|
|
||||||||
|
First published online October 6, 2006; 10.1104/pp.106.085233 Plant Physiology 142:1294-1303 (2006) © 2006 American Society of Plant Biologists The BnALMT1 and BnALMT2 Genes from Rape Encode Aluminum-Activated Malate Transporters That Enhance the Aluminum Resistance of Plant Cells1Research Institute for Bioresources, Okayama University, Chuo 2-20-1, Kurashiki 7100046, Japan (A.L., M.K., M.S., H.M.); and Commonwealth Scientific and Industrial Research Organization Plant Industry, Canberra, Australian Capital Territory 2601, Australia (P.R.R.)
The release of organic anions from roots can protect plants from aluminum (Al) toxicity and help them overcome phosphorus (P) deficiency. Our previous findings showed that Al treatment induced malate and citrate efflux from rape (Brassica napus) roots, and that P deficiency did not induce the efflux. Since this response is similar to the malate efflux from wheat (Triticum aestivum) that is controlled by the TaALMT1 gene, we investigated whether homologs of TaALMT1 are present in rape and whether they are involved in the release of organic anions. We isolated two TaALMT1 homologs from rape designated BnALMT1 and BnALMT2 (B. napus Al-activated malate transporter). The expression of these genes was induced in roots, but not shoots, by Al treatment but P deficiency had no effect. Several other cations (lanthanum, ytterbium, and erbium) also increased BnALMT1 and BnALMT2 expression in the roots. The function of the BnALMT1 and BnALMT2 proteins was investigated by heterologous expression in cultured tobacco (Nicotiana tabacum) cells and in Xenopus laevis oocytes. Both transfection systems showed an enhanced capacity for malate efflux but not citrate efflux, when exposed to Al. Smaller malate fluxes were also activated by ytterbium and erbium treatment. Transgenic tobacco cells grew significantly better than control cells following an 18 h treatment with Al, indicating that the expression of BnALMT1 and BnALMT2 increased the resistance of these plant cells to Al stress. This report demonstrates that homologs of the TaALMT1 gene from wheat perform similar functions in other species.
Aluminum (Al) toxicity is the primary factor limiting crop production on acidic soils. When the soil pH falls below 5.0 the soluble Al in the soil solution exists predominantly as the toxic trivalent cation Al3+ that can inhibit root growth in many species at micromolar concentrations (Kochian et al., 2005
The mechanism of Al resistance that has been observed most commonly in monocotyledonous and dicotyledonous species involves the release of organic anions such as malate, citrate, and oxalate from roots (Miyasaka et al., 1991
Phosphorus (P) deficiency is also reported to induce the release of organic anions in rape (Brassica napus; Hoffland et al., 1989
Al resistance in wheat relies on the Al-dependent efflux of malate anions from the root apices and a strong correlation exists between relative Al resistance of different genotypes and the capacity for malate efflux (Delhaize et al., 1993
Recently the gene controlling the Al-dependent efflux of malate from wheat was isolated by Sasaki et al. (2004)
Homologs of TaALMT1 have now been identified in other members of the poaceae (rice and barley) as well as in dicotyledons (see GenBank database). The Arabidopsis (Arabidopsis thaliana) genome contains at least 14 homologs with the predicted proteins showing an approximately 30% to 40% identity with TaALMT1. One of these homologs has recently been implicated in an Al-resistance mechanism of Arabidopsis that also relies on malate release (Hoekenga et al., 2003
Ligaba et al. (2004)
Isolation of ALMT1 Homologs in Rape
Previous investigation by Ligaba et al. (2004)
The Arabidopsis genome contains at least 14 genes that are homologous to the TaALMT1 gene in wheat (Sasaki et al., 2004
Analysis of BnALMT Expression Semiquantitative reverse transcription (RT)-PCR was initially used to analyze BnALMT1 and BnALMT2 expression in rape seedlings. Expression in the apical 2 cm of roots was relatively low but increased by a 6 h treatment in 50 µM Al (Fig. 2 ). No expression of BnALMT1 was detected in the shoots with or without Al treatment (Fig. 2A). To determine the specificity of this response for Al ions, the effect of a number of lanthanides on BnALMT expression was tested. These elements, like Al, exist as trivalent cations in solution and are toxic to plants. Treatment with 50 µM lanthanum (La), erbium (Er), or ytterbium (Yb) increased expression of BnALMT1 and BnALMT2 in the roots in the presence and absence of Al (Fig. 2B).
