Plant Physiol.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


First published online September 8, 2006; 10.1104/pp.106.085043

Plant Physiology 142:993-1003 (2006)
© 2006 American Society of Plant Biologists

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
142/3/993    most recent
pp.106.085043v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Web of Science (12)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Demarsy, E.
Right arrow Articles by Lerbs-Mache, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Demarsy, E.
Right arrow Articles by Lerbs-Mache, S.
Agricola
Right arrow Articles by Demarsy, E.
Right arrow Articles by Lerbs-Mache, S.
DEVELOPMENT AND HORMONE ACTION

Building Up of the Plastid Transcriptional Machinery during Germination and Early Plant Development1

Emilie Demarsy, Florence Courtois, Jacinthe Azevedo, Laurence Buhot2 and Silva Lerbs-Mache*

Laboratoire Plastes et Differenciation Cellulaire, Université Joseph Fourier and Centre National de la Recherche Scientifique, F–38041 Grenoble, France


    ABSTRACT
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 CONCLUSION
 MATERIALS AND METHODS
 LITERATURE CITED
 
The plastid genome is transcribed by three different RNA polymerases, one is called plastid-encoded RNA polymerase (PEP) and two are called nucleus-encoded RNA polymerases (NEPs). PEP transcribes preferentially photosynthesis-related genes in mature chloroplasts while NEP transcribes preferentially housekeeping genes during early phases of plant development, and it was generally thought that during plastid differentiation the building up of the NEP transcription system precedes the building up of the PEP transcription system. We have now analyzed in detail the establishment of the two different transcription systems, NEP and PEP, during germination and early seedling development on the mRNA and protein level. Experiments have been performed with two different plant species, Arabidopsis (Arabidopsis thaliana) and spinach (Spinacia oleracea). Results show that the building up of the two different transcription systems is different in the two species. However, in both species NEP as well as PEP are already present in seeds, and results using Tagetin as a specific inhibitor of PEP activity demonstrate that PEP is important for efficient germination, i.e. PEP is already active in not yet photosynthetically active seed plastids.


The plastid transcriptional machinery is very complex. Many different components of the plastid transcriptional apparatus are already known. For some of them the function has been elucidated. At least three enzymes, plastid-encoded RNA polymerase (PEP), and two nucleus-encoded RNA polymerases (NEPs), are implicated in plastid gene expression (for recent reviews, see Shiina et al., 2005Go; Toyoshima et al., 2005Go). PEP is a eubacterial-type multimeric enzyme. Gene order and organization have bacterial traits, i.e. genes coding the beta (rpoB) and beta'/beta'' subunits (rpoC1 and rpoC2) are arranged as operons analogous to the rif operon of Escherichia coli while the gene coding for the {alpha}-subunit (rpoA) is arranged in another operon together with genes coding for ribosomal proteins (for review, see Igloi and Kössel, 1992Go). The expected molecular masses for the PEP subunits of Arabidopsis (Arabidopsis thaliana) are 38 kD ({alpha}), 121 kD (beta), 79 kD (beta'), and 156 kD (beta''). NEP enzymes (RPOTm, RPOTp, and RPOTmp; for nomenclature see Azevedo et al., 2006Go) are phage-type monomeric enzymes of about 110 kD. All three genes are nucleus encoded and two of the resulting NEP enzymes (RPOTp and RPOTmp) are imported into plastids (Hedtke et al., 2000Go; Azevedo et al., 2006Go). RPOTmp is also imported into mitochondria and organelle targeting might be species specific and developmentally regulated (Hedtke et al., 2000Go; Kabeya and Sato, 2005Go). In plastids, specificity of promoter recognition and transcriptional enhancement is brought about by nucleus-encoded transcription factors ranging from six prokaryotic-type sigma ({sigma}) factors (for review, see Allison, 2000Go) up to specific DNA-binding factors like CDF1 (Lam et al., 1988Go), CDF2 (Iratni et al., 1994Go), AGF (Kim and Mullet, 1995Go), and PTF1 (Baba et al., 2001Go).

According to this multiplicity of transcriptional components, different types of promoters are found on the plastid genome: PEP, consensus-type NEP (class I), and exceptional promoters (class II; for review, see Weihe and Börner, 1999Go). PEP promoters are characterized by the eubacterial-type consensus sequences –10 and –35. Consensus-type NEP promoters are characterized by the short consensus YRTA that resembles the consensus of mitochondrial promoters. Exceptional promoters differ from the class I promoters in two respects. They do not have the YRTA consensus sequence and they are differently utilized during plant development. While consensus-type promoters are mainly active in nonphotosynthetic cells, PEP and exceptional promoters are active in green tissues (for review, see Liere and Maliga, 2001Go). Most of the plastid transcription units are under control of PEP as well as NEP promoters. Only few genes are transcribed only from a NEP promoter (e.g. rpoB, accD) or only from a PEP promoter (e.g. rbcL, psbA).

RNAs encoding housekeeping functions (transcription/translation) reach maximal abundance earlier in chloroplast development than RNAs encoding photosynthetic functions (Baumgartner et al., 1993Go) and it has been hypothesized that the building up of the NEP transcription system precedes the building up of the PEP transcription system (Mullet, 1993Go). This hypothesis had been reinforced by two supplementary observations: (1) The plastid rpoB operon is under control of a NEP promoter (Silhavy and Maliga, 1998Go; Liere and Maliga, 1999Go); (2) It had been shown that, in general, the expression of nuclear genes encoding plastid proteins precedes the expression of chloroplast genes during germination, i.e. during early phases of chloroplast development (Harrak et al., 1995Go). Since NEP is nucleus encoded it was likely to assume that during germination at first NEP is made. NEP will then transcribe housekeeping genes (e.g. PEP-encoding genes) during early phases of plastid differentiation and PEP takes over transcription during later stages. However, experimental proof for this hypothesis, based on expression studies of NEP and PEP during plastid differentiation, is still lacking. To close this gap we have prepared specific antibodies against a number of proteins of the NEP and PEP transcription system and we have analyzed the expression of these components of the two transcription systems on the RNA and on the protein level during germination and early plant development, i.e. during the transformation of protoplasts that are present in dry seeds into chloroplasts of photosynthetically active cotyledons. Analyses have been made with two different plant species, Arabidopsis and spinach (Spinacia oleracea).


