cassette transporter from Nicotiana plumbaginifolia, plays a major role in plant pathogen defense. Plant Physiol 139: 341–352[Abstract/Free Full Text]

Teixeira MC, Sa-Correia I (2002) Saccharomyces cerevisiae resistance to chlorinated phenoxyacetic acid herbicides involves Pdr1p-mediated transcriptional activation of TPO1 and PDR5 genes. Biochem Biophys Res Commun 292: 530–537[CrossRef][ISI][Medline]

Terasaka K, Blakeslee JJ, Titapiwatanakun B, Peer WA, Bandyopadhyay A, Makam SN, Lee OR, Richards EL, Murphy AS, Sato F, et al (2005) PGP4, an ATP binding cassette P-glycoprotein, catalyzes auxin transport in Arabidopsis thaliana roots. Plant Cell 17: 2922–2939[Abstract/Free Full Text]

Theodoulou FL (2000) Plant ABC transporters. Biochim Biophys Acta 1465: 79–103[Medline]

Tommasini R, Vogt E, Fromenteau M, Hortensteiner S, Matile P, Amrhein N, Martinoia E (1998) An ABC-transporter of Arabidopsis thaliana has both glutathione-conjugate and chlorophyll catabolite transport activity. Plant J 13: 773–780[CrossRef][ISI][Medline]

Ulmasov T, Murfett J, Hagen G, Guilfoyle TJ (1997) Aux/IAA proteins repress expression of reporter genes containing natural and highly active synthetic auxin response elements. Plant Cell 9: 1963–1971[Abstract]

van den Brule S, Muller A, Fleming AJ, Smart CC (2002) The ABC transporter SpTUR2 confers resistance to the antifungal diterpene sclareol. Plant J 30: 649–662[CrossRef][ISI][Medline]

van den Brule S, Smart CC (2002) The plant PDR family of ABC transporters. Planta 216: 95–106[CrossRef][ISI][Medline]

Walker JE, Saraste M, Runswick MJ, Gay NJ (1982) Distantly related sequences in the alpha- and beta-subunits of ATP synthase, myosin, kinases and other ATP-requiring enzymes and a common nucleotide binding fold. EMBO J 1: 945–951[ISI][Medline]

Walker TS, Bais HP, Halligan KM, Stermitz FR, Vivanco JM (2003) Metabolic profiling of root exudates of Arabidopsis thaliana. J Agric Food Chem 51: 2548–2554[CrossRef][ISI][Medline]

Windsor B, Roux SJ, Lloyd A (2003) Multiherbicide tolerance conferred by AtPgp1 and apyrase overexpression in Arabidopsis thaliana. Nat Biotechnol 21: 428–433[CrossRef][ISI][Medline]

Woodward AW, Bartel B (2005) Auxin: regulation, action, and interaction. Ann Bot (Lond) 95: 707–735[Abstract/Free Full Text]

Zimmermann P, Hirsch-Hoffmann M, Hennig L, Gruissem W (2004) GENEVESTIGATOR: Arabidopsis microarray database and analysis toolbox. Plant Physiol 136: 2621–2632[Abstract/Free Full Text]




This article has been cited by other articles: