| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
|
First published online September 29, 2006; 10.1104/pp.106.087056 Plant Physiology 142:1053-1064 (2006) © 2006 American Society of Plant Biologists The Cyclin-Dependent Kinase Inhibitor Orysa;KRP1 Plays an Important Role in Seed Development of Rice1,[W]Department of Plant Systems Biology, Flanders Interuniversity Institute for Biotechnology, Ghent University, B–9052 Ghent, Belgium (R.M.B., L.D.V., L.S.L.N., V.M., G.T.S.B., D.I.); and CropDesign NV, B–9052 Ghent, Belgium (A.P., A.-M.D., J.D.W., R.P., W.F.B., V.F.)
Kip-related proteins (KRPs) play a major role in the regulation of the plant cell cycle. We report the identification of five putative rice (Oryza sativa) proteins that share characteristic motifs with previously described plant KRPs. To investigate the function of KRPs in rice development, we generated transgenic plants overexpressing the Orysa;KRP1 gene. Phenotypic analysis revealed that overexpressed KRP1 reduced cell production during leaf development. The reduced cell production in the leaf meristem was partly compensated by an increased cell size, demonstrating the existence of a compensatory mechanism in monocot species by which growth rate is less reduced than cell production, through cell expansion. Furthermore, Orysa;KRP1 overexpression dramatically reduced seed filling. Sectioning through the overexpressed KRP1 seeds showed that KRP overproduction disturbed the production of endosperm cells. The decrease in the number of fully formed seeds was accompanied by a drop in the endoreduplication of endosperm cells, pointing toward a role of KRP1 in connecting endocycle with endosperm development. Also, spatial and temporal transcript detection in developing seeds suggests that Orysa;KRP1 plays an important role in the exit from the mitotic cell cycle during rice grain formation.
Cell division is controlled by the activity of cyclin (CYC)-dependent kinase (CDK) complexes. In addition to their association with CYCs, the activity of CDKs is also regulated by other mechanisms, including activation of CDKs through phosphorylation of Thr-161 by a CDK-activating kinase, inactivation of the CDK/CYC complex via phosphorylation of the Thr-14 and Tyr-15 residues by WEE1 kinase, and degradation of CYC subunits (for review, see De Veylder et al., 2003  ; Dewitte and Murray, 2003; Inzé, 2005). A further level of regulation of CDK activity involves the so-called CDK inhibitors (CKIs).
CKI proteins directly inhibit CDK activity by binding to the CDK/CYC complexes (Sherr and Roberts, 1999
In plants, all the CKI proteins that have been identified share a limited similarity to the mammalian p27Kip1 inhibitor. Therefore, plant CKIs are designated Kip-related proteins (KRPs; De Veylder et al., 2001
Targeted expression of the Arabidopsis ICK1/KRP1 was obtained with the trichome-specific GL2 (Schnittger et al., 2003
Additionally, transgenic plants have been generated that overexpress KRP genes by means of a constitutive promoter (Wang et al., 2000
In monocotyledonous plants, the structural and functional characteristics of KRPs are largely unknown. Recently, Coelho et al. (2005) Here, we report the identification of rice (Oryza sativa) KRP genes and the functional characterization of one of these. The phenotype of transgenic KRP1-overexpressing (KRP1OE) rice plants suggests the importance of KRPs for plant growth as well as a prominent role in seed development.
Identification of Rice KRP Genes and Characterization of Orysa;KRP1
To search for rice KRP members, we screened the rice genomic database for proteins containing highly conserved plant KRP hallmarks (GRYEW and KYNFD; De Veylder et al., 2001
Sequences of rice KRP1, KRP2, and KRP3 comprise nuclear localization signals (Fig. 1A), whereas KRP2 (amino acids 160–176) and KRP4 (amino acids 126–138) have a putative PEST domain. These two functional domains have been detected in some other plant KRPs as well (De Veylder et al., 2001 ; Jasinski et al., 2002). By phylogenetic analysis of plant KRPs, rice KRPs were found to form two groups: KRP1 is more closely related to KRP2 and KRP3, whereas KRP4 and KRP5 cluster in a separate group (Fig. 1B). Sequence analysis suggests that Orysa;KRP1 and Orysa;KRP2 are the two most closely related rice KRPs, sharing 51% identity at the amino acid level. Orysa;KRP4 shares high amino acid similarity to Zeama;KRP1, whereas Zeama;KRP2 clusters with Orysa;KRP2 and Orysa;KRP3. Overall, the phylogenetic analysis supports a separation of monocot KRPs into two different groups, whereas that between dicot members is less obvious.
For this study, we chose to characterize KRP1 in more detail. First, its sequence was verified by sequencing a full-length cDNA clone that was isolated from a rice cell suspension cDNA library using a PCR-amplified probe corresponding to a partial Orysa;KRP1 cDNA sequence. To investigate the possible role of Orysa;KRP1 in rice development, we generated transgenic plants overexpressing the gene under the control of the constitutive rice GOS2 promoter (de Pater et al., 1992
The vegetative growth of the rice plants overexpressing KRP1 was investigated. Total vegetative growth of the KRP1OE plants was recorded by digital image analysis on a weekly basis. The transgenic plants had slightly smaller leaf areas and were shorter than the controls in three out of the four lines analyzed, but the differences were not significant at a P value of 0.05 (Fig. 2A ; Supplemental Table S1). Also, the time to reach 90% of the maximal aboveground plant area did not vary statistically for the transgenic and control plants.
Although no major differences were observed in the vegetative growth of the entire plant, ruler measurements showed that leaf elongation rates (LERs) of the sixth leaf from overexpressing plants were at least 20% slower than those of control leaves (P < 0.05). Maximum LER of transgenic plants was 0.26 cm h–1, whereas the control plants grew at 0.33 cm h–1 (Fig. 2E). The duration of the leaf elongation period was unaffected by the transgene and so the final leaf length was decreased by nearly 14% in the overexpressing plants (Fig. 2D; P < 0.05). To further understand the cellular basis of reduced leaf growth rates, mature epidermal cell lengths were measured. As observed in Figure 2, B and C , epidermal cells of KRP1OE leaves were significantly larger than those of control plants (93.7 µm versus 78.6 µm; Fig. 2F), indicating that the lower LERs in transgenic plants might be due to reduced cell production, which is partly offset by increased cell expansion. Indeed, cell production was severely reduced in transgenic plants. During the first 56 h following leaf emergence, overexpressing plants produced per cell file 26.1 cells h–1 versus 39.6 cells h–1 for the control (Fig. 2G; P < 0.05). In summary, the overexpression of KRP1 in rice strongly decreases cell number in leaves, but total leaf growth is only moderately affected because of compensation by increased cell size. In contrast, the transgene had no significant effect on growth rate or cell size of the primary root (data not shown), indicating insensitivity of this organ to the presence of the transgene.
KRP1 Overexpression Alters Rice Seed Production Phenotypic evaluation of transgenic Orysa;KRP1OE plants revealed striking differences in seed production when compared to the corresponding controls. Seed production was significantly reduced in the T1 transgenic plants of all four lines analyzed (Table I ). The difference between transgenic and control plants varied between 56% and 80% in the four lines analyzed (P < 0.05). After estimation of different yield components, reduction in seed yield was primarily due to a decrease in filling rate (the ratio of seed-filled over total florets) and, to a lesser extent, to a reduction of seed weight. The reduction in the filling rate was significant in all four transgenic lines, with an average of 67%. On the other hand, the number of panicles or the number of florets per panicle was not significantly reduced. A small, but significant reduction, in seed weight was observed in three out of the four lines analyzed (Table I).
Subsequent analysis of seeds from T2 plants confirmed a drastic reduction (more than 98%) in the number of filled seeds from KRP1OE plants (Fig. 3A). Concomitantly, the total weight of filled seeds was also dramatically reduced. KRP1 overexpression also decreased the number of seeds formed by more than 17%. Interestingly, phenotypic changes associated with Orysa;KRP1 overexpression seemed to be "dose dependent" because heterozygous seeds had an intermediate phenotype for all the seed parameters analyzed (Fig. 3A). Closer inspection and sectioning of the rice KRP1OE transgenic seeds revealed that in spite of most seeds appearing morphologically normal (Fig. 3, B [right side] and C), they were in fact nearly or completely empty, whereas the maternal pericarp tissue was intact and morphologically normal. The remaining endosperm was filled with cavities (resembling a walnut structure) and no embryos were observed, either in the empty seeds or in seeds containing underdeveloped endosperm (Fig. 3D). The nuclear DNA content of seeds from wild-type and transgenic lines was measured by flow cytometry to study the effects of Orysa;KRP1 overexpression on the DNA ploidy distribution of the endosperm. As mentioned above, a large fraction of the seeds was empty, and so they could not be used; therefore, partially filled seeds were used instead. In overexpressing transgenic seeds, the 3C nuclei population had increased at the expense of the fraction of nuclei with 12C and 24C DNA ploidy levels (Fig. 4, A and B ). Most KRP1OE seeds had undergone one round of DNA replication less, with the consequent loss of the 24C peak that was consistently present in control seeds. The total percentage of endoreduplicated nuclei decreased by almost 30% in the KRP1OE seeds (Fig. 4C), showing that KRP1 overproduction inhibits endoreduplication in the endosperm.
To analyze whether the reduction in seed production (Table I) was caused by impaired pollination, pollen production and viability in KRP1OE plants was investigated. The number of pollen grains per anther was approximately 5-fold lower in the homozygous transgenic plants (data not shown), and various morphological aberrations were visible in pollen of these plants (Fig. 5 ). The rice pollen grains stained with 4',6-diamidino-2-phenylindole (DAPI) appeared to still comprise one vegetative and two sperm nuclei, but because their morphology was largely abnormal, it was impossible to determine precisely whether the nuclear morphology was altered in these grains. Overall pollen viability was reduced to 60%, whereas in the control plants more than 90% of the pollen grains were viable (data not shown). These data suggest that the poor seed set in KRP1OE plants was at least partly caused by reduced pollen quality.
Tissue-Specific Accumulation of Orysa;KRP1 Transcripts To better understand the observed phenotypes, the expression pattern of Orysa;KRP1 transcript levels was investigated by semiquantitative reverse transcription (RT)-PCR and real-time quantitative PCR (qPCR) in the root, shoot apex, leaf, stem, and developing seeds at different time points between 0 and 19 d after pollination (DAP). Orysa;KRP1 was expressed in all vegetative organs (root, stem, leaf, and apex), being most abundant in leaves (Fig. 6A ). In developing seeds, Orysa;KRP1 transcripts were detected throughout seed development, but expression was highest at 8 DAP using both semiquantitative RT-PCR (data not shown) and real-time qPCR (Fig. 6B). To deduce whether the involvement of KRP1 in seed development could be common to other rice KRP genes, the transcript accumulation profile of the four other ones was analyzed by qPCR (Fig. 6B): KRP1 was the only one whose expression level was low at the initial stages of seed development, peaking later at 8 DAP (as also demonstrated by RT-PCR experiments; data not shown). On the contrary, KRP3 and KRP5 transcripts were strongly up-regulated immediately after pollination, dropping 2 to 3 d later to basal levels. KRP4 expression was strongly down-regulated after pollination and the abundance of KRP2 mRNA levels was very low during seed formation, without a clear expression profile as a result. The different transcript accumulation profiles of KRP genes during seed development suggest a functional diversity between different KRP members.
Because both the phenotypic analysis of KRP1OE rice and the expression profile pointed toward a possible role of KRP1 in seed development, the tissue-specific accumulation pattern of Orysa;KRP1 mRNA in developing seeds was investigated by in situ hybridization. An RNA probe for Orysa;KRP1 was hybridized with sections of immature rice seeds, collected at 8, 10, and 15 DAP. Orysa;KRP1 was expressed at all three stages in the pericarp and endosperm tissues (data not shown). However, a much stronger and localized signal was observed at 8 DAP in the outermost cell layers located centripetally to the endosperm (Fig. 6, C and D).
Five KRP rice genes were identified with sequence similarity to other plant KRP genes and to the mammalian CKI, p21Kip1. Sequence identity between the rice KRPs and those of other plants is most striking in a region of 40 amino acids located at the extreme C-terminal end of each KRP protein, which is believed to be involved in the interaction with both CYCD and CDK/CYCD complexes (Wang et al., 1998 ).
In maize, two KRPs have recently been reported (Coelho et al., 2005
Rice plants constitutively overexpressing Orysa;KRP1 were produced and analyzed phenotypically. A high level of expression was detected in different organs of several transgenic lines. At first sight, leaves of KRP1OE rice were only marginally shorter than those of wild-type plants. However, cell measurements revealed that mature cell length in these leaves had considerably increased. Taken together, the data indicate that overproduction of Orysa;KRP1 strongly decreased cell production and, consequently, leaf cell number. Thus, the Orysa;KRP1 overexpression inhibits cell cycle progression, resulting in fewer but bigger cells. The existence of an organ size control mechanism that maintains organ size by regulating/compensating cell division and cell expansion has been previously described for dicot plant species and also in animals (Inzé, 2005
KRP overproduction has a remarkably different effect on leaf morphology in monocot versus dicot plants. Whereas the inhibition of cell division caused by the overproduction of KRPs in Arabidopsis is accompanied by a change in leaf shape (De Veylder et al., 2001
Orysa;KRP1 overexpression in rice plants reduces seed yield by approximately 70%, mainly caused by a drop in the seed-filling rate and, to a small extent, by a decrease in the average seed weight, which might be the consequence of a disturbance in cell expansion and/or cell division during endosperm formation. A role for Orysa;KRP1 in endosperm formation is also inferred from its expression profile during seed development. In developing seeds harvested during the first 19 DAP, the expression of endogenous Orysa;KRP1 was highest at 8 DAP. Cell division in the rice endosperm and embryo is completed approximately 9 to 10 DAP (Hoshikawa, 1993
Rice endosperm begins as a triploid tissue resulting from the union of two polar nuclei and one sperm nucleus. After fertilization, endosperm growth is the result of increases in both cell number and cell size. For the first days after pollination, the endosperm nuclei divide synchronously without cell wall formation. At 4 DAP, the endosperm nuclei near the embryo begin to form cell walls, enclosing the nucleus and protoplasma. The endosperm changes from a multinucleate, single-cell to a uninucleate, multicellular structure, after which all multiplication takes place only by cell division. During this period, cell multiplication in the endosperm is confined mainly to the outermost peripheral cell layer. Newly formed cells are added centripetally so that the dividing cell layer remains at the periphery (Hoshikawa, 1993 Endosperm cell division ends 9 to 10 DAP, and the total number of cells is determined. As the number of mitotic divisions decreases, the average DNA content per nucleus rapidly increases because of endoreduplication. From the Orysa;KRP1 transcript accumulation profile, this inhibitor can be inferred to be implicated in both cell proliferation and endoreduplication, given that expression could be detected throughout seed formation. However, both the in situ hybridization and semiquantitative expression analysis showed that Orysa;KRP1 expression reaches its maximum when cell proliferation ends and endoreduplication starts, indicating that Orysa;KRP1 at endogenic levels plays an important role in the switch from mitosis to endocycle.
Endoreduplication has a central function in endosperm formation (Larkins et al., 2001
The reduced seed production observed in rice overexpressing Orysa;KRP1 is probably related to the low pollen quality. Previously, plants overexpressing AtKRP1 under control of the Bgp1 promoter of Brassica campestris were shown to produce a reduced amount of seeds because of the inability of the formed pollen grains to germinate. All together, these data indicate that KRP1 might play a critical role in pollen development. However, because the transgenic pollen grains stained with DAPI were largely abnormal, we could not statistically determine whether nuclear morphology and nucleus number could be altered in these grains. Recently, a pollen phenotype has been described resulting from mutation of the CDKA;1 protein in Arabidopsis (Nowack et al., 2006
Arrest in pollen development has also been found associated with loss of SCF function in Arabidopsis (Wang and Yang, 2005 In summary, our data point to a critical role for Orysa;KRP1 in vegetative and reproductive developmental processes, including pollen development, seed formation, and leaf cell division/expansion. Artificial modulation of KRP expression levels during seed development could provide feasible approaches for increasing seed yield in plants. The possible role of Orysa;KRP1 in endosperm development should be carefully elucidated given that the endosperm constitutes the largest part of the rice seed; clarifying the cellular and molecular events that contribute to normal endosperm development might provide a better understanding of the components of seed production and offer the possibility to engineer grain yield.
Construction of a Rice cDNA Library
Total RNA was extracted from rice (Oryza sativa) cell suspension cultures harvested at 0, 3, 6, 9, and 12 d after subculture in fresh medium. Equimolar amounts (100 µg) of total RNA from each sample were used to purify poly(A+) mRNA with the Poly(A) Quick mRNA Isolation kit (Stratagene). The synthesis and subcloning of the cDNA into the HybriZAP-2.1
In an attempt to identify rice KRP genes, public sequence databases were screened for the KYNFD and GRYEW amino acid motifs located at the C-terminal end of most plant KRPs (De Veylder et al., 2001
To clone the full-length Orysa;KRP1 cDNA, approximately 750,000 plaque-forming units from the rice cell suspension cDNA library were screened by hybridization with the PCR-amplified expressed sequence tag fragment as a probe (Terras et al., 1995
Based on the sequence of Orysa;KRP1, four other KRP genes could be identified for rice from The Institute for Genome Research (TIGR pseudomolecule assembly release 3). Protein sequences were aligned with ClustalW (Thompson et al., 1994
The pDONR-KRP1 entry clone was used to transfer the Orysa;KRP1 cDNA into a Gateway-compatible plant transformation binary vector containing a hygromycin phosphotransferase (HPT)-based selectable marker cassette and a green fluorescent protein-based visual marker cassette. The Orysa;KRP1 cDNA was linked at its 5' end to the GOS2 promoter (de Pater et al., 1992
Rice cv Nipponbare was transformed according to Hervé and Kayano (2006)
For copy number estimation, genomic DNA was isolated from small segments of mature leaves from transgenic lines (T1) using the Wizard Magnetic 96 DNA kit (Promega) and subjected to qPCR using Taqman probes in multiplex qPCR (Ingham et al., 2001
Fifteen independent T0 transgenic plants, containing the Orysa;KRP1 coding sequence under the control of the rice constitutive GOS2 promoter, were regenerated in vitro and transferred to soil. Four transformation events containing a single copy of the transgene, as determined by real-time qPCR (Ingham et al., 2001 From transplantation until maturity, each plant was digitally imaged. Image analysis software was used for the calculation of several growth parameters (for more details, see Supplemental Methods S1). When the plants had reached maturity, the primary panicles were counted, harvested, and threshed (separation of seeds from vegetative part). The unfilled and filled (rice grain-containing) florets were taken apart, independently counted, and weighed (for more details, see Supplemental Methods S1). Through this procedure, the following seed-related parameters were obtained: seed yield (weight of filled florets per plant in grams); panicle number; florets per panicle; filling rate (%); 1,000 seed weight (g); and harvest index, i.e. ratio between seed yield per plant (g) and the aboveground plant area (mm2), multiplied by a 106 factor.