    RESULTS
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 CONCLUSION
 MATERIALS AND METHODS
 LITERATURE CITED
 

RNAs Encoding NEP and PEP Are Already Present in Dry Seeds of Arabidopsis

Germination experiments of Arabidopsis have been carried out as previously described and young plantlets have been analyzed up to the 6th d after germination (Privat et al., 2003Go). The developmental stages that have been used in the following experiments are shown in Figure 1A . RNA steady-state levels corresponding to all RNA polymerase subunits and to all six {sigma} factors have been analyzed by semiquantitative reverse transcription (RT)-PCR using cytoplasmic 18S rRNA as control (Fig. 1, B and C). The absence of DNA in the RNA preparations has been verified by direct PCR reaction without prior RT (Fig. 1C, control RT). RNAs coding for all RNA polymerase subunits (RPOTmp, RPOTp, rpoA, rpoB, rpoC1, and rpoC2) are already present in dry seeds (Fig. 1B, lane 1). Their quantity augments immediately during imbibition (lane 2) and drops down progressively during later developmental stages. Messenger RNAs coding for RPOTmp and RPOTp increase again at stage 6 when primary leaves start to emerge (lane 8). The augmentation of all mRNA levels from stage 0 to 0+ indicates that nucleus-encoded RPOT genes as well as plastid-encoded rpo genes are transcribed immediately after the onset of imbibition. In contrast to this general raise of mRNAs encoding RNA polymerase subunits (Fig. 1B), {sigma} factor genes are differentially expressed during germination and early seedling development (Fig. 1C). SIG2 and SIG5 mRNAs are already present in dry seeds (Fig. 1C, lane 1) whereas mRNAs of all other {sigma} factors appear during imbibition, i.e. at stage 0+ (lane 2). Messenger RNA levels corresponding to SIG1, SIG2, and SIG6 peak between stages 2 and 4 and then drop down while the transcript levels coding for SIG3, SIG4, and SIG5 do not change significantly between stages 3 and 6.


Figure 1
View larger version (47K):
[in this window]
[in a new window]
 
Figure 1. Analysis of mRNA levels of NEP and PEP components during germination and early Arabidopsis seedling development. A, Developmental stages of Arabidopsis that have been used in B and C. B, mRNA levels coding for NEP and PEP core subunits. C, PEP transcription factors of the {sigma} type have been analyzed by semiquantitative RT-PCR. The principal developmental stages that have been analyzed are as follows: dry seeds (0, lane 1), seeds after imbibition and vernalization (0+, lane 2), and 1 to 6 d after germination (lanes 3–8). 18S RNA in B was analyzed as internal constitutive control standard and RNA preparations have been routinely tested for the absence of DNA by performing PCR directly without prior RT (shown as example for rpoA in C, Control [–RT]).

 

Protein Components of the NEP and PEP Transcription Systems Are Already Present in Dry Seeds of Arabidopsis

To reveal components of NEP and PEP at the protein level we have prepared specific peptide antibodies against the two different NEP enzymes, RPOTp and RPOTmp, from Arabidopsis (see "Materials and Methods"). Both antisera react with two different proteins in total protein extracts. One of these proteins has the expected molecular mass of about 110 kD. The second one has a molecular mass slightly below 100 kD (Fig. 2A , lanes 2 and 6). Affinity purification of these antisera on Affi-gel fixed peptides results in an enrichment of antibodies reacting with the higher Mr polypeptide (Fig. 2A, lanes 3 and 7). The preimmune sera do not react with proteins present in total plant protein extracts (Fig. 2A, lanes 1 and 5). As expected, RPOTp is present in purified chloroplasts (Fig. 2A, lane 4). Immunological cross-reaction of the two different RPOT antisera has been excluded by cross testing the corresponding peptides (Fig. 2B).


Figure 2
View larger version (59K):
[in this window]
[in a new window]
 
Figure 2. Analysis of protein levels of NEP and PEP components during germination and early Arabidopsis seedling development. A, Characterization of specific RPOTp and RPOTmp peptide antibodies. Thirty microgram aliquots of either total leaf proteins (lanes 1–3 and 5–7) or chloroplast proteins (lane 4) have been separated on 12% polyacrylamide gels and Nitrocellulose blots have been probed with either preimmune serum (PI, lanes 1 and 5) or RPOTp and RPOTmp antisera before (lanes 2 and 6) and after (lanes 3, 4, and 7) affinity purification of specific IgG fractions. B, Exclusion of antibody cross-reaction between RPOTmp and RPOTp. Different concentrations (as indicated in ng on the left side of the figure) of peptides AtRPOTmp-a (lanes 1 and 5), AtRPOTmp-b (lanes 2 and 6), AtRPOTp-a (lanes 3 and 7), and AtRPOTp-b (lanes 4 and 8) have been spotted in equal volumes to Nitrocellulose filters and probed either with RPOTp (left-hand side) or RPOTmp (right-hand side) antibodies. C, Immunological cross-reaction of two different antibodies prepared against E. coli RNA polymerase with PEP subunits in Arabidopsis protein extracts. Thirty microgram aliquots of total leaf proteins (lanes 1–3) or chloroplast proteins (lane 4) have been separated on 12% SDS-polyacrylamide gels and Nitrocellulose blots have been probed with the A antibodies (lane 1 and bottom part of lanes 3 and 4) and the B antibodies (lane 2 and top part of lanes 3 and 4). D, Protein patterns of the protein extracts prepared from dry seeds (0), seeds after vernalization (0+), and from seedlings 1 to 6 d after germination (1–6) as revealed by Ponceau staining of Nitrocellulose membranes after SDS gel separation on 10% acrylamide gels and blotting. E, Immunoblot analysis of Nitrocellulose blots as described in D by the different antibodies that are characterized in A, B, and C.

 
To analyze components of the eubacterial-type enzyme we have used antibodies prepared against components of the E. coli RNA polymerase. It has been repeatedly shown that the E. coli RNA polymerase and PEP have sufficient similarity to allow immunological cross-reaction (Lerbs et al., 1985Go; Lerbs, 1988Go; Iratni et al., 1994Go). So we have used two different antisera that have both been prepared against E. coli RNA polymerase (see "Materials and Methods"). Immunological cross-reaction of these antisera with proteins of Arabidopsis is shown in Figure 2C. The two antisera reveal different polypeptides in the Arabidopsis protein extracts, indicating that antibody production has not been efficient against all polymerase polypeptides or that some of the antibodies do not recognize their plastid orthologous with sufficient strength in the same antiserum. The A antibodies react with polypeptides of about 120, 80, and 38 kD corresponding well to the expected molecular masses of the beta, beta', and {alpha}-subunits of PEP (Fig. 2C, lane 1). The B antibodies react with polypeptides of about 150 and 38 kD in the Arabidopsis total protein extract (Fig. 2C, lane 2). This corresponds well to the molecular masses expected for the beta'' and {alpha}-subunits of PEP. Thus, although each antiserum alone does not permit to analyze all polymerase subunits, the use of the two different antibodies solves this problem. Plastid localization of the immunologically cross-reacting polypeptides RPOB, RPOC1, and RPOC2 is shown in Figure 2C on the right-hand side (lanes 3 and 4).

Next we have prepared protein extracts from Arabidopsis seeds and plantlets up to 6 d after germination. The protein pattern of these extracts after separation on denaturing SDS polyacrylamide gel and blotting to a nitrocellulose membrane is shown in Figure 2D. Western immunoblotting of these extracts using the antibodies made against RPOTp and RPOTmp shows that both RNA polymerases are already present in seeds (Fig. 2E, top two sections). Equally, analysis of western blots using the two E. coli RNA polymerase antibodies shows that all PEP subunits are already present in dry seeds (Fig. 2E, bottom two sections). The expression profiles of RPOB and RPOC1/C2 differ from that of RPOA. This difference might be due to the fact that RPOA is encoded by another operon than RPOB/C1 and C2 and protein expression of the two operons might be differently regulated.

