|
|
||||||||
|
First published online September 8, 2006; 10.1104/pp.106.083030 Plant Physiology 142:1027-1038 (2006) © 2006 American Society of Plant Biologists Consistency of Polyamine Profiles and Expression of Arginine Decarboxylase in Mitosis during Zygotic Embryogenesis of Scots Pine1Department of Biology (J.V., A.J., M.S., R.M., S.S., H.H.) and Department of Mathematical Sciences/Statistics (E.L.), University of Oulu, 90014 Oulu, Finland; Unitat de Fisiologia Vegetal, Facultat de Farmàcia, Universitat de Barcelona, 08028 Barcelona, Spain (T.A.); and Finnish Forest Research Institute, Parkano Research Unit, 39700 Parkano, Finland (T.S.)
In this study, we show that both arginine decarboxylase (ADC) protein and mRNA transcript are present at different phases of mitosis in Scots pine (Pinus sylvestris) zygotic embryogenesis. We also examined the consistency of polyamine (PA) profiles with the effective temperature sum, the latter indicating the developmental stage of the embryos. PA metabolism was analyzed by fitting statistical regression models to the data of free and soluble conjugated PAs, to the enzyme activities of ADC and ornithine decarboxylase (ODC), as well as to the gene expression of ADC. According to the fitted models, PAs typically had the tendency to increase at the early stages but decrease at the late stages of embryogenesis. Only the free putrescine fraction remained stable during embryo development. The PA biosynthesis strongly preferred the ADC pathway. Both ADC gene expression and ADC enzyme activity were substantially higher than putative ODC gene expression or ODC enzyme activity, respectively. ADC gene expression and enzyme activity increased during embryogenesis, which suggests the involvement of transcriptional regulation in the expression of ADC. Both ADC mRNA and ADC protein localized in dividing cells of embryo meristems and more specifically within the mitotic spindle apparatus and close to the chromosomes, respectively. The results suggest the essential role of ADC in the mitosis of plant cells.
The polyamines (PAs), found in bacteria, fungi, animals, and plants, are evolutionary ancient small polycations that are implicated in various physiological and developmental processes. In higher plants, these processes include stimulation of cell division, response to environmental stresses and regulation of rhizogenesis, embryogenesis, senescence, floral development, and fruit ripening (Kakkar and Sawhney, 2002
Diamine putrescine (Put) and triamine spermidine (Spd) are present in most organisms, but tetra-amine spermine (Spm) is predominantly found in eukaryotes (Cohen, 1998
Different physiological roles have been proposed for ADC and ODC because their production in plants is often tissue specific and developmentally regulated (Kumar et al., 1997
The importance of PAs in embryogenesis has been documented in many angiosperm species (Lin et al., 1984
Zygotic Embryo Development and Effective Temperature Sum
In gymnosperms including Scots pine, the time of fertilization and, consequently, embryo development are known to vary between years in the same locality according to the effective temperature sum (d.d.; i.e. the heat sum unit based on the daily mean temperatures minus the adapted +5°C base temperature; Sarvas, 1962 The anatomical preparates of the developing embryos from the year 2003 indicate the following developmental pattern. On sampling date I, when the effective temperature sum was approximately 500 d.d., around 50% of the embryos were still at the proembryogeny stage and 50% at the early embryogeny stage. On sampling dates II and III, when the effective temperature sum was between 600 and 700 d.d., nearly 100% of the embryos were at the early embryogeny stage. On sampling date IV, when the effective temperature sum was over 800 d.d., approximately 85% of the embryos had reached the late embryogeny stage while the remaining 15% were still at the early embryogeny stage. In Figure 1 , both early embryos from sampling dates II (Fig. 1A) and III (Fig. 1F) and late embryos from sampling date IV (Fig. 1, BD) have been presented.
Changes in PA Content during Zygotic Embryo Development By presenting PA concentrations as quadratic (second-order polynomial) functions of the effective temperature sum, we were able to combine results from different clones, years, and PA fractions to the same regression model and to show that the PA concentrations followed consistent profiles, at least for Spd and Spm (Fig. 2 ; Table I ).