All parameters were analyzed by two-factor ANOVA for transgenic state (populations with and without the transgene) and event differences. If P (transgenic state) < 0.05, an overall "transgene" effect was considered causing the differences in phenotype. To check for an effect of the transgene within an event, i.e. for detecting line-specific effects, a pair-wise comparison t test based on the ANOVA results, using P < 0.05 as a cutoff, was performed for each event, between the transgenic plants and their corresponding control siblings. Flow cytometric analysis was performed with a CyFlow (Partec) as described (Boudolf et al., 2004
Leaf elongation rates were determined by measuring leaf length twice a day and calculating growth in function of time. Homozygous transgenic and control plants were grown in parallel and the length of the sixth leaf was measured by ruler as the distance from its tip to the soil surface. This measurement was carried out on at least 15 plants each time from leaf emergence to complete extension. LER of individual leaves was calculated as the slope of the regression fitted through the data points. A local polynomial fit of third degree on five data points was used to estimate the slope of the midpoint. For the first and last two points, the slope was determined on the first and last five points of the dataset, respectively.
Segments of the fully mature region of sixth leaves were collected, placed in methanol for chlorophyll removal and fixation for at least 2 d, and transferred in 90% (w/v) lactic acid (Merck) for clearing, storage, and mounting on microscopy slides. Cells were measured using image analysis on differential interphase contrast images. The setup consisted of a light microscope (Axioskop; Zeiss) equipped with a monochrome CCD camera 4912 (Cohu Electronics). The image was acquired by a computer equipped with Scion Image program (http://www.scioncorp.com). The lengths of individual cells were measured with the image analysis program ImageJ (publicly available on http://rsb.info.nih.gov/ij/) by tracing straight lines between successive transverse cell walls. The values obtained were averaged between different leaves and used to compare transgenic and control plants. The rate of cell production (cells h–1) per cell file in the meristem was calculated as the ratio between the LER (mm h–1) and the length (mm) of the mature cells (Fiorani et al., 2000
Anthers were collected from flowers immediately after anthesis and gently squashed in a droplet of water; the number of grains released was counted under the microscope. To analyze the viability, the collected pollen grains were fixed in ethanol:acetic acid (3:1), dehydrated through ethanol series, and stored in 70% ethanol. Before analysis, anthers were rehydrated in 1xphosphate buffered saline. Morphological integrity of the pollen grains was analyzed by staining them with 1% (w/v) iodine-potassium iodide (Khatun and Flowers, 1995
Total RNA was extracted from 10-d-old seedling organs (roots, leaves, stems, and apex) or immature seeds harvested daily between 0 and 11, and at 13, 15, and 19 DAP from greenhouse-grown plants. For semiquantitative RT-PCR, 2 µg of each sample was reverse transcribed into cDNA with the SuperScript First-Strand Synthesis System for RT-PCR (Invitrogen). PCR amplification of the Orysa;KRP1 cDNA was carried out with the following gene-specific primers: 5'-CCGCCGAGATCGAGGCGTTCTTCG-3' and 5'- AAACCTCTGATAAATACTGGGACG-3' (forward and reverse, respectively). The PCR products were separated on a 1% (w/v) agarose gel and transferred to a nylon membrane (Hybond N; GE-Biosciences) by blotting. Hybridizations were performed with the same probe used for the cDNA library screening and labeled with the North2South Biotin Random Prime kit (Pierce). Detection was done with the North2South Chemiluminescent Nucleic Acid Hybridization and Detection kit (Pierce), according to the manufacturer's protocol.