Taken together with our previous studies showing that one of the PEP transcription factors, SIG3, is also already present in dry seeds (Privat et al., 2003Go), these results indicate that both types of plastid RNA polymerases, NEP and PEP, are present in dry seeds, i.e. not only NEP but also PEP could be active immediately after seed imbibition.


RNAs Encoding NEP and PEP Are Already Present in Dry Seeds of Spinach

The above-described results indicate the presence of both types of RNA polymerase, NEP and PEP, already in dry seeds. This observation is unexpected, especially with regard to the PEP transcription system that is thought to be primarily important for the expression of photosynthesis-related genes. Therefore, we wanted to know whether or not this result can be generalized, and we performed similar experiments as described above for Arabidopsis also with spinach. Spinach has been chosen for the following reasons: (1) The sequence of the spinach genome is known (Schmitz-Linneweber et al., 2001Go), i.e. mRNA levels coding PEP subunits could be easily analyzed by RT-PCR. (2) The cDNAs coding the two NEP enzymes, RPOTp and RPOTmp, have recently been sequenced and plastid localization of two NEP enzymes has been shown (Azevedo et al., 2006Go). (3) Partial cDNAs of spinach coding for two of the early {sigma} factors (SIG2 and SIG3, see Fig. 1C and Privat et al., 2003Go) have recently been cloned and sequenced by us (Mache et al., 2002Go). For the following experiment the partial cDNA sequence coding the spinach SIG2 factor has been completed by 5' RACE and the additional sequence has been deposited at EMBL (accession no. AJ427912).

Developmental stages of young spinach plantlets that have been used for the following experiments are demonstrated in Figure 3A . Semiquantitative RT-PCR analyses of RNAs corresponding to all RNA polymerase subunits and two {sigma} factors (SIG2 and SIG3) are shown in Figure 3B. The RT-PCR experiment shows that all analyzed RNAs, including those coding the two {sigma} factors, are already present in dry seeds. RNA levels do not change considerably between stages 0 and 1, but augment strongly at stage 2 when hypocotyl/root growth starts. With respect to the PEP enzyme, results resemble those obtained with Arabidopsis, i.e. PEP-coding mRNAs are already present in dry seeds. However, the expression patterns of the mRNAs are slightly different. While in Arabidopsis, core PEP mRNA levels peak between stages 0+ and 2 and then decrease, in spinach the raise in mRNA levels is retarded to stage 2 and mRNA levels do not change considerably afterward. The expression patterns of the two {sigma} factors are also different between Arabidopsis and spinach. The augmentation of the SIG2 and SIG3 mRNA levels are 1 d delayed in spinach compared to Arabidopsis and SIG3 mRNA is already present in dry seeds of spinach but not in Arabidopsis.


Figure 3
View larger version (49K):
[in this window]
[in a new window]
 
Figure 3. Analysis of mRNA levels of NEP and PEP components during germination and early seedling development of spinach. A, Stages of spinach development that have been used for analyzing the mRNA and protein levels. B, mRNA levels of stages presented in A have been analyzed by semiquantitative RT-PCR as described in "Materials and Methods." 18S RNA has been analyzed as internal constitutive control standard.

 

Protein Components of the PEP Transcription System Are Differently Expressed during Seed Germination of Spinach When Compared to Arabidopsis

To analyze components of the PEP transcription system from spinach we prepared specific peptide antibodies against its {alpha}-subunit (SoRPOA) and against {sigma} 2 (SoSIG2). Both antisera have been made by using two different peptides at once for immunization (Double X program, Eurogentec). The two cDNAs have been cloned into pET-32a and pBAD/ThioTOPO expression vectors and the antibodies have been tested on E. coli extracts without and after induction of expression by Ara or isopropylthio-beta-galactoside (IPTG), respectively (Fig. 4, A and C , lanes 2 and 3 and lanes 3 and 4, respectively). Antibody signals have been verified by antithioredoxin antibodies (Fig. 4A, lanes 4 and 5) or by anti-His antibodies (Fig. 4C, lanes 5 and 6). The specificity of the SoSIG2 antibody has been further characterized by affinity purification of the antisera on one (P1) or the other (P2) of the two peptides that had been used for immunization (Fig. 4B, lanes 1 and 2). Both different IgG fractions react with a polypeptide of the expected size in spinach protein extracts thus confirming the immunoreactivity of both peptides and the specificity of the SoSIG2 antibody. Control reactions that have been performed using the preimmune sera do not reveal any polypeptides (Fig. 4, B [lane 3] and C [lanes 1 and 2]). The SoRPOA antibodies have been further characterized by showing plastid localization (Fig. 4C, lanes 7 and 8). The two spinach RPOTp and RPOTmp antisera have been characterized previously (Azevedo et al., 2006Go).


Figure 4
View larger version (43K):
[in this window]
[in a new window]
 
Figure 4. Analysis of protein levels of NEP and PEP components during germination and early spinach seedling development. A, Characterization of the spinach SIG2 antibodies on recombinant SoSIG2 protein. The cDNA of SoSIG2 has been cloned into pBAD-ThioTOPO and the thioredoxin fusion protein has been analyzed in total E. coli protein extracts before (lanes 2 and 4) and after (lanes 3 and 5) induction of protein expression by Arabinose using the SoSIG2 antibodies (lanes 2 and 3) and the antithioredoxin antibodies (lanes 4 and 5). B, Characterization of affinity purified SoSIG2 antibodies on spinach total protein extracts. SoSIG2 antibodies have been affinity purified on either the SoSIG2-a peptide (P1, lane 1) or the SoSIG2-b peptide (P2, lane 2) and probed on 50 µg aliquots of total spinach proteins. Lane 3 shows a control reaction with preimmune serum. C, Characterization of SoRPOA antibodies on recombinant RPOA protein and on spinach protein extracts. The cDNA of SoRPOA has been cloned into pET32a and the His-fusion protein has been analyzed in total E. coli protein extracts before (lanes 1, 3, and 5) and after (lanes 2, 4, and 6) induction of protein expression by IPTG using preimmune serum (lanes 1 and 2), the SoRPOA antibodies (lanes 3 and 4), and the anti-His antibodies (lanes 5 and 6). Thirty microgram aliquots of total leaf proteins (lane 7) and chloroplast proteins (lane 8) have been separated on a 12% SDS-polyacrylamide gel and analyzed by anti-SoRPOA antibodies after transfer to nitrocellulose. D, Analysis of NEP and PEP protein levels during germination and early seedling development. Nitrocellulose blots of proteins from developmental stages shown in Figure 3A have been probed by the different antibodies that are characterized in Figure 4, A to C. The RPOTp antibody has been characterized previously (Azevedo et al., 2006Go).