The free Put content was not observed to change during the study period apart from clone K884 in 2001, when we found a slightly increasing trend (Fig. 2, top, left side). The latter exception to the rule was supported by the estimated value [+26.4 nmol g1 (100 d.d.)1] of the interaction term C x V x T1 between clone, year, and the linear term of effective temperature sum being larger than its error margin [EM; 95% EM 22.5 nmol g1 (100 d.d.)1; Table I]. The observation of no trend elsewhere in the free Put was consistent with the estimates and EMs for the main effects of effective temperature sum T1 (slope) and T2 (curvature), and with those of the interaction effects C x T1 and C x T2 between clone and effective temperature sum, as well as interactions V x T1 and V x T2 between year and effective temperature sum, in which the estimates were all well within their EMs. In clone K884, the free Put observations on sampling date II were excluded from statistical analysis due to the wide scattering of the observations. The soluble conjugated fraction of the Put appeared in both clones to increase at the beginning of embryo development and to decrease during embryo maturation (Fig. 2, top, right side). However, the results on relevant interaction terms F x T1 and F x T2 were not sufficiently supportive about this for clone K818, whereas for clone K884 strong evidence for this observed pattern was provided by the estimates and EMs of the interaction effects F x C x T1 and F x C x T2. The insoluble conjugated Put fraction was considerable and maximally contained nearly 35% of the total Put in the sample, but there was no trend in the insoluble conjugated Put content (data not shown). Spd was the most abundant PA during Scots pine zygotic embryogenesis. Both free and soluble conjugated Spd increased at the beginning of embryo development, reached their maximum when the effective temperature sum was between 600 and 750 d.d., and decreased thereafter (Fig. 2, middle). There was somewhat more random fluctuation in 2001 than in 2003 and more fluctuation in clone K818 than in clone K884. The main quadratic effect of T2 [estimate 35.7, 95% EM 28.0, both in nmol g1 (100 d.d.)1; Table I] conveyed strong evidence for the observed downward curvature in the PA concentrations by the effective temperature sum together with the "nonsignificance" of the main linear effect T1. This observation was qualitatively consistent for both the free and the soluble conjugated forms over the 2 years and in the two clones, as can be judged from the result for all the interaction terms involving T1 and T2, the estimates of these being all within their EMs (Table I). The insoluble conjugated Spd fraction always contained less than 11% of the total Spd fraction in the sample (data not shown). Both the free and the soluble conjugated forms of Spm fluctuated in a consistent way in the two pine clones (Fig. 2, bottom). The concentrations appeared to increase typically when the level of the effective temperature sum was 500 d.d. until it was around 700 d.d., after which the concentrations started to go down. There was convincing evidence for the observed overall downward curvature provided by the fitted regression model, in which the main linear and quadratic terms of effective temperature sums [T1: estimate 19.6, 95% EM 12.4; T2: estimate 24.4, 95% EM 11.0; all values in nmol g1 (100 d.d.)1; Table I] were well supporting the observed pattern, and none of the estimated interaction terms involving T1 and T2 modified this appreciably. The content of insoluble conjugated Spm was very low or under the HPLC detection level in most samples.
ADC gene expression and ADC enzyme activity were clearly preferred compared to putative ODC gene expression and ODC enzyme activity, respectively. This suggests that the ADC pathway is the main route to produce Put in developing zygotic embryos. Relative ADC gene expression showed an increasing trend over time and by the effective temperature sum in both of the clones on the double logarithmic scale. The slope appeared steeper in clone K818 (slope 4.7, 95% EM 0.80) than in K884 (slope 3.3, 95% EM 0.75; Fig. 3 ). An ascending trend was also evident in ADC gene expression during embryo development, when the gene expression was normalized by another housekeeping gene, glyceraldehyde-3-phosphate dehydrogenase (data not shown). The mRNA levels of the putative ODC gene were very low. The fluorescence signal showed up after 35 cycles in real-time reverse transcription (RT)-PCR and therefore could not be reliably distinguished from spurious background.
ADC enzyme activity seemed to increase in both clones during early embryo development, when the effective temperature sum rose from 500 to 600 d.d. Thereafter, the activity still seemed to increase in clone K884 but not in K818 (Fig. 4 ). The evidence for an increasing trend was weak and for curvature even weaker, though, as reflected by the estimate to EM ratio of the linear and quadratic terms T1 and T2 (Table II ). Also, the results on interaction terms C x T1 and C x T2 did not provide sufficient basis to conclude that the slope and curvature were different for the two clones.
ODC enzyme activity showed a decreasing trend with downward curvature in clone K818 throughout the sampling period, as suggested by the estimated values 0.76 (95% EM 0.25) of the linear term T1 and 0.36 (95% EM 0.27) of the quadratic term T2. In clone K884, ODC enzyme activity was initially lower and decreased further during the early developmental stages of the embryos, when the effective temperature sum was between 500 and 600 d.d., after which it remained at that level (Fig. 4). The estimated coefficients and EMs for the C x T1 and C x T2 interactions supported the existence of a less steep overall slope but an upward curvature for clone K884 than for K818 (Table II). ADC and ODC activities were also measured in pellets, in which the enzyme activities were clearly lower than in supernatants but no trend could be detected (data not shown).