A second set of experiments used quantitative RT-PCR to examine BnALMT expression. Since the expression of BnALMT1 and BnALMT2 responded similarly to Al treatment these experiments used primers that amplified both genes together. Figure 3A shows that BnALMT expression was induced by Al treatment in a concentration-dependent manner. The expression of neither gene was increased by 8 d of P deprivation in the absence of Al. A time course indicates that the BnALMT genes are induced after 2 h exposure to Al with no further increases occurring after 6 h (Fig. 3B).
Expression of BnALMT1 and BnALMT2 in Xenopus Oocytes Confers Al-Activated Malate Efflux The function of the proteins encoded by BnALMT1 and BnALMT2 was examined by expressing their cRNA in Xenopus oocytes. The oocytes were first injected with the full-length cRNA of BnALMT1, BnALMT2, or with water (control), and later injected with malate or citrate before being exposed to 100 µM Al. For oocytes injected with the cRNA of either BnALMT1 or BnALMT2 as well as malate, treatment with 100 µM Al activated large inward or negative currents (Fig. 4 ). These inward currents were absent from control oocytes injected with water and malate and they were also absent from the oocytes injected with BnALMT1 cRNA and citrate (instead of malate). Oocytes injected with BnALMT1 cRNA and malate but treated with La (instead of Al) did not show the same currents either. The average current detected in oocytes expressing BnALMT1 was approximately 2-fold greater than the current measured in oocytes expressing BnALMT2. In summary, Al-dependent currents were only detected in cells expressing BnALMT1 or BnALMT2 that had been injected with malate. By convention, inward currents are generated either by the net uptake of cations or the net efflux of anions. Therefore, these inward currents are consistent with the Al-dependent efflux of malate2 or malate anions from the oocytes.
Expression of BnALMT1 and BnALMT2 in Tobacco Cultured Cells Confers Al-Activated Malate Efflux and Enhances Resistance to Al Stress The function of proteins encoded by BnALMT1 and BnALMT2 was also investigated in transgenic plant cells using the constitutive 35S cauliflower mosaic virus promoter (Fig. 5A ). To confirm expression of the genes, RNA was isolated from the transgenic calli and RT-PCR was conducted using gene-specific primers. Transcript of BnALMT1 and BnALMT2 was accumulated in the transgenic cells while no transcript was detected in the cells transformed with the empty vector (Fig. 5B). Al-dependent malate efflux was measured in two independent transgenic lines expressing each gene construct. Al treatment activated malate efflux from all the transgenic cell lines expressing BnALMT1 or BnALMT2 but not from the control lines containing the empty vector (Fig. 5C). No citrate was detected in the media with or without Al treatment (data not shown).
We determined whether malate efflux from the transgenic tobacco cells could also be induced by some of the elements from the lanthanide series. Figure 6 shows that Yb and Er, but not La, induced malate release from the transgenic cells but the magnitude was only 20% to 30% of the response induced by Al treatment. None of the treatments induced malate release from cells transformed with an empty vector. Malate efflux from cells expressing BnALMT1 was more than 50% greater than from cells expressing BnALMT2.
The concentration dependence of malate efflux was investigated by treating cells with a Ca-Suc medium containing 0, 25, 50, 75, or 100 µM Al. Figure 7A shows that cells transformed with the empty vector showed no increase in malate efflux with Al whereas the efflux from cells expressing BnALMT1 or BnALMT2 increased with Al concentrations up to 100 µM. The time course for Al-dependent malate efflux from transgenic tobacco cells was also determined by treating cells with 100 µM Al and measuring malate released to the media periodically over 24 h. Malate was detected in the media within 1 h of Al treatment in cells expressing either cDNA. Malate release continued at a constant rate of approximately 3 µmol g fresh weight1 h1 for approximately 4 h and then slowed (Fig. 7B). Since treatment solution contained only CaCl2 and Suc it is possible that nutrient deficiencies explain the decrease in efflux through time. Malate efflux from cells transformed with the empty vector remained negligible throughout the period.