 
In the following, spinach protein extracts prepared from dry seeds (0), seeds after imbibition (0+), and seedlings up to 6 d after germination (1–6) have been analyzed by western immunoblotting (Fig. 4D). Immunoreactions corresponding to the {alpha} and beta'' subunits of PEP as representatives for the two different plastid rpo gene-coding operons, are shown. Both proteins are detectable from stage 0+ until stage 5 and drop down at stage 6. The phage-type RPOTp enzyme and {sigma} factor 2 are already present in dry seeds. RPOTmp is not shown because the antibody is not strong enough to reveal the protein in total protein extracts of entire plantlets during germination. The presence of the {alpha}-subunit as well as the beta"-subunit of PEP at stage 0+ suggests that the PEP core enzyme is built up immediately at the onset of imbibition. The presence of at least one {sigma} factor indicates that PEP could be already functional during germination and root outgrowth.


The PEP Transcription System Is Already Active during Germination

The experiments demonstrated above show the presence of PEP already in seeds, thus raising the question of whether some PEP is just stored to facilitate early seedling growth or whether PEP is already functional in seeds during germination. To answer this question we decided to analyze germination in the presence and in the absence of Tagetin, a specific inhibitor of eubacterial RNA polymerase and PEP (Mathews and Durbin, 1990Go, 1994Go) and of nuclear RNA polymerase III (PolIII; Steinberg et al., 1990Go). We started our experiments by determining the optimal concentration of Tagetin that inhibits PEP but not PolIII activity. For this purpose, Arabidopsis seedlings have been grown in the presence of either water or different concentration of Tagetin for 4 d (Fig. 5, A and B ). Inhibition of transcription of photosynthesis-related genes by PEP due to the presence of Tagetin results in bleaching of leaves (Kapoor et al., 1997Go). Figure 5A shows that growth of Arabidopsis seedlings in the presence of a concentration of 100 µM Tagetin leads to complete bleaching of cotyledons. To assure that this concentration does not interfere with PolIII activity we verified the quantity of nuclear 5S RNA by in vitro capping of total RNA obtained from seedlings that had been grown either on water or on different concentrations of Tagetin (Fig. 5B; Iratni et al., 1997Go). Since the quantity of 5S RNA is not diminished at 100 µM Tagetin, this concentration has been used in the following experiments to analyze the percentage of germination of Arabidopsis seeds on water or on Tagetin (Fig. 5, C and D). We used a transparent testa mutant (tt2-1; Debeaujon et al., 2000Go) whose seed coat is highly permeable to ensure that the exogenously applied Tagetin reaches the embryo easily during seed imbibition. This mutant has already been successfully used to analyze the effect of {alpha}-Amanitin on seed germination (Rajjou et al., 2004Go). Each time 50 seeds have been observed over a period of 3 d and the percentage of radicle protrusion has been calculated at various time points as a measure for germination (Fig. 5D). Figure 5C shows tt2-1 seeds germinated on water or on Tagetin, 60 h after imbibition (i.e. 24 h cold treatment followed by 36 h at room temperature). In general, we observed that the tt2-1 seeds needed more time to accomplish germination than wild-type seeds. Most of the seeds are germinated 48 h after release from cold treatment, but the delay of germination due to Tagetin treatment is obvious from differences in root length between the water and Tagetin-treated samples (data not shown). The experiment has been performed three times and Figure 5D summarizes the results. Tagetin treatment results in a slight but significant delay of germination, thus indicating an activity of PEP immediately after imbibition.


Figure 5
View larger version (34K):
[in this window]
[in a new window]
 
Figure 5. Delay of germination by Tagetin. A, Arabidopsis seeds of the tt2-1 mutant have been germinated on moistened filter paper in the absence (lane 1) and in the presence of 1 µM (lane 2), 10 µM (lane 3), and 100 µM (lane 4) of Tagetin. B, Tagetin has no influence on 5S RNA levels. 5S RNA has been analyzed from Arabidopsis plantlets shown in A by in vitro capping of isolated total RNA, separation on 6% denaturing polyacrylamide gels, and autoradiography. C, Arabidopsis seeds were photographed after 24 h vernalization and 36 h incubation at 23°C under continuous light in the absence (water) and presence (Tagetin) of 100 µM Tagetin. D, Analysis of the effect of Tagetin on the time course of seed germination. Seeds were germinated as described in "Materials and Methods" in the absence (blue) and in the presence (pink) of 100 µM Tagetin. Germination is expressed as percentage of seeds showing radicle protrusion at the indicated time points. The time scale does not include the first 24 h after the vernalization period. E, RNA and protein have been isolated from water (lanes 2 and 4) and Tagetin (lanes 1 and 3) treated seeds at the end of the imbibition period (0+) and 42 h after cold release. RNA levels have been analyzed by semiquantitative RT-PCR for 18S rRNA, rbcL, and rpoA mRNAs and protein levels have been analyzed by immunoblotting for RPOA and RPOC2 using anti-E. coli B antibodies.

 
This early PEP activity has been confirmed by RT-PCR analysis of rbcL mRNA at stage 0+ and 42 h after cold release (Fig. 5E, top part, lanes 1–4). RbcL is one of the few plastid genes that are transcribed exclusively from a PEP promoter. At stage 0+, water and Tagetin-treated seeds contain about the same amounts of mRNA. This might be explained in that PEP is not active at 4°C. However, RT-PCR analysis of RNA isolated 42 h after cold release shows a strong diminution of rbcL mRNA after Tagetin treatment. As controls, we have analyzed by RT-PCR the RNA levels of two different genes that are not transcribed by Tagetin-sensitive RNA polymerases, i.e. the cytoplasmic 18S rRNA and the plastid rpoA mRNA. As expected, both mRNA levels do not change after Tagetin treatment. Finally, the presence of PEP subunits RPOA and RPOC2 in tt2-1 seeds at stage 0+ and 42 h after release from cold treatment confirms the presence of PEP at early developmental stages in the mutant (Fig. 5E, bottom part).


    DISCUSSION
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 CONCLUSION
 MATERIALS AND METHODS
 LITERATURE CITED
 
In this study we have analyzed the building up of the two different plastid transcription systems, PEP and NEP, during germination and early seedling outgrowth in Arabidopsis and in spinach on the mRNA and protein levels.


Analyses of rpo mRNAs

Although the kinetics of mRNA accumulation is different in both plant species, all RNAs corresponding to the PEP and NEP core enzymes are already present in dry seeds (Figs. 1B and 3B). In Arabidopsis, de novo synthesis of rpo mRNAs starts immediately with imbibition as suggested by the strong accumulation of all rpo mRNAs at stage 0+ compared to dry seeds (stage 0; Fig. 1B). In spinach, rpo mRNA accumulation occurs later, on the 2nd d after germination, when roots have started to elongate (Fig. 3). The accumulation of mRNAs coding {sigma} factors is different for each of the six {sigma} factors of Arabidopsis (Fig. 1C). Only two {sigma} mRNAs, SIG2 and SIG5, are already present in dry seeds, consistent with a proposed early expression of {sigma} 2 (Kanamaru et al., 2001Go; Privat et al., 2003Go) and a specific function of {sigma} 5 in embryo development (Yao et al., 2003Go). In spinach, the accumulation of the two mRNAs coding for SIG2 and SIG3 resembles that of the mRNAs encoding the PEP core enzymes (Fig. 3B). Apart from these differences in mRNA accumulation between Arabidopsis and spinach, the essential information obtained from these experiments is that PEP as well as NEP-coding mRNAs are already present in dry seeds. This means that both different transcription systems coexist in different plastid types, like chloroplasts, proplastids, and amyloplasts.