ADC gene expression was localized in the dominant embryo at the early embryogeny stage and also in two subordinate embryos (Fig. 1A). In late embryos, ADC expression was found to be located in the regions undergoing cell division, especially in the shoot apical and axillary meristems, but also in the dividing cells of the root meristem (Fig. 1, BD). The ADC probe specificity was confirmed by the absence of signals in the sections hybridized with the sense ADC probe (Fig. 1, E and L). The transcripts of a putative ODC gene were not detected in embryos (Fig. 1F). ADC gene expression occurred during mitosis and was found in cells throughout the mitotic stages (Fig. 1, GK). In early prophase, when chromatids became visible in the nucleus, ADC expression was located in the cytoplasm (Fig. 1G). In late prophase and metaphase, ADC transcripts were also in the cytoplasmic region (Fig. 1, H and I), but in anaphase and telophase cells ADC transcripts clearly accumulated within the area of the mitotic spindle apparatus (Fig. 1, J and K). The immunocytochemical localization showed the presence of ADC protein in the nuclei of late embryos (Fig. 1, M and N). High level of ADC protein was detected especially in mitotic cells, but, in contrast to ADC transcripts, ADC protein was found to locate close to the chromosomes and not within the mitotic spindle as the mRNA (Fig. 1, O and P). No positive signal was found in the control sections incubated with preimmune serum (Fig. 1Q).
PA Concentrations Show Consistent Profiles during Zygotic Embryogenesis
In this study, we found high PA concentrations in developing zygotic embryos of Scots pine, in accordance with the high PA contents reported in tissues undergoing rapid cell division, active metabolism, and somatic embryogenesis (Egea-Cortines and Mizrahi, 1991
The zygotic embryo development of Scots pine takes 2 years. Generally, wind pollination occurs at the beginning of the growing season, late May or early June in Scandinavia, after which the pollen tube germination gradually ceases to be continued during the following growing season about 1 year later. Fertilization occurs usually at late June or early July, depending on the effective temperature sum (Sarvas, 1962
In this study, both ADC gene expression at the mRNA transcript level and the activity of ADC enzyme were detected in developing zygotic embryos. The higher rate of ADC activity compared to ODC was prominent, which is in agreement with the reports of somatic embryo development in Picea rubens Sarg. (Minocha et al., 1996
In this work, ADC gene expression and ADC enzyme activity showed a steady increase throughout the embryo development. This might be due to the increasingly important role of the more developed embryo in PA metabolism compared to the senescing megagametophyte. We found that ADC expression increased during embryo development at both the mRNA and the enzyme activity levels. This suggests an involvement of transcriptional regulation in ADC gene expression but does not rule out posttranscriptional regulation of the gene. ADC mRNA has been found to accumulate under various stress conditions in Oryza sativa (Chattopadhyay et al., 1997
In this study, we were able to localize ADC gene expression and ADC protein specifically in the mitotic cells of developing zygotic embryos. There is evidence that PAs are involved in the regulation of cell division in animals (Bello-Fernandez et al., 1993
ADC mRNAs, in this study, were located within the mitotic spindle apparatus of dividing cells, whereas ADC protein was close to the chromosomes. This may suggest that the transport of ADC mRNA during mitosis is mediated by microtubules and that ADC mRNA is translationally repressed while en route. Studies in Drosophila melanogaster Meigen and Xenopus laevis Daudin embryos, as well as neurons, have implicated microtubules in localizing mRNA (Nasmyth and Jansen, 1997
ADC mRNA and ADC protein seem to take place particularly at the mitotic phase of the cell cycle, when most protein synthesis is inhibited. Pyronnet et al. (2000)
In this study, we report PA metabolism to follow yearly consistent profiles during zygotic embryo development in Scots pine. There is typically an increasing trend in PA concentrations at the early developmental stages and a decreasing trend during late embryo development, except in the case of the free Put fraction, which remains relatively stable throughout the embryo development. Our results show that the ADC pathway is the main PA route and that ADC expression is regulated, at least in part, at the mRNA level. We also show that ADC gene expression and ADC protein are present specifically in mitotic cells of embryo meristems, suggesting the essential role of ADC in the mitosis of plant cells.