The effect of BnALMT expression on the Al resistance of tobacco cultured cells was investigated by measuring the recovery of growth following exposure to a toxic Al treatment. Transgenic cells expressing BnALMT1 or BnALMT2 were suspended in the standard Ca-Suc medium (pH 4.5) with or without 100 µM Al for 18 h. The cells were then washed with Ca-Suc medium (pH 5.8) and cultured in a modified Murashige and Skoog (MS) medium for an additional 7 d. The fresh weight of cells was then measured and compared with similar cells not treated with Al. Cells expressing BnALMT1 or BnALMT2 recovered better following the Al treatment than cells containing an empty vector. The fresh weight of cells expressing BnALMT1 and BnALMT2 were 90% and 75%, respectively, of the control cells not treated with Al compared to 20% for the vector controls (Fig. 8 ). These results indicate that cells expressing BnALMT1 or BnALMT2 show an enhanced resistance to Al toxicity compared to controls.
The recent isolation of the TaALMT1 gene from wheat (Sasaki et al., 2004
The function of BnALMT1 and BnALMT2 was investigated by heterologous expression in Xenopus oocytes and tobacco suspension cells. When Xenopus oocytes injected with BnALMT cRNA and malate were exposed to Al, large inward currents were generated that were not observed in water controls or when malate was replaced with citrate (Fig. 4). These inward currents are consistent with the efflux of malate2 or malate from the oocytes. Similarly, the expression of either BnALMT gene in tobacco suspension cells was associated with an Al-dependent efflux of malate that was not observed in control cells transformed with an empty plasmid (Fig. 5C). Al-dependent citrate efflux was not detected in these transgenic cells. Furthermore, BnALMT1 or BnALMT2 expression enhanced the Al resistance of the tobacco cells because cells expressing these genes grew 4-fold more rapidly than controls following Al treatment (Fig. 8). Previous reports have demonstrated that other trivalent cations such as many of the lanthanides (La, Er, and Yb) can activate malate release from the root apices of Al-tolerant wheat and rape plants but at significantly lower rates than observed for Al (Kataoka et al., 2002
The phenotypes conferred by BnAMLT1 and BnALMT2 expression in Xenopus oocytes and tobacco cultured cells were similar to those generated by TaALMT1 in the same transfection systems (see Sasaki et al., 2004
Hoffland et al. (1992)
A distinguishing feature between the ALMT gene from wheat with those from rape and Arabidopsis is that BnALMT1, BnALMT2, and At1g08430 expression is induced by Al, whereas TaALMT1 is constitutively expressed (Figs. 2 and 3; Sasaki et al., 2004
The Al-dependent efflux of organic anions from some plant species (e.g. wheat, buckwheat) occurs rapidly, suggesting all the necessary proteins are constitutively expressed and that exposure to Al activates the existing cellular machinery. In other species (e.g. Cassia tora), a delay of several hours occurs between the start of the Al treatment and the beginning of organic anion efflux and this has been interpreted as Al first triggering the induction of one or more proteins essential for organic anion efflux. These contrasting responses have been designated as pattern I and pattern II, respectively (Ma et al., 2001
The regulation of organic anion release from roots has been attributed, in some cases, to changes in organic anion synthesis (de la Fuente et al., 1997 This work describes the first isolation of TaALMT1 homolog genes from rape and the first functional characterization of a dicotyledonous member of this gene family in plant cells. BnALMT expression can increase malate efflux and enhance the Al resistance of tobacco cells. We conclude that BnALMT1 and BnALMT2 encode Al-activated malate transporters that function similarly to the TaALMT1 gene in wheat.
Plant Cultivation Rape (Brassica napus L. var. Natane nourin no. 20) seeds were sown on moist river sand and germinated in a dark chamber (LNC-131, Tabai) at 25°C. After 3 d, the seedlings were transferred to a cultivation chamber (CFH-405, Tomy) at a cycle of 14 h/25°C day and 10 h/20°C night and a light intensity of 40 µmol s1 m2. Six-day-old uniformly sized seedlings were transferred to a complete nutrient solution containing (in mmol L1): Ca (NO3)2 (5), KNO3 (1.25), MgSO4 (2), KCl (0.25), and KH2PO4 (0.25); and (in µmol L1): Fe (III)-EDTA (20), H3BO3 (25), MnSO4 (1.5), ZnSO4 (1.5), CuSO4 (0.5), and (NH4)6Mo7O24 (0.025), pH 5.0. The nutrient solution was renewed every 3 to 4 d to maintain optimum nutrition. The seedlings were grown in a cultivation chamber as described above. After 7 d in the complete nutrient solution, the seedlings were transferred to an aerated nutrient solution with (+P) or without (P) 250 µM P in 3.5 L containers (16 seedlings per container). The plants were grown for an additional 8 d in a naturally illuminated phytotron at a day temperature of 25°C and night temperatures of 22°C. For Al treatment, all plants grown in the same pot were transferred to 1 L pot filled with 0.5 mM CaCl2, pH 4.5, containing 0, 50, or 100 µM AlCl3.