Real-time qPCR was performed on cDNA prepared from total RNA using the Taqman Reverse Transcription Reagents kit (Applied Biosystems) according to the manufacturer's instructions. Total RNA was extracted from 10-mg tissue samples with the Nucleic Acid Purification System 6100 (Applied Biosystems) and the ABI Prism 6100 Nucleic Acid PrepStation (Applied Biosystems). The multiplex PCR reactions were carried out in 384-well plates with Taqman probes and the ABI Prism 7900 HT sequence detection system. Specific primers and probes were used: 5'-CCGCGAGAGGAGAGAAACAA-3' (forward primer), 5'-TGCTGTGCTGAGGCTGTTG-3' (reverse primer), and 5'-Fam-CAGATCGCTCACCTCGCCGGG-Tamra-3' (Taqman probe) for Orysa;KRP1 transcripts, and 5'-CGCCGGTCGGTTCGA-3' (forward primer), 5'-GACACTGCCACCCATGGT-3' (reverse primer), and 5'-Vic-ATGCGTGACACATTATT-Tamra-3' (Taqman probe) for the 18S rRNAs, which were used as an internal control. For transcript quantification by qPCR of the additional KRP genes of rice, the following primer pairs were used: ATTGTTGGGCTGTTCTGGTGAG (forward) and TGCTGCTTGGCCTCCTGG (reverse) for KRP2; AGCACAAGCACAACCCTGC (forward) and GGGCAATGTCGTAATTGTACTTCTC (reverse) for KRP3; AGAGCTGGAAGCGTTCTTCG (forward) and GGCAGTCATTCACAGGATCAAAG (reverse) for KRP4; and CCCCTGGCTCCACAACTAAAAC (forward) and CCATCTCAAGAGAACTCGGAACG (reverse) for KRP5. cDNA was amplified for multiplex PCR with TaqMan Universal PCR Master Mix (Applied Biosystems), according to the manufacturer's instructions. All multiplex PCR reactions were performed in duplicate. The cycle values at which the crossing point between the amplification curve and the threshold occurred were defined as the threshold cycle (Ct values). To determine the expression level of Orysa;KRP1, the comparative
The in situ hybridization of sections through developing rice seeds was performed according to de Almeida-Engler et al. (2001) The accession numbers for the sequences referred to in the article are: AAC49698 (AtKRP1), CAB76424 (AtKRP2), CAC41617 (AtKRP3), CAC41618 (AtKRP4), CAC41619 (AtKRP5), CAC41620 (AtKRP6), CAC41621 (AtKRP7), CAA05215 (CrKRP), AAV76001 (EeKRP), AI728644 (GhKRP1), AAS13376 (GmKRP2;1), AAS13374 (GmKRP1;1), AAS13375 (GmKRP1;2), AAS13377 (GmKRP2;2), CAD29648 (LeKRP1), CAD29649 (LeKRP2), AJ297905 (NsKIS1a), CAD56868 (NtaKIS2), CAC82733 (NtoKIS1a), BAB20860 (PsKRP), AAX85449 (ZmKRP1), and AAX85450 (ZmKRP2).
We thank the members of the leaf growth and development group for critical reading of the manuscript and Martine De Cock for help in preparing it. Received July 20, 2006; accepted September 21, 2006; published September 29, 2006.
1 This work was supported in part by a grant from the Institute for the Promotion of Innovation by Science and Technology in Flanders (TraitQuest grant no. 000391 and postdoctoral fellowship to R.M.B.), the European Research Training Network (DAGOLIGN project HPRN–CT–2002–00267 [fellowship to A.P.] and Marie Curie Industry Host Fellowship Horyzan project HPMI–CT–1999–00056 [fellowship to A.-M.D.]), and the Research Foundation-Flanders (postdoctoral fellowship to L.D.V.). 
2 These authors contributed equally to the paper.
3 Present address: European Commission, Joint Research Centre, Institute for Reference Materials and Measurements, B–2440 Geel, Belgium. The author responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors (www.plantphysiol.org) is: Valerie Frankard (valerie.frankard{at}cropdesign.com).
[W] The online version of this article contains Web-only data. www.plantphysiol.org/cgi/doi/10.1104/pp.106.087056 * Corresponding author; e-mail dirk.inze{at}psb.ugent.be; fax 32–9–3313809.