Collection of Immature Seeds During the growing seasons 2001 and 2003, 1-year-old immature seed cones were collected from two open-pollinated elite Scots pine (Pinus sylvestris) clones, K818 and K884, growing in the Scots pine clone collection in Punkaharju, Finland (61°48' N; 29°17' E). In both years, the same grafts, one per pine clone, were used to collect the cones. The cone collection was repeated four times in July throughout the period of embryo development. In 2001 cones were collected on July 9 (sampling date I), July 16 (sampling date II), July 23 (sampling date III), and July 30 (sampling date IV), and in 2003 cones were collected on July 8 (sampling date I), July 15 (sampling date II), July 22 (sampling date III), and July 29 (sampling date IV). Immature zygotic embryos surrounded by the immature megagametophyte, called zygotic embryos, were dissected from the developing cones and fixed immediately for the microscopic examination as described below. Dissected zygotic embryos for PA analysis, enzyme analysis, and real-time RT-PCR were stored at 80°C until use.
Developing embryos were fixed for study of the anatomical features of the embryos, for in situ hybridization and for immunolocalization. For all these purposes, the following protocol from fixation to coverslip mounting was used. The tissues were fixed in 4% (w/v) p-formaldehyde in 1x phosphate-buffered saline (PBS) buffer (10 mM phosphate, 150 mM NaCl, pH 7.4). After dehydration with a graded series of ethanol, ethanol was replaced by tertiary butanol and then gradually by paraffin. Sections (5 and 7 µm) were cut from the embedded samples with a microtome, mounted on SuperFrostPlus slides (Menzel-Glaser), and fixed by drying overnight at 40°C.
To study the developmental stage of the embryos, the preparates were stained with toluidine blue (0.05% toluidine blue in water) and the sections were examined under a light microscope. In 2003 the developmental stage was specified from six to 15 embryos per sampling date, totaling 85 embryos. The sequence of embryo development was divided into three phases according to Singh (1978)
In addition to the free PAs, soluble and insoluble conjugated PAs were also examined. Four samples per sampling date and each sample consisting of 250 mg of embryos were extracted in 5% (w/v) perchloric acid. Crude extract for free PAs, hydrolyzed supernatant for perchloric acid-soluble conjugated PAs, and hydrolyzed pellet for perchloric acid-insoluble conjugated PAs were dansylated and separated by HPLC according to Sarjala and Kaunisto (1993)
The proteins of Scots pine zygotic embryos were extracted for enzyme activity measurements from one to four independent samples per sampling date. Embryos (400 mg fresh weight) were homogenized in an ice-cold mortar with liquid nitrogen and dissolved in 4 mL of extraction buffer containing 50 mM Tris-HCl, pH 8.4, 0.5 mM pyridoxal-5-phosphate, 0.1 mM EDTA, and 5.0 mM dithiothreitol. The solution was centrifuged at 15,500g for 20 min at +4°C, and the supernatant as well as the pellet resuspended with 4 mL of extraction buffer were used for both ADC and ODC enzyme assays according to Minocha et al. (1999a)
The primers 5'-AGAAATTGGGGATGCTGGAT-3' and 5'-GCCATCACGATTGTATTCACC-3' were designed to amplify a 466-bp fragment of the Scots pine ADC gene (AF306451). For amplifying a 420-bp fragment of a putative ODC gene, the primers 5'-AAGCGGTGAAGCCATTAAAA-3' and 5'-TTGCGTTGCAGACGTATTTC-3' were used. The primers for ODC were designed using GenBank Pinus taeda EST sequence CO176452. The selection of a putative ODC sequence was based on similarity at amino acid level with the ODC genes isolated from other plant species. The designing of the ACT primers 5'- GCTTGCTTATGTAGCCCTTGA-3' and 5'-GGTCTTGGCAATCCACATCT-3' was based on the Pinus contorta Dougl. ex Loud. actin (ACT) gene sequence M36171. The ACT primers were designed to contain an intron in the sequence between the primers to reveal possible genomic DNA contamination. The functioning of ACT primers and the primer pair against Scots pine glyceraldehyde-3-phosphate dehydrogenase sequence (L07501) was shown in Jaakola et al. (2004)
The total RNA of Scots pine zygotic embryos was extracted for the gene expression studies date as described in our previous paper (Vuosku et al., 2004