Roots of +P and P plants were rinsed with deionized water and transferred to 1 L of 0.5 mM CaCl2, pH 4.5, containing 0, 50, or 100 µM AlCl3 for 6 h. After 6 h, the roots were carefully rinsed with deionized water and 1 g apical root tissue was excised and immediately frozen in liquid nitrogen. The frozen plant material was disrupted by mortar and pestle, and then lysed with Trizol reagent based on recommended procedure (Invitrogen/Life Technologies). After lyses of the plant material, RNA was isolated by a modified acid guanidinium thiocyanate-phenol-chloroform method of Chomezynski and Sacchi (1987)
To clone BnALMT1, RNA was isolated from Al-treated roots of +P plants. Degenerated PCR primers were designed from conserved sequences of three Arabidopsis (Arabidopsis thaliana) genes (At1g08430, At1g08440, and At2g27240) that show homology to the putative malate transporter from wheat (Triticum aestivum) TaALMT1. A fragment of about 600 bp was amplified using a pair of degenerated sense (5'-GCNGTNATGACNGTNGTNGTNGTNTTYG-3') and antisense (5'-CANGGRTGNCKRAANCKRAAYTGNCCRTG-3') primers. For sequencing, the PCR product was purified using microcon filters (Amicon Bioseparations, Millipore), and then cloned into the pGEM-T-Easy vector (Promega). The nucleotide sequence of the products was determined according to the enzymatic method of Sanger et al. (1977)
Ligaba et al. (2004)
The coding region of the BnALMT1 and BnALMT2 was amplified using a sense primer with a XbaI restriction site at the 5' end (CGCGCTCTAGAATGGAGAAACTGAGAGAGATAGTG) and an antisense primer with a SmaI restriction site (CGCCCCGGGTCAAATCTGAAGTATACGAACACCC). The fragments were inserted into a binary vector pBI121 (CLONTECH) replacing the
For complementary RNA (cRNA) preparation, the coding region of the BnALMT1 and BnALMT2 were cloned into the XbaI and SmaI sites of the pGEM-T Easy vector (Promega). After digesting with the XbaI and SmaI and blunting with T4 DNA polymerase, the fragments were inserted into the blunt-ended BglII site of vector pXBG-ev1, that is a pSP64T-derived Bluescript type vector into which Xenopus laevis oocytes
To determine the amount of malate efflux from tobacco cells, 300 mg fresh weight logarithmically growing cells were transferred to a centrifuge tube and pelleted at 2,000 rpm for 5 min. The cells were washed twice with Ca-Suc medium (3 mM CaCl2 and 3% Suc), pH 5.8. The cells were then suspended in Ca-Suc, pH 4.5, containing 100 µM AlCl3, LaCl3, ErCl3, or YbCl3. For the Al-dose experiment, the cells were suspended in Ca-Suc medium containing 0, 25, 50, 75, or 100 µM Al. After 18 h of incubation at dark on a rotary shaker (110 rpm) maintained at 25°C, 10 mL of the culture, corresponding to 100 mg fresh weight cells was centrifuged and the supernatant was used for malate assay. For the time-course experiment, the cells were suspended in Ca-Suc medium containing 100 µM Al and samples were taken at 0, 0.5, 1, 2, 4, 8, 16, and 24 h after treatment. The concentration of malate in the samples was determined using the method previously described by Delhaize et al. (1993)
Transgenic cells (100 mg fresh weight) were treated with 100 µM Al in Ca-Suc (pH 4.5) for 18 h. The cells were then washed twice with Ca-Suc (pH 5.8) and suspended in 20 mL modified MS medium containing 100 µg mL1 kanamycin for additional 7 d. The growth of the cells was determined as percentage of the control cells not treated with Al. Sequence data from this article can be found in the GenBank/EMBL data libraries under accession numbers BAE97280 and BAE97281.