Analyses of rpo Proteins

To confirm this conclusion on the protein level we had at first to produce several antibodies, specific for some of the RNA polymerase polypeptides. Two-peptide antibodies have been prepared against Arabidopsis RPOTm and RPOTmp and against spinach {sigma} factor 2 and the {alpha}-subunit of PEP. RPOT and {sigma} peptides have been chosen in the variable N-terminal parts of the proteins to avoid the risk of cross-reaction between either the two NEP enzymes or between different {sigma} factors. In addition, all antibodies have been purified on the corresponding peptides and specific IgG fractions have been used for protein analyses. Nonpurified RPOTp and RPOTmp antisera react both with two different polypeptides of about 100 and 110 kD. After purification both antibodies react preferentially with the larger polypeptide (Fig. 2A). This indicates that only the 110-kD polypeptides correspond to RPOTp and RPOTmp. However, at present we cannot exclude that the smaller polypeptides result from development-dependent alternative splicing (Young et al., 1998Go) or alternative translation initiation of the rpo mRNA precursor molecules (Kobayashi et al., 2001Go; Richter et al., 2002Go) or from alternative cleavage of the proteins.

The spinach RPOA and SIG2 antibodies reveal only one protein of the expected Mrs, i.e. 38 and 60, respectively, independent of whether the antibodies are purified or not (data not shown). Finally, we have also prepared peptide antibodies against other spinach PEP core subunits but they are not strong enough to reveal the corresponding polypeptides in crude protein extracts (data not shown). Therefore, to analyze the subunits of the PEP core enzyme in Arabidopsis and spinach we have used antibodies that had been prepared against two different preparations of E. coli RNA polymerase. Although the titer of individual antibodies recognizing the RPOA, RPOB, RPOC1, and RPOC2 subunits of the plastid PEP enzyme is very different in the two E. coli antisera it is possible to reveal all PEP subunits by using the two different antisera (Fig. 2C). Figure 2E shows the analysis of all PEP subunits during Arabidopsis germination and early seedling development. The polypeptide pattern of the extracts is shown in Figure 2D. The result shows that not only PEP and NEP mRNAs but also the corresponding protein products are already present in dry seeds of Arabidopsis. RPOTp and RPOTmp protein levels are highest on day 2 after germination, subsequently decrease up to day 5 and increase again on day 6. The increase on day 6 might correspond to the appearance of the primary leaves at that stage (see Privat et al., 2003Go; Fig. 1A). These results are in good agreement with recently published results obtained by expression of RpoTp::beta-glucuronidase (GUS) and RPOTmp::GUS fusion constructs in Arabidopsis (Emanuel et al., 2006Go). This study shows overall expression of GUS on day 2 from the two constructs with a specific accumulation in root tips from the RpoTmp::GUS construct. On day 4 GUS expression is strongly diminished in the whole plantlets, remaining only detectable in root tips again for the RpoTmp::GUS construct. On day 7, GUS expression reappears but now in a very limited tissue-specific manner with strongest expression in the emerging primary leaves.

At present, it is not known whether RPOTmp and SIG2 proteins are present in chloroplasts or in mitochondria or in both organelles in early developmental stages, i.e. during the first 6 d after germination. It is technically not feasible to isolate pure mitochondria and chloroplasts from different organs of very young Arabidopsis plantlets. RPOTmp is localized exclusively in chloroplasts in mature spinach plants (Azevedo et al., 2006Go). In cotyledons and leaves of Arabidopsis, RPOTmp might be exclusively localized in mitochondria (Kabeya and Sato, 2005Go). On the other hand, rpoTmp T-DNA insertion mutants have altered plastid gene expression while no differences have been found for mitochondrial gene transcripts (Baba et al., 2004Go). It is therefore likely that the targeting of RPOTmp to either mitochondria or chloroplasts is developmentally regulated and might differ in different plant species. Double targeting to mitochondria and plastids has also been described for SIG2 in maize (Zea mays; Beardslee et al., 2002Go). In both cases, i.e. RPOTmp and SIG2, it is not yet clear whether the polypeptides are functional in mitochondria or whether mitochondrial localization is the result of erroneous targeting.

Since cross-reaction of RPOA antibodies are very weak in Arabidopsis we decided in the following to prepare specific peptide antibodies against the {alpha}-subunit of spinach PEP (Fig. 4C). Contrary to Arabidopsis, in spinach the PEP core enzyme is not present in dry seeds as demonstrated for the {alpha} (SoRPOA)- and beta'' (SoRPOC2)-subunits (Fig. 4D). However, both subunits can be clearly revealed at stage 0+, indicating that PEP is built up immediately after imbibition and is present in seeds already during germination before the radicle protrudes the seed coat. RPOTp and SIG2 are already present in dry seeds, i.e. both enzymes, PEP and NEP coexist already in seeds and the building up of the two transcriptional systems during germination seems to proceed either sequentially (spinach) or in parallel (Arabidopsis).

From the results we can further conclude that PEP activity is not only important in photosynthetically active chloroplasts but also in nonphotosynthetic plastids. In agreement with this conclusion are recent studies analyzing PEP promoter-driven transient expression of green fluorescent protein in various plastid types that have shown green fluorescent protein in chromoplasts and roots (Hibberd et al., 1998Go). Furthermore, early transcription in chloroplast development of plastid rpo genes has been already reported (Baumgartner et al., 1993Go; Inada et al., 1996Go), but in these studies rpo gene transcription has not been linked to PEP activity. Finally, early transcription of several SIG2-dependent tRNAs indicates that PEP might be necessary for efficient tRNA synthesis in nonphotosynthetic plastids (Kanamaru et al., 2001Go).

In this study, we have analyzed early PEP activity during imbibition and germination by treating Arabidopsis seeds with Tagetin, a specific inhibitor of PEP activity (Mathews and Durbin, 1990Go, 1994Go). A clear retard in germination is observed in the presence of the inhibitor (Fig. 5, C and D), which should be due to the inhibition of PEP activity during germination as shown by specific inhibition of rbcL transcription (Fig. 5E). The lack or diminution of PEP activity is not vital for germination since all seeds germinate finally, but PEP activity is certainly important in nonphotosynthetic seed plastids for efficient germination.


    CONCLUSION
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 CONCLUSION
 MATERIALS AND METHODS
 LITERATURE CITED
 
Results show that both plastid transcription systems, NEP and PEP, are built up in parallel during germination and early plant development. The presence of PEP in dry seeds of Arabidopsis and in seeds of spinach immediately after imbibition indicates that PEP could be active already before germination and development of photosynthetically active tissues/organs. Delay of germination in the presence of Tagetin, a specific inhibitor of PEP activity, confirms that PEP is active and required for efficient germination. Experiments are in progress to define the role of PEP for optimal germination in more detail.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 CONCLUSION
 MATERIALS AND METHODS
 LITERATURE CITED
 

Plant Material and Growth Conditions

If not otherwise indicated, surface-sterilized Arabidopsis (Arabidopsis thaliana) seeds (ecotype Wassilewskija) were spread on Murashige and Skoog agar plates containing 1% Suc, kept for 72 h at 4°C in darkness (stage 0+), and then transferred into a growth chamber and grown for 6 d at 23°C under 16/8 h light/dark cycle at 110 µmol m–2 s–1. For mRNA and protein analyses seeds and/or plantlets were harvested in 24-h intervals.