The quantification of mRNA was done with real-time PCR. A first-strand cDNA template was synthesized from 3 µg of total RNA as described above. Three independent cDNA preparations were made for every sampling date, and every PCR reaction was done in duplicate to control for the variability of PCR amplification. The real-time PCR was performed in 50 µL of reaction mixture composed of 2 µL of cDNA, Brilliant SYBR Green QPCR Master Mix, and 150 nM gene-specific primers using the Mx3000P real-time PCR system (Stratagene). PCR amplification was initiated by incubation at 95°C for 10 min followed by 40 cycles: 30 s at 95°C, 1 min at 58°C, and 1 min at 72°C. The PCR conditions were optimized for high amplification efficiency >95% for all primer pairs used. ADC and ODC gene expressions were normalized by nonregulated reference gene expression derived from the housekeeping gene ACT. Q-Gene software (Muller et al., 2002
To prepare RNA probes, we used a PCR-based technique, in which a T7 polymerase promoter sequence (TAATACGACTCACTATAGGG) was introduced at the 5' ends of the gene-specific primers (Young et al., 1991
The sections for in situ hybridization were done as described above. In situ hybridization was done according to Mähönen et al. (2000)
The IgGs obtained against the tobacco (Nicotiana tabacum) ADC protein (Bortolotti et al., 2004
The PA concentrations were analyzed by normal linear regression models in which T (effective temperature sum) was the main explanatory variable. C (clone; values 0 = K818, 1 = K884), F (fraction; 0 = free, 1 = soluble conjugated), and V (year; 1 = 2001, 0 = 2003) were binary covariates. A second-order polynomial curve for the response was assumed, including both T1 = the centered and scaled linear term (original values minus the overall mean value divided by 100) and T2 = the quadratic (square of T1) term of the effective temperature sum. Interactions between both terms of effective temperature sum with the three binary factors were allowed for by including appropriate product terms in the model. The development of ADC gene expression as a function of effective temperature sum in 2003 was analyzed by fitting a regression line through the origin for the logarithm of relative expression as a linear function of the logarithm of effective temperature sum (LET). The slopes were estimated for both clones separately, and the common slope assumption was evaluated by the appropriate interaction term C x LET. ADC and ODC enzyme activities by effective temperature sum in 2003 were analyzed by linear mixed regression models. Here, the natural logarithm of the enzyme activity measurement was taken as the response variable. As in the above PA models, the linear and quadratic terms T1 and T2 of effective temperature sum were the interesting quantitative covariates, and C = clone was a binary covariate. The interactions of effective temperature sum terms with clone were also included in the models. In addition, the variability of the response over the separate isolation runs performed at each measurement occasion was allowed for by including an appropriate random effect term. The PA models and the gene expression models were fitted using function lm() and the models for the enzyme activities by function lme() in the R statistical environment (http://www.r-project.org/). Assessment of the model assumptions were based on an informal inspection of the four diagnostic graphs provided by the default plot methods for the fitted model objects. The results were tabulated by giving the point estimates and the 95% EMs for the coefficients in each model, so that estimate ± EM provides the 95% confidence interval for the coefficient. The estimate to EM ratio multiplied by 2 can be used as an approximate t statistic to perform a test of significance for any coefficient of interest, but, in light of recent recommendations, we prefer to avoid explicit reporting of P values.
We thank Dr. Anneli Kauppi, Dr. Antti Pajunen, and Dr. Marja Nissinen from the University of Oulu, Dr. Eila Tillman-Sutela from the Finnish Forest Research Institute, Dr. Alexandra C. Baumgartner from the University of Göttingen, and MA Merja Lappalainen for help, enthusiasm, and interest during the work. We are also grateful to Ms. Eeva Pihlajaviita, Finnish Forest Research Institute, for technical help, and to the personnel of the Finnish Forest Research Institute at Punkaharju Research Unit for conducting the collections of the research material. Received May 7, 2006; accepted September 5, 2006; published September 8, 2006.
1 This work was supported by the Academy of Finland (project no. 53440 to T.S.). The author responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors (www.plantphysiol.org) is: Hely Häggman (hely.haggman{at}oulu.fi). www.plantphysiol.org/cgi/doi/10.1104/pp.106.083030 * Corresponding author; e-mail jaana.vuosku{at}oulu.fi; fax 35885531061.