Beemster GTS, De Veylder L, Vercruysse S, West G, Rombaut D, Van Hummelen P, Galichet A, Gruissem W, Inzé D, Vuylsteke M (2005) Genome-wide analysis of gene expression profiles associated with cell cycle transitions in growing organs of Arabidopsis. Plant Physiol 138: 734–743 Bisbis B, Delmas F, Joubès J, Sicard A, Hernould M, Inzé D, Mouras A, Chevalier C (2006) Cyclin-dependent kinase (CDK) inhibitors regulate the CDK-cyclin complex activities in endoreduplicating cells of developing tomato fruit. J Biol Chem 281: 7374–7383 Boudolf V, Vlieghe K, Beemster GTS, Magyar Z, Torres Acosta JA, Maes S, Van Der Schueren E, Inzé D, De Veylder L (2004) The plant-specific cyclin-dependent kinase CDKB1;1 and transcription factor E2Fa-DPa control the balance of mitotically dividing and endoreduplicating cells in Arabidopsis. Plant Cell 16: 2683–2692 Coelho CM, Dante RA, Sabelli PA, Sun Y, Dilkes BP, Gordon-Kamm WJ, Larkins BA (2005) Cyclin-dependent kinase inhibitors in maize endosperm and their potential role in endoreduplication. Plant Physiol 138: 2323–2336 de Almeida Engler J, De Groodt R, Van Montagu M, Engler G (2001) In situ hybridization to mRNA of Arabidopsis tissue sections. Methods 23: 325–334[CrossRef][Web of Science][Medline] de Pater BS, van der Mark F, Rueb S, Katagiri F, Chua N-H, Schilperoort RA, Hensgens LAM (1992) The promoter of the rice gene GOS2 is active in various different monocot tissues and binds rice nuclear factor ASF-1. Plant J 2: 837–844[Web of Science][Medline] De Veylder L, Beeckman T, Beemster GTS, Krols L, Terras F, Landrieu I, Van Der Schueren E, Maes S, Naudts M, Inzé D (2001) Functional analysis of cyclin-dependent kinase inhibitors of Arabidopsis. Plant Cell 13: 1653–1667 De Veylder L, Joubès J, Inzé D (2003) Plant cell cycle transitions. Curr Opin Plant Biol 6: 536–543[CrossRef][Web of Science][Medline] Dewitte W, Murray JAH (2003) The plant cell cycle. Annu Rev Plant Biol 54: 235–264[CrossRef][Medline] Fiorani F, Beemster GTS, Bultynck L, Lambers H (2000) Can meristematic activity determine variation in leaf size and elongation rate among four Poa species? A kinematic study. Plant Physiol 124: 845–855 Hervé P, Kayano T (2006) Japonica rice varieties (Oryza sativa, Nipponbare, and others). In K Wang, ed, Agrobacterium Protocols, Vol 1, Ed 2. Humana Press, Totowa, NJ, pp 213–222 Himanen K, Boucheron E, Vanneste S, de Almeida Engler J, Inzé D, Beeckman T (2002) Auxin-mediated cell cycle activation during early lateral root initiation. Plant Cell 14: 2339–2351 Hoshikawa K (1993) Anthesis, fertilization and development of caryopsis. In T Matsuo, K Hoshikawa, eds, Science of the Rice Plant, Vol 1: Morphology. Food and Agriculture Policy Research Center, Tokyo, pp 339–376 Ingham DJ, Beer S, Money S, Hansen G (2001) Quantitative real-time PCR assay for determining transgene copy number in transformed plants. Biotechniques 31: 132–140[Web of Science][Medline] Inzé D (2005) Green light for the cell cycle. EMBO J 24: 657–662[CrossRef][Web of Science][Medline] Jasinski S, Perennes C, Bergounioux C, Glab N (2002) Comparative molecular and functional analyses of the tobacco cyclin-dependent kinase inhibitor NtKIS1a and its spliced variant NtKIS1b. Plant Physiol 130: 1871–1882 Khatun S, Flowers TJ (1995) The estimation of pollen viability in rice. J Exp Bot 46: 151–154 Larkins BA, Dilkes BP, Dante RA, Coelho CM, Woo Y-m, Liu Y (2001) Investigating the hows and whys of DNA endoreduplication. J Exp Bot 52: 183–192 Lechner E, Xie D, Grava S, Pigaglio E, Planchais S, Murray JA, Parmentier Y, Mutterer J, Dubreucq B, Shen WH, et al (2002) The AtRbx1 protein is part of plant SCF complexes, and its down regulation causes severe growth and developmental defects. J Biol Chem 277: 50069–50080 Lui H, Wang H, DeLong C, Fowke LC, Crosby WL, Fobert PR (2000) The Arabidopsis Cdc2a-interacting protein ICK2 is structurally related to ICK1 and is a potent inhibitor of cyclin-dependent kinase activity in vitro. Plant J 21: 379–385[CrossRef][Web of Science][Medline] Nakayama KI, Nakayama K (2005) Regulation of the cell cycle by SCF-type ubiquitin ligases. Semin Cell Dev Biol 16: 323–333[CrossRef][Web of Science][Medline] Nowack MK, Grini PE, Jakoby MJ, Lafos M, Koncz C, Schnittger A (2006) A positive