Spinach (Spinacia oleracea) seeds were agitated in distilled water for 24 h (0+) and were then germinated at 23°C on three layers of moistened filter paper (Whatman 3MM, Dominique Dutscher) in a growth chamber under 10/14 h light/dark cycle. For mRNA and protein analyses seeds and/or plantlets were harvested according to the developmental stages described in Figure 3A (see also Harrak et al., 1995Go).


RNA Extraction

RNA has been isolated as described by Suzuki et al. (2004)Go. Briefly, after extensive homogenization in liquid nitrogen the powder is solubilized in 2 mL of buffer (100 mM Tris/HCl, pH 9.5; 10 mM EDTA, pH 8; 2% lithium dodecyl sulfate (w/v); 0.6 M NaCl; 0.5 M Trisodium Citrate; and 5% beta-mercaptoethanol). Cell debris are removed by centrifugation at 16,000g for 5 min and RNAs are extracted from the aqueous phase by three successive treatments. (1) Chloroform treatment is followed by (2) treatment with phenol containing 3.5% (w/v) of guanidine isothiocyanate (Sigma) and 0.2 M sodium acetate, pH 4. After 3 min of incubation, half a volume of chloroform is added and (3) an additional chloroform treatment is performed. The resulting supernatant is finally precipitated by addition of 0.6 volumes of isopropanol. Remaining traces of DNA are removed by two successive DNase treatments and the absence of DNA in the RNA preparation is verified by PCR.


Semiquantitative RT-PCR

One microgram of DNase I treated RNA was reverse transcribed using 200 units of Superscript II (Invitrogen SARL) according to the manufacturer's protocol. The reaction was performed in the presence of 1 µg random hexamers in a total volume of 60 µL at 42°C for 50 min. Aliquots of 1 µL of this reaction were afterward used as template for semiquantitative PCR in a 25-µL reaction mix containing 1 unit of BioTaq (Bioline). To assure that amplification is in the linear range, the optimal number of cycles (n) has been determined for each couple of primers separately. PCR was carried out under the following conditions: 5 min denaturation at 94°C, followed by n cycles of amplification (30'' at 94°C, 30'' at 55°C, 1 min at 72°C), and a final 7 min termination step at 72°C. The Quantum 18S rRNA Universal kit (Ambion) served as control. Primers are as follows. Arabidopsis: TTGCTTCTACTGAGAGACCTGGC5'-TTGCTTCTACTGAGAGACCTGGC-3', 5'-CCGAGATATCTTCAAGATACTGCTTAACGGCCTTTCATCAATGGATCAACTTCCTGCGCAACAAGACGTTGATGCAACCTATGAAGGCTTTCGGCTTCAATGAATCGAGTTTATCGGTTTATTGATCAGGGTTGTTTCCTACTCACCCGAGCAGATGACTGCTTTTGCACCTTGAGGTTAACCATCAACATTCC5'-AGCACTTTGGGTTCTCCAG-3', 5'-TTGATTAAGCTCTTCACGCG-3' (SSIG2); 5'-TCCTTTCACCACCAATTCTTCC-3', 5'-GGAAGGTTGGGAGCATTGCA-3' (SSIG3); 5'-AATTCTTCACCCCGAACCTC-3', 5'-TTGATTAAGCTCTTCACGCG-3' (SRPOT); 5'-AATTCTTCACCCCGAACCTC-3', 5'-TTGATTAAGCTCTTCACGCG-3'(SRPOT)-3' (AtSIG1); 5'-TTAACGGCCTTTCATCAATGG-3', 5'-ATCAACTTCCTGCGCAACAAGACG-3' (AtSIG2); 5'-TTAGTGCGATCGAGTTTAACATCG-3', 5'-TAAGCACGACGTGATTGAGGAACC-3' (AtSIG3); 5'-ACAATCTCTCCCTTACTCAGAACG-3', 5'-AACAACCAACCTACGGTAACAACG-3' (AtSIG4); 5'-TTGATGCAACCTATGAAGGC-3', 5'-TTTCGGCTTCAATGAATCGAG-3' (AtSIG5); 5'-ACTAGCTCAGAAGGCTTTATCAGC-3', 5'-ATGGACTACCAGACGTAGGTTTGC-3' (AtSIG6); 5'-TCTACTCGGACACTACAGTGGAAG-3', 5'-CATCGCAATGCCTATTGTGTCGGC-3' (AtRPOA); 5'-TTTATCGGTTTATTGATCAGGG-3', 5'-TTGTTTCCTACTCACCCGAG-3' (AtRPOB); 5'-ATCCTGGAAATACAGCATCC-3', 5'-ATCTTCCCATTCATTCCCC-3' (AtRPOC1); 5'-ATAGATCACTTCGGGATGGC-3', 5'-ATATGGACTGGATTGAAGGG-3' (AtRPOC2); 5'-CAGATGACTGCTTTTGCACC-3', 5'-TTGAGGTTAACCATCAACATTCC-3' (AtRPOTm); 5'-TTCATTGGAAGACCAATACC-3', 5'-TTTCAAAGTCTGATCAACC-3' (AtRPOTp); 5'-TGGTTATTGTTCTGGTTTAT-3', 5'-AACAATTCATCTACCTCAGG-3' (AtRPOTmp); 5'-GGTGAGTAACGCGTAAGAACCTGC-3', 5'-CCTCGGGCGGATTCCTCCTTTTGC-3' (control-rrn). Spinach: 5'-AGCACTTTGGGTTCTCCAG-3', 5'-TTGATTAAGCTCTTCACGCG-3'(SoSIG2); 5'-TCCTTTCACCACCAATTCTTCC-3', 5'-GGAAGGTTGGGAGCATTGCA-3' (SoSIG3); 5'-AATTCTTCACCCCGAACCTC-3', 5'-TTGATTAAGCTCTTCACGCG-3' (SoRPOTmp); 5'-AATTCTTCACCCCGAACCTC-3', 5'-TTGATTAAGCTCTTCACGCG-3' (SoRPOTp).


RNA Capping

RNA was 5' labeled by in vitro capping using guanylyltransferase according to the supplier's protocol (Ambion). One microgram of RNA was incubated with 5 units of guanylyltransferase in the presence of 37 units RNase inhibitor (Amersham Biosciences) and 15 pmol {alpha}32P-GTP (3,000 Ci per mmol) in reaction buffer (50 mM Tris/HCl, pH 8; 6 mM KCl; 1.25 mM dithiothreitol; 1.25 mM MgCl2; 50 µg mL–1 bovine serum albumin) for 1 h at 37°C. RNA was precipitated by adding 2 volumes of ethanol and 0.3 M sodium acetate pH 5.6, washed with 70% ethanol, dried, and separated by electrophoresis on a 6% denaturing polyacrylamide gel.