Acosta C, Pérez-Amador MA, Carbonell J, Granell A (2005) The two ways to produce putrescine in tomato are cell-specific during normal development. Plant Sci 168: 10531057[CrossRef][Web of Science] Bagni N, Tassoni A (2001) Biosynthesis, oxidation and conjugation of aliphatic polyamines in higher plants. Amino Acids 20: 301317[CrossRef][Web of Science][Medline] Bello-Fernandez C, Packham G, Cleveland JL (1993) The ornithine decarboxylase gene is a transcriptional target of c-Myc. Proc Natl Acad Sci USA 90: 78047808 Belmont AS, Braunfeld MB, Sedat JW, Agard DA (1989) Large-scale chromatin structural domains within mitotic and interphase chromosomes in vivo and in vitro. Chromosoma 98: 129143[CrossRef][Web of Science][Medline] Borrell A, Besford RT, Altabella T, Masgrau C, Tiburcio AF (1996) Regulation of arginine decarboxylase by spermine in osmotically-stressed oat leaves. Physiol Plant 98: 105110 Bortolotti C, Cordeiro A, Alcázar R, Borrell A, Culiañez-Maciá FA, Tiburcio AF, Altabella T (2004) Localization of arginine decarboxylase in tobacco plants. Physiol Plant 120: 8492[CrossRef][Medline] Bouchereau A, Aziz A, Larher F, Martin-Tanguy J (1999) Polyamines and environmental challenges: recent development. Plant Sci 140: 103125[CrossRef][Web of Science] Chattopadhyay MK, Gupta S, Sengupta DN, Ghosh B (1997) Expression of arginine decarboxylase in seedlings of indica rice (Oryza sativa L.) cultivars affected by salinity stress. Plant Mol Biol 34: 477483[CrossRef][Web of Science][Medline] Childs AC, Mehta DJ, Gerner EW (2003) Polyamine-dependent gene expression. Cell Mol Life Sci 60: 13941406[CrossRef][Web of Science][Medline] Cohen E, Arad SM, Heimer YH, Mizrahi Y (1984) Polyamine biosynthetic enzymes in the cell cycle of Chlorella. Plant Physiol 74: 385388 Cohen S (1998) A Guide to the Polyamines. University Press, Oxford Coleman CS, Hu G, Pegg A (2004) Putrescine biosynthesis in mammalian tissues. Biochem J 379: 849855[CrossRef][Web of Science][Medline] Delis C, Dimou M, Efrose RC, Flemetakis E, Aivalakis G, Katinakis P (2005) Ornithine decarboxylase and arginine decarboxylase gene transcripts are co-localized in developing tissues of Glycine max etiolated seedlings. Plant Physiol Biochem 43: 1925[CrossRef][Web of Science][Medline] Dewitte W, Murray JAH (2003) The plant cell cycle. Annu Rev Plant Biol 54: 235264[CrossRef][Medline] Egea-Cortines M, Mizrahi Y (1991) Polyamines in cell division, fruit set and development, and seed germination. In RD Slocum, HE Flores, eds, Biochemistry and Physiology of Polyamines in Plants. CRC Press, Boca Raton, FL, pp 143158 Flores HE (1991) Changes in polyamine metabolism in response to abiotic stress. In RD Slocum, HE Flores, eds, Biochemistry and Physiology of Polyamines in Plants. CRC Press, Boca Raton, FL, pp 213225 Fornalé S, Sarjala T, Bagni N (1999) Endogenous polyamine content and metabolism in the ectomycorrhizal fungus Paxillus involutus. New Phytol 143: 581587[CrossRef][Web of Science] Galston AW, Sawhney RK (1990) Polyamines in plant physiology. Plant Physiol 94: 406410 Gavis ER, Lehmann R (1994) Translational regulation of nanos by RNA localization. Nature 369: 315318[CrossRef][Medline] Ge C, Cui X, Wang Y, Hu Y, Fu Z, Zhang D, Cheng Z, Li J (2006) BUD2, encoding an S-adenosylmethionine decarboxylase, is required for Arabidopsis growth and development. Cell Res 16: 446456[CrossRef][Web of Science][Medline] Hanfrey C, Sommer S, Mayer MJ, Burtin D, Michael AJ (2001) Arabidopsis polyamine biosynthesis: absence of ornithine decarboxylase and the mechanism of arginine decarboxylase activity. Plant J 27: 551560[CrossRef][Web of Science][Medline] Hao YJ, Kitashiba H, Honda C, Nada K, Moriguchi T (2005) Expression of arginine decarboxylase genes in apple cells and stressed shoots. J Exp Bot 56: 11051115 Imai A, Matsuyama T, Hanzawa Y, Akiyama T, Tamaoki M, Saji H, Shirano Y, Kato T, Hayashi H, Shibata D, et al (2004) Spermidine synthase genes are essential for survival of Arabidopsis. Plant Physiol 135: 15651573 Jaakola L, Pirttilä