signal from the fertilization of the egg cell sets off endosperm proliferation in angiosperm embryogenesis. Nat Genet 38: 63–67[Web of Science][Medline] Schnittger A, Weinl C, Bouyer D, Schöbinger U, Hülskamp M (2003) Misexpression of the cyclin-dependent kinase inhibitor ICK1/KRP1 in single-celled Arabidopsis trichomes reduces endoreduplication and cell size and induces cell death. Plant Cell 15: 303–315 Shen WH, Parmentier Y, Hellmann H, Lechner E, Dong A, Masson J, Granier F, Lepiniec L, Estelle M, Genschik P (2002) Null mutation of AtCUL1 causes arrest in early embryogenesis in Arabidopsis. Mol Biol Cell 13: 1916–1928 Sherr CJ, Roberts JM (1995) Inhibitors of mammalian G1 cyclin-dependent kinases. Genes Dev 9: 1149–1163 Sherr CJ, Roberts JM (1999) CDK inhibitors: positive and negative regulators of G1-phase progression. Genes Dev 13: 1501–1512 Terras FRG, Eggermont K, Kovaleva V, Raikhel NV, Osborn RW, Kester A, Rees SB, Torrekens S, Van Leuven F, Vanderleyden J, et al (1995) Small cysteine-rich antifungal proteins from radish: their role in host defense. Plant Cell 7: 573–588[Abstract] Thompson JD, Higgins DG, Gibson TJ (1994) CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 22: 4673–4680 Van de Peer Y, De Wachter R (1994) TREECON for Windows: a software package for the construction and drawing of evolutionary trees for the Microsoft Windows environment. Comput Appl Biosci 10: 569–570 Verkest A, de O Manes C-L, Maes S, Van Der Schueren E, Beeckman T, Genschik P, Inzé D, De Veylder L (2005a) The cyclin-dependent kinase inhibitor KRP2 controls the onset of the endoreduplication cycle during Arabidopsis leaf development through inhibition of mitotic CDKA;1 kinase complexes. Plant Cell 17: 1723–1736 Verkest A, Weinl C, Inzé D, De Veylder L, Schnittger A (2005b) Switching the cell cycle. Kip-related proteins in plant cell cycle control. Plant Physiol 139: 1099–1106 Wang H, Fowke LC, Crosby WL (1997) A plant cyclin-dependent kinase inhibitor gene. Nature 386: 451–452[CrossRef][Medline] Wang H, Qi Q, Schorr P, Cutler AJ, Crosby WL, Fowke LC (1998) ICK1, a cyclin-dependent protein kinase inhibitor from Arabidopsis thaliana interacts with both Cdc2a and CycD3, and its expression is induced by abscisic acid. Plant J 15: 501–510[CrossRef][Web of Science][Medline] Wang H, Zhou Y, Gilmer S, Whitwill S, Fowke LC (2000) Expression of the plant cyclin-dependent kinase inhibitor ICK1 affects cell division, plant growth and morphology. Plant J 24: 613–623[CrossRef][Web of Science][Medline] Wang Y, Yang M (2005) The ARABIDOPSIS SKP1-LIKE1 (ASK1) protein acts predominately from leptotene to pachytene and represses homologous recombination in male meiosis. Planta 9: 1–5 Weinl C, Marquardt S, Kuijt SJH, Nowack MK, Jakoby MJ, Hülskamp M, Schnittger A (2005) Novel functions of plant cyclin-dependent kinase inhibitors, ICK1/KRP1, can act non-cell-autonomously and inhibit entry into mitosis. Plant Cell 17: 1704–1722 Wu L, Ueda T, Messing J (1993) 3'-end processing of the maize 27 kDa zein mRNA. Plant J 4: 535–544[CrossRef][Web of Science][Medline] Yang L, Ding J, Zhang C, Jia J, Weng H, Liu W, Zhang D (2005) Estimating the copy number of transgenes in transformed rice by real-time quantitative PCR. Plant Cell Rep 23: 759–763[CrossRef][Web of Science][Medline] Zhou Y, Fowke LC, Wang H (2002a) Plant CDK inhibitors: studies of interactions with cell cycle regulators in the yeast two-hybrid system and functional comparisons in transgenic Arabidopsis plants. Plant Cell Rep 20: 967–975[CrossRef][Web of Science] Zhou Y, Wang H, Gilmer S, Whitwill S, Fowke LC (2002b) Effects of co-expressing the plant CDK inhibitor ICK1 and D-type cyclin genes on plant growth, cell size and ploidy in Arabidopsis thaliana. Planta 216: 604–613[Medline] This article has been cited by other articles:
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ASPB Publications | PLANT PHYSIOLOGY® | THE PLANT CELL | |
|---|---|---|---|
TOP
ABSTRACT
RESULTS
), and the P value for %
vector were performed according to the manufacturer's instructions (Stratagene). Approximately 2 x 106 independent plaque-forming units were produced, with an average insert size of 1 kb. The library was amplified once to yield 2 x 109 plaque-forming units mL–1. 