Antibody Preparation, Purification, and Characterization

Peptide antibodies have been prepared in rabbits according to the DoubleX program by Eurogentec. The following peptides have been used for immunization: SoSIG2:H2N-DYSDPLRYLRGATNS-CONH2, H2N-KLHDELKVRFGKSPSC-CONH2; SoRPOA: H2N-WKCVESRTDSKCL-CONH2, H2N-HAEENVNLEDNQHKVC-CONH2; AtRPOTp: H2N-CSFENQDSSYAGT-CONH2, H2N-DIDKRKFDSLRRRQC-CONH2; AtRPOTmp: H2N-ITRREEFSKSERCL-CONH2, H2N-RSWRMKKQDQFGMGC-CONH2.

Specific IgG fractions have been obtained by coupling of the corresponding peptides to Affi-Gel 10 or 15 and antibodies have been purified according to the supplier's protocol (BIO-RAD). Purified antibodies have been stored in aliquots at –80°C until usage. The reactivity and specificity of the antibodies have been tested either by dot-blot analyses or on recombinant proteins. For dot-blot analyses, 5, 50, 100, 250, and 500 ng of peptides have been spotted in equal volumes to Nitrocellulose. For testing on recombinant proteins the SoSIG2 and SoRPOA cDNAs have been cloned into pBAD-ThioTOPO (Invitrogen, SARL) and pET32a (Novagen, tebu-bio SA), respectively, and antibodies have been tested on the thioredoxin fusion proteins after Ara or IPTG induction, SDS-PAGE separation of proteins, and transfer to Nitrocellulose. Antibody reactions have been revealed by the ECL western-blotting detection system (Amersham Biosciences).

One of the two different antibodies against Escherichia coli RNA polymerase (E.c.-A) had been kindly provided by Professor Dubert. The second one (E.c.-B) has been prepared by Eurogentec using commercially available E. coli RNA polymerase.


Chloroplast Isolation

Arabidopsis chloroplasts were prepared using a slightly modified protocol of Kunst (1998)Go. Briefly, 7-d-old Arabidopsis leaves were homogenized in buffer containing Sorbitol (0.45 M), Tricine (20 mM, pH 8.4), EDTA (10 mM), and NaHCO3 (10 mM). A crude plastid pellet was obtained by centrifugation at 5,000g for 3 min. Plastids were suspended in RB buffer (Sorbitol 0.3 M; Tricine 20 mM, pH 7.6; MgCl2 5 mM; ETDA 2.5 mM) and further purified by centrifugation through a 40% Percoll cushion at 5,000g for 10 min. Intact chloroplasts were recovered as a pellet, washed twice with RB buffer, and chlorophyll was removed by treatment with 80% acetone. For further analyses the chlorophyll-free protein pellet was suspended in buffer containing Tris/HCl (30 mM, pH 6.8), glycerol (12.5%), and SDS (1%). Preparations were routinely analyzed by western immunoblotting using an antibody directed against the mitochondrial polynucleotide phosphorylase (Perrin et al., 2004Go) and were found to be devoid of mitochondrial cross contamination.


Protein Purification and Analyses

Proteins have been isolated and analyzed by western immunoblotting as described previously (Privat et al., 2003Go). Briefly, protein extracts were prepared according to Hurkman and Tanaka (1986)Go. Protein concentrations were determined by using the Bio-Rad DC protein assay and bovine serum albumin as standard (BIO-RAD). After separation of equal amounts of protein by SDS-PAGE and subsequent transfer to nitrocellulose membranes (Schleicher & Schuell, BioScience), proteins were either stained by Ponceau S or analyzed by antibody reaction using the ECL western-blotting detection system (Amersham Biosciences).


Germination Test

Germination assays have been performed using the transparent testa mutant tt2-1 (Debeaujon et al., 2000Go). The analyses of the kinetics of germination were carried out on three independent experiments. Seeds were imbibed in 200 µL of distilled water in presence or absence of 100 µM Tagetin (Epicentre, tebu-bio SA) on three layers of filter paper (Whatman No. 1, Dominique Dutscher) or on one layer of Whatmann No.1 covered by a black membrane filter with a white grid (ME 25/31, Schleicher & Schuell, BioScience) in small petri dishes. After vernalization in darkness at 4°C for 24 h, samples were kept at 23°C under continuous light. Protrusion of the radicle through the seed coat was counted at different intervals over a period of 50 h and values were expressed as percentage of germinated seeds.

Sequence data from this article can be found in the GenBank/EMBL data libraries under accession numbers AJ427912 and AJ427913.


    ACKNOWLEDGMENTS
 
We thank Isabelle Debeaujon for kindly providing tt2-1 seeds and Dominique Job for many stimulating discussions.

Received June 12, 2006; accepted August 30, 2006; published September 8, 2006.


    FOOTNOTES
 
1 This work was supported by the French Ministry of Research (ACI Biologie du Développement et Physiologie Intégrative). Back

2 Present address: The Sainsbury Laboratory, John Innes Centre, Colney Lane, Norwich, Norfolk NR4 7UH, UK. Back

The author responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors (www.plantphysiol.org) is: Silva Lerbs-Mache (silva.lerbs-mache{at}ujf-grenoble.fr).

www.plantphysiol.org/cgi/doi/10.1104/pp.106.085043

* Corresponding author; e-mail silva.lerbs-mache{at}ujf-grenoble.fr; fax 33–04–76–63–55–86.


    LITERATURE CITED
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 CONCLUSION
 MATERIALS AND METHODS
 LITERATURE CITED
 
Allison LA (2000) The role of sigma factors in plastid transcription. Biochimie 82: 537–548[Medline]

Azevedo J, Courtois F, Lerbs-Mache S (2006) Sub-plastidial localization of two different phage-type RNA polymerases in spinach chloroplasts. Nucleic Acids Res 34: 436–444[Abstract/Free Full Text]

Baba K, Nakano T, Yamagishi K, Yoshida S (2001) Involvement of a nuclear-encoded basic helix-loop-helix protein in transcription of the light-responsive promoter of psbD. Plant Physiol 125: 595–603[Abstract/Free Full Text]

Baba K, Schmidt J, Espinosa-Ruiz A, Villarejo A, Shiina T, Gardeström P, Sane AP, Bhalero RP (2004) Organellar gene transcription and early seedling development are affected in the rpoT;2 mutant of Arabidopsis. Plant J 38: 38–48[CrossRef][Web of Science][Medline]

Baumgartner BJ, Rapp JC, Mullet JE (1993) Plastid genes encoding the transcription/translation apparatus are differentially transcribed early in barley (Hordeum vulgare) chloroplast development. Plant Physiol 101: 781–791[Abstract]

Beardslee TA, Roy-Chowdhury S, Jaiswal P, Buhot L, Lerbs-Mache S, Stern DB, Allison L (2002) A nucleus-encoded maize protein with sigma factor activity accumulates in mitochondria and chloroplasts. Plant J 31: 199–209[CrossRef][Web of Science][Medline]