AM, Vuosku J, Hohtola A (2004) Method based on electrophoresis and gel extraction for obtaining genomic DNA-free cDNA without DNase treatment. Biotechniques 37: 744748[Web of Science][Medline] Jeffery WB, Tomlinson CR, Brodeur RD (1983) Localization of actin messenger RNA during early ascidian development. Dev Biol 99: 408417[CrossRef][Web of Science][Medline] Kakkar RK, Sawhney VK (2002) Polyamine research in plantsa changing perspective. Physiol Plant 116: 281292[CrossRef] Kaur-Sawhney R, Flores HE, Galston AW (1980) Polyamine-induced DNA synthesis and mitosis in oat leaf protoplasts. Plant Physiol 65: 368371 Kindler S, Wang H, Richter D, Tiedge H (2005) RNA transport and local control of translation. Annu Rev Cell Dev Biol 21: 223245[CrossRef][Web of Science][Medline] Krasowski MJ, Owens JN (1993) Ultrastructural and histochemical postfertilization megagametophyte and zygotic embryo development of white spruce (Picea glauca) emphasizing the deposition of seed storage products. Can J Bot 71: 98112 Kumar A, Altabella T, Taylor MA, Tiburcio AF (1997) Recent advances in plant polyamine research. Trends Plant Sci 2: 124130[CrossRef][Web of Science] Lin PPC, Egli DB, Li GM, Meckel L (1984) Polyamine titer in the embryonic axis and cotyledons of Glycine max (L.) during seed growth and maturation. Plant Physiol 76: 366371 Mähönen AP, Bonke M, Kauppinen L, Riikonen M, Benfey PN, Helariutta Y (2000) A novel two-component hybrid molecule regulates vascular morphogenesis of the Arabidopsis root. Genes Dev 14: 29382943 Malmberg RL, Cellino ML (1994) Arginine decarboxylase of oats is activated by enzymatic cleavage into two polypeptides. J Biol Chem 28: 27032706 Martin-Tanguy J (1997) Conjugated polyamines and reproductive development: biochemical, molecular and physiological approaches. Physiol Plant 100: 675688 Minocha R, Long S, Maki H, Minocha SC (1999a) Assays for the activities of polyamine biosynthetic enzymes using intact tissues. Plant Physiol Biochem 37: 597603[CrossRef] Minocha R, Shortle WC, Coughlin DJ, Minocha SC (1996) Effects of aluminum on growth, polyamine metabolism, and inorganic ions in suspension cultures of red spruce (Picea rubens). Can J For Res 26: 550559 Minocha R, Smith DR, Reeves C, Steele K, Minocha S (1999b) Polyamine levels during the development of zygotic and somatic embryos of Pinus radiata. Physiol Plant 105: 155164 Minocha SC, Minocha R (1995) Role of polyamines in somatic embryogenesis. In YPS Bajaj, ed, Biotechnology in Agriculture and Forestry, Vol 30: Somatic Embryogenesis and Synthetic Seed I. Springer-Verlag, Heidelberg, pp 5572 Mo H, Pua EC (2002) Up-regulation of arginine decarboxylase gene expression and accumulation of polyamines in mustard (Brassica juncea) in response to stress. Physiol Plant 114: 439449[CrossRef][Medline] Muller PY, Janovjak H, Miserez AR, Dobbie Z (2002) Processing of gene expression data generated by quantitative real-time RT-PCR. Biotechniques 32: 13721379[Web of Science][Medline] Nam KH, Lee SH, Lee JH (1997) Differential expression of ADC mRNA during development and upon acid stress in soybean (Glycine max) hypocotyls. Plant Cell Physiol 38: 11561166 Nasmyth K, Jansen RP (1997) The cytoskeleton in mRNA localization and cell differentiation. Curr Opin Cell Biol 9: 396400[CrossRef][Web of Science][Medline] Niemi K, Sarjala T, Chen X, Häggman H (2002) Spermidine and methylglyoxal bis(guanylhydrazone) affect maturation and endogenous polyamine content of Scots pine embryogenic cultures. J Plant Physiol 159: 11551158[CrossRef] Oredsson SM (2003) Polyamine dependence of normal cell-cycle progression. Biochem Soc Trans 31: 366370[CrossRef][Web of Science][Medline] Owens JN, Øystein J, Dæhlen OG, Skrøppa T (2001) Potential effects of temperature on early reproductive development and progeny performance in Picea abies (L.) Karst. Scand J For Res 16: 221237 Paschalidis KA, Roubelakis-Angelakis KA (2005) Spatial and temporal distribution of polyamine levels and polyamine anabolism in different organs/tissues of the tobacco