The authors are very grateful to Dr. Takayuki Sasaki for help in cloning, Prof. Minoru Murata for help in sequence analysis, and Dr. Manny Delhaize for helpful comments on the manuscript. The authors also thank Ms. Shizuka Sasano and Mr. Hideki Nishimura for technical assistance. Received June 16, 2006; accepted September 9, 2006; published October 6, 2006.
1 This research was supported by a Grant-in-Aid for General Research (A) from the Ministry of Education, Science, Sports and Culture of Japan (grant no. 14206008 to H.M.); the Ohara Foundation for Agricultural Sciences; and a postdoctoral fellowship awarded by the Japan Society for the Promotion of Science (to A.L.). The author responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors (www.plantphysiol.org) is: Ayalew Ligaba (aligaba{at}rib.okayama-u.ac.jp). www.plantphysiol.org/cgi/doi/10.1104/pp.106.085233 * Corresponding author; e-mail aligaba{at}rib.okayama-u.ac.jp; fax 81864341249.
Anoop VM, Basu U, McCammon MT, McAlister-Henn L, Taylor GJ (2003) Modulation of citrate metabolism alters aluminum tolerance in yeast and transgenic canola overexpressing a mitochondrial citrate synthase. Plant Physiol 132: 22052217 Chomezynski P, Sacchi N (1987) Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162: 156159[Web of Science][Medline] de la Fuente JM, Ramírez-Rodríguez V, Cabrera-Ponce JL, Herrera-Estrella L (1997) Aluminum tolerance in transgenic plants by alteration of citrate synthesis. Science 276: 15661568 Delhaize E, Ryan PR (1995) Aluminum toxicity and tolerance in plants. Plant Physiol 107: 315321[Web of Science][Medline] Delhaize E, Ryan PR, Hebb DM, Yamamoto Y, Sasaki T, Matsumoto H (2004) Engineering high-level aluminum tolerance in barley with the ALMT1 gene. Proc Natl Acad Sci USA 101: 1524915254 Delhaize E, Ryan PR, Randall P (1993) Aluminium tolerance in wheat (Triticum aestivum L.). II. Aluminium-stimulated excretion of malic acid from root apices. Plant Physiol 103: 695702[Abstract] Ermolayev V, Weschki W, Manteuffel R (2003) Comparison of Al-induced gene expression in sensitive and tolerant soybean cultivars. J Exp Bot 54: 27452756 Ezaki B, Yamamoto Y, Matsumoto H (1995) Cloning and sequencing of the cDNAs induced by aluminium treatment and Pi starvation in tobacco cultured cells. Physiol Plant 93: 1118[CrossRef] Foy CD, Chaney RL, White MC (1978) The physiology of metal toxicity in plants. Annu Rev Plant Physiol 29: 511566 Gardner WK, Barber DA, Parbery DG (1983) The acquisition of phosphorus by Lupinus albus L. III. The probable mechanism by which phosphorus movement in the soil root interface is enhanced. Plant Soil 70: 107124[CrossRef] Hoekenga OA, Maron LG, Cançado GMA, Piñeros MA, Shaff J, Kobayashi Y, Ryan PR, Dong B, Delhaize E, Sasaki T, et al (2006) AtALMT1 (At1g08430) is a novel, essential factor for aluminum tolerance in Arabidopsis thaliana and encodes an aluminum-activated malate transporter. Proc Natl Acad Sci USA 103: 97349743 Hoekenga OA, Vision TJ, Shaff JE, Monforte AJ, Lee GP, Howell SH, Kochian LV (2003) Identification and characterization of aluminum tolerance loci in Arabidopsis (Landsberg erecta x Columbia) by quantitative trait locus mapping: a physiologically simple but genetically complex trait. Plant Physiol 132: 936948 Hoffland E, Findenegg GR, Nelemans JA (1989) Utilization of rock phosphate by rape. Plant Soil 113: 155160[CrossRef] Hoffland E, Van de Boogaard R, Nelemans JA, Findenegg GR (1992) Biosynthesis and root exudation of citric and malic acid in phosphate starved rape plants. New Phytol 122: 675680 Horst WJ (1995) The role of the apoplast in aluminum toxicity and resistance of higher plants: a review. Z Pflanzenernaehr Bodenkd 158: 419428 Kataoka T, Stekelenburg A, Nakanishi TM, Delhaize E, Ryan PR (2002) Several lanthanides activate malate efflux from roots of aluminium tolerant wheat. Plant Cell Environ 25: 453460[Medline] Katsuhara M, Akiyama Y, Koshio K, Shibasaka M, Kasamo K (2002) Functional analysis of water channels in barley roots. Plant Cell Physiol 43: 885893 Kinraide TB, Parker DR, Zobel RW (2005) Organic acid secretion as a mechanism of aluminium resistance: a model incorporating the root cortex, epidermis, and the external unstirred layer. J Exp Bot 56: 18531865 Kispal G, Rosenkrantz M, Guarente L, Srere PA (1988) Metabolic changes in Saccharomyces cerevisiae strains lacking citrate synthases. J Biol Chem 263: 1114511149 Kochian LV (1995) Cellular mechanisms of aluminum toxicity and tolerance in plants. Annu Rev Plant Physiol Plant Mol Biol 46: 237260[CrossRef][Web of Science] Kochian LV, Piñeros MA, Hoekenga OA (2005) The physiology, genetics and molecular biology of plant aluminum resistance and toxicity. Plant Soil 274: 175195[CrossRef] Kollmeier M, Dietrich P, Bauer CS, Horst WJ, Hedrich R (2001) Aluminum activates a citrate-permeable anion channel in the Al-sensitive zone of the maize root apex: a comparison between an Al-sensitive and an Al-tolerant cultivar. Plant Physiol 126: 397410 Koyama H, Kawamura A, Kihara T, Hara T, Takita E, Shibata D (2000) Overexpression of mitochondrial citrate synthase in Arabidopsis thaliana improved growth on a phosphorus limited soil. Plant Cell Physiol 41: 10301037 Ligaba A, Shen H, Shibata K, Yamamoto Y, Tanakamaru S, Matsumoto H (2004) The role of phosphorus in aluminum-induced citrate and malate exudation in rape (Brassica napus L.). Physiol Plant 120: 575584[CrossRef][Medline] Lipton D, Blanchar R, Blevins D (1987) Citrate, malate and succinate concentration in exudates from P sufficient and P stressed Medicago sativa L. seedlings. Plant Physiol 85: 315317 Ma JF, Ryan PR, Delhaize E (2001) Aluminum tolerance in plants and the complexing role of organic acids. Trends Plant Sci 66: 273278 Ma JF, Zheng SJ, Matsumoto H (1997a) Specific secretion of citric acid induced by Al stress in Cassia tora L. Plant Cell Physiol 38: 10191025 Ma JF, Zheng SJ, Matsumoto H, Hiradate S (1997b) Detoxifying aluminum with buckwheat. Nature 390: 569570[Medline] Ma Z, Miyasaka SC (1998) Oxalate exudation by taro in response to Al. Plant Physiol 118: 861865 Magalhaes JV, Garvin DF, Wang Y, Sorrells ME, Klein PE, Schaffert RE, Li L, Kochian LV (2004) Comparative mapping of a major aluminum tolerance gene in sorghum and other species in the poaceae. Genetics 167: 19051914 Matsumoto H (2002) Metabolism of organic acids and metal tolerance in plants exposed to aluminum. In MNV Prasad, K Strzalka, eds, Physiology and Biochemistry of Metal Toxicity and Tolerance in Plants. Kluwer Academic Publisher, Dordrecht, The Netherlands, pp 95109 Miyasaka SC, Buta JG, Howell RK, Foy CD (1991) Mechanism of aluminium tolerance in snapbeans: root exudates of citric acid. Plant Physiol 96: 737743 Neumann G, Massonneau A, Maritinoia E, Roemheld V (1999) Physiological adaptation of phosphorous deficiency during proteoid root development in white lupin. Planta 208: 373382[CrossRef] Osawa H, Matsumoto H (2002) Aluminum triggers malate independent potassium release via ion channels from the root apex in wheat. Planta 215: 405412[CrossRef][Web of Science][Medline] Pellet DM, Grunes DL, Kochian LV (1995) Organic acid exudation as an aluminium-tolerance mechanism in maize (Zea mays L.). Planta 196: 788795[CrossRef][Web of Science] Piñeros