plant. Correlations with age, cell division/expansion, and differentiation. Plant Physiol 138: 142152 Pohjanpelto P, Knuutila S (1982) Polyamine deprivation causes major chromosomal alterations in polyamine-dependent Chinese hamster ovary cell line. Exp Cell Res 141: 333339[CrossRef][Web of Science][Medline] Pollard KJ, Samuels ML, Crowley KA, Hansen JC, Peterson CL (1999) Functional interaction between GCN5 and polyamines: a new role for core histone acetylation. EMBO J 18: 56225633[CrossRef][Web of Science][Medline] Pyronnet S, Pradayrol L, Sonenberg N (2000) A cell cycle-dependent internal ribosome entry site. Mol Cell 5: 607616[CrossRef][Web of Science][Medline] Santanen A, Simola LK (1992) Changes in polyamine metabolism during somatic embryogenesis in Picea abies. J Plant Physiol 140: 475480 Santanen A, Simola LK (1999) Metabolism of L[U-14C]-arginine and L[U-14C]-ornithine in maturating and vernalized embryos and megagametophytes of Picea abies. Physiol Plant 104: 433440 Sarjala T, Kaunisto S (1993) Needle polyamine concentrations and potassium nutrition in Scots pine. Tree Physiol 13: 8796 Sarjala T, Savonen EM (1994) Seasonal fluctuation in free polyamines in Scots pine needles. J Plant Physiol 144: 720725 Sarvas R (1962) Investigations on the flowering and seed crop of Pinus sylvestris. Commun Inst For Fenn 53: 1198 Schipper RG, Cuijpers VMJI, de Groot LHJM, Thio M, Verhofstad AAJ (2004) Intracellular localization of ornithine decarboxylase and its regulatory protein, antizyme-1. J Histochem Cytochem 52: 12591266 Serafini-Fracassini D (1991) Cell cycle-dependent changes in plant polyamine metabolism. In RD Slocum, HE Flores, eds, Biochemistry and Physiology of Polyamines in Plants. CRC Press, Boca Raton, FL, pp 159173 Simon P (2003) Q-gene: processing quantitative real-time RT-PCR data. Bioinformatics 19: 14391440 Singh H (1978) Embryology of Gymnosperms. Borntrager, Berlin Sirois L, Bégin Y, Parent J (1999) Female gametophyte and embryo development of black spruce along a shore-hinterland climatic gradient of a recently created reservoir, northern Quebec. Can J Bot 77: 6169[CrossRef] St Johnston D (1995) The intracellular localization of messenger RNAs. Cell 81: 161170[CrossRef][Web of Science][Medline] Tassoni A, van Buuren M, Franceschetti M, Fornalé S, Bagni N (2000) Polyamine content and metabolism in Arabidopsis thaliana and effect of spermidine on plant development. Plant Physiol Biochem 38: 383393[CrossRef][Web of Science] Theiss C, Bohley P, Voigt J (2002) Regulation by polyamines of ornithine decarboxylase activity and cell division in the unicellular green alga Chlamydomonas reinhardtii. Plant Physiol 128: 14701479 Tiburcio AF, Altabella T, Borrell A, Masgrau C (1997) Polyamine metabolism and its regulation. Physiol Plant 100: 664674[CrossRef] Urano K, Yoshiba Y, Nanjo T, Igarashi Y, Seki M, Sekiguchi F, Yamaguchi-Shinozaki K, Shinozaki K (2003) Characterization of Arabidopsis genes involved in biosynthesis of polyamines in abiotic stress responses and developmental stages. Plant Cell Environ 26: 19171926[CrossRef] Vuosku J, Jaakola L, Jokipii S, Karppinen K, Kämäräinen T, Pelkonen VP, Jokela A, Sarjala T, Hohtola A, Häggman H (2004) Does extraction of DNA and RNA by magnetic fishing work for diverse plant species? Mol Biotechnol 27: 209215[CrossRef][Web of Science][Medline] Watson MB, Malmberg RL (1996) Regulation of Arabidopsis thaliana (L.) Heynh. arginine decarboxylase by potassium deficiency stress. Plant Physiol 111: 10771083[Abstract] Yadav JS, Rajam MV (1998) Temporal regulation of somatic embryogenesis by adjusting cellular polyamine content in eggplant. Plant Physiol 116: 617625 Young IY, Ailles L, Deugau K, Kisilevsky R (1991) Transcription of cRNA for in situ hybridization from polymerase chain reaction-amplified DNA. Lab Invest 64: 709712[Web of Science][Medline] This article has been cited by other articles:
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ASPB Publications | PLANT PHYSIOLOGY® | THE PLANT CELL | |
|---|---|---|---|