M, Kochian LV (2001) A patch clamp study on the physiology of aluminum toxicity and aluminum tolerance in maize: identification and characterization of Al3+-induced anion channels. Plant Physiol 125: 292305 Piñeros MA, Magalhaes JV, Alve VMC, Kochian LV (2002) The physiology and biophysics of Al tolerance mechanism based on root citrate exudation in maize. Plant Physiol 129: 11941206 Preston GM, Carroll TP, Guggino WB, Agre P (1992) Appearance of water channels in Xenopus oocytes expressing red cell CHIP28 protein. Science 256: 385387 Raman H, Zhang K, Cakir M, Appels R, Garvin DF, Maron LG, Kochian LV, Moroni JS, Raman R, Imtiaz M, et al (2005) Molecular characterization and mapping of ALMT1, the aluminium-tolerance gene of bread wheat (Triticum aestivum L.). Genome 48: 781791[Medline] Richards KD, Schott EJ, Sharma YK, Davis KR, Gardner RC (1998) Aluminum induces oxidative stress genes in Arabidopsis thaliana. Plant Physiol 116: 409418 Ryan PR, Delhaize E, Jones DL (2001) Function and mechanism of organic anion exudation from plant roots. Annu Rev Plant Physiol Plant Mol Biol 52: 527560[CrossRef][Web of Science][Medline] Ryan PR, Delhaize E, Randall PJ (1995a) Characterization of Al-stimulated efflux of malate from the apices of Al-tolerant wheat roots. Planta 196: 103110 Ryan PR, Delhaize E, Randall PJ (1995b) Malate efflux from root apices and tolerance to aluminum are highly correlated in wheat. Aust J Plant Physiol 22: 531536 Ryan PR, Skerrett M, Findlay GP, Delhaize E, Tyerman S (1997) Aluminum activates an anion channel in the apical cells of wheat roots. Proc Natl Acad Sci USA 94: 65476552 Sanger F, Nicklen S, Coulson AR (1977) DNA sequencing with chain-terminating inhibitors. Proc Natl Acad Sci USA 74: 54635467 Sasaki T, Yamamoto Y, Ezaki B, Katsuhara M, Ahn SJ, Ryan PR, Delhaize E, Matsumoto H (2004) A wheat gene encoding an aluminum-activated malate transporter. Plant J 37: 645653[CrossRef][Web of Science][Medline] Snowden KC, Richards KD, Gardner RC (1995) Aluminum-induced genes (induction by toxic metals, low calcium, and wounding and pattern of expression in root tips). Plant Physiol 107: 341348[Abstract] Taylor GJ (1991) Current views of the aluminum stress response; the physiological basis of tolerance. Curr Top Plant Biochem Physiol 10: 5793 Tesfaye M, Temple SJ, Allan DJ, Vance CP, Samac DA (2001) Overexpression of malate dehydrogenase in transgenic alfalfa enhances organic acid synthesis and confers tolerance to aluminum. Plant Physiol 127: 18361844 Yamaguchi M, Sasaki T, Sivaguru M, Yamamoto Y, Osawa H, Ahn SJ, Matsumoto H (2005) Evidence for the plasma membrane localization of Al-activated malate transporter (ALMT1). Plant Cell Physiol 46: 812816 Yamamoto Y, Rikiishi S, Chang YC, Ono K, Kasai M, Matsumoto H (1994) Quantitative estimation of aluminum toxicity in cultured tobacco cells: correlation between aluminum uptake and growth inhibition. Plant Cell Physiol 35: 575583 Yang ZM, Sivaguru M, Horst JW, Matsumoto H (2000) Aluminium tolerance is achieved by exudation of citric acid from roots of soybean (Glycine max). Physiol Plant 110: 7277[CrossRef] Zhang W-H, Ryan PR, Tyerman S (2001) Malate-permeable channels and cation channels activated by aluminum in the apical cells of wheat roots. Plant Physiol 125: 14591472 Zheng SJ, Ma JF, Matsumoto H (1998) High aluminium resistance in buckwheat. I. Al-induced specific secretion of oxalic acid from root tips. Plant Physiol 117: 745751 This article has been cited by other articles:
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ASPB Publications | PLANT PHYSIOLOGY® | THE PLANT CELL | |
|---|---|---|---|