Debeaujon I, Léon-Kloosterziel KM, Koornneef M (2000) Influence of the testa on seed dormancy, germination, and longevity in Arabidopsis. Plant Physiol 122: 403–413[Abstract/Free Full Text]

Emanuel C, von Groll U, Müller M, Börner T, Weihe A (2006) Development- and tissue-specific expression of the RpoT gene family of Arabidopsis encoding mitochondrial and plastid RNA polymerase. Planta 223: 998–1009[CrossRef][Web of Science][Medline]

Harrak H, Lagrange T, Bisanz-Seyer C, Lerbs-Mache S, Mache R (1995) The expression of nuclear genes encoding plastid ribosomal proteins precedes the expression of chloroplast genes during early phases of chloroplast development. Plant Physiol 108: 685–692[Abstract]

Hedtke B, Börner T, Weihe A (2000) One RNA polymerase serving two genomes. EMBO Rep 5: 435–440[CrossRef]

Hibberd JM, Linley PJ, Khan MS, Gray JC (1998) Transient expression of green fluorescent protein in various plastid types following microprojectile bombardment. Plant J 16: 627–632[CrossRef]

Hurkman WJ, Tanaka CK (1986) Solubilization of plant membrane proteins for analysis by two-dimensional gel electrophoresis. Plant Physiol 116: 1209–1218

Igloi GL, Kössel H (1992) The transcriptional apparatus of chloroplasts. CRC Crit Rev Plant Sci 10: 525–558

Inada H, Kusumi K, Nishimura M, Iba K (1996) Specific expression of the chloroplast gene for RNA polymerase (rpoB) at an early stage of leaf development in rice. Plant Cell Physiol 37: 229–232[Abstract/Free Full Text]

Iratni R, Baeza L, Andreeva A, Mache R, Lerbs-Mache S (1994) Regulation of rDNA transcription in chloroplasts: promoter exclusion by constitutive repression. Genes Dev 8: 2928–2938[Abstract/Free Full Text]

Iratni R, Diederich L, Harrak H, Bligny M, Lerbs-Mache S (1997) Organ-specific transcription of the rrn operon in spinach plastids. J Biol Chem 21: 13676–13682

Kabeya Y, Sato N (2005) Unique translation initiation at the second AUG codon determines mitochondrial localization of the phage-type RNA polymerases in the moss Physcomitrella patens. Plant Physiol 138: 369–382[Abstract/Free Full Text]

Kanamaru K, Nagashima A, Fujiwara M, Shimada H, Shirano Y, Nakabayashi K, Shibata D, Tanaka K, Takahashi H (2001) An Arabidopsis sigma factor (SIG2)-dependent expression of plastid-encoded tRNAs in chloroplasts. Plant Cell Physiol 42: 1034–1043[Abstract/Free Full Text]

Kapoor S, Suzuki JY, Sugiura M (1997) Identification and functional significance of a new class of non-consensus-type plastid promoters. Plant J 11: 327–337[CrossRef][Web of Science][Medline]

Kim M, Mullet JE (1995) Identification of a sequence-specific DNA binding factor required for transcription of the barley chloroplast blue light-responsive psbD-psbC promoter. Plant Cell 7: 1445–1457[Abstract]

Kobayashi Y, Dokiya Y, Sugita M (2001) Dual targeting of phage-type RNA polymerase to both mitochondria and plastid is due to alternative translation initiation in single transcripts. Biochem Biophys Res Commun 289: 1106–1113[CrossRef][Web of Science][Medline]

Kunst L (1998) Arabidopsis protocols. In JM Martinez-Zapater, J Salinas, eds, Preparation of Physiologically Active Chloroplasts from Arabidopsis. Humana Press, Totowa, NJ, pp 43–48

Lam E, Hanley-Bowdoin L, Chua NH (1988) Characterization of a chloroplast sequence-specific DNA binding factor. J Biol Chem 263: 8288–8293[Abstract/Free Full Text]

Lerbs S, Bräutigam E, Mache R (1988) DNA-dependent RNA polymerase of spinach chloroplasts: characterization of {alpha}-like and {sigma}-like polypeptides. Mol Gen Genet 211: 459–464[CrossRef]

Lerbs S, Bräutigam E, Partier B (1985) Polypeptides of DNA-dependent RNA polymerase of spinach chloroplasts: characterization by antibody-linked polymerase assay and determination of sites of synthesis. EMBO J 4: 1661–1666[Web of Science][Medline]

Liere K, Maliga P (1999) In vitro characterization of the tobacco rpoB promoter reveals a core sequence motif conserved between phage-type and plant mitochondrial promoters. EMBO J 18: 249–257[CrossRef][Web of Science][Medline]

Liere K, Maliga P (2001) Plastid RNA polymerase in higher plants. In EM Aro, B Andersson, eds, Regulation of Photosynthesis. Kluwer Academic Publishers, Dordrecht, The Netherlands, pp 29–49

Mache R, Cottet A, Imberty A, Hakimi M-A, Lerbs-Mache S (2002) The plant sigma factors: structure and phylogenetic origin. Genome Lett 1: 1–6

Mathews DE, Durbin RD (1990) Tagetitoxin inhibits RNA synthesis directed by RNA polymerases from chloroplasts and Escherichia coli. J Biol Chem 265: 493–498[Abstract/Free Full Text]

Mathews DE, Durbin RD (1994) Mechanistic aspects of Tagetitoxin inhibition of RNA polymerase from Escherichia coli. Biochemistry 33: 11987–11992[CrossRef][Medline]

Mullet JE (1993) Dynamic regulation of chloroplast transcription. Plant Physiol 103: 309–313[CrossRef][Web of Science][Medline]

Perrin R, Meyer EH, Zaepfel M, Kim Y-J, Mache R, Grienenberger J-M, Gualberto JM, Gagliardi D (2004) Two exoribonucleases act sequentially to process mature 3'-ends of atp9 mRNAs in Arabidopsis mitochondria. J Biol Chem 279: 25440–25446[Abstract/Free Full Text]

Privat I, Hakimi M-A, Buhot L, Favory J-J, Lerbs-Mache S (2003) Characterization of Arabidopsis plastid sigma-like transcription factors SIG1, SIG2 and SIG3. Plant Mol Biol 55: 385–399

Rajjou L, Gallardo K, Debeaujon I, Vandekerckhove J, Job C, Job D (2004) The effect of {alpha}-amanitin on the Arabidopsis seed proteome highlights the distinct roles of stored and neosynthesized mRNAs during germination. Plant Physiol 134: 1598–1613[Abstract/Free Full Text]

Richter U, Kiessling J, Hedtke B, Reski R, Börner T, Weihe A (2002) Two RPOT genes of Physcomitrella patens encode phage-type RNA polymerases with dual targeting to mitochondria and plastids. Gene 290: 95–105[CrossRef][Web of Science][Medline]

Schmitz-Linneweber C, Maier RM, Alcaraz J-P, Cottet A, Herrmann RG, Mache R (2001) The plastid chromosome of spinach (Spinacia oleracea): complete nucleotide sequence and gene organization. Plant Mol Biol 45: 307–315[CrossRef][Web of Science][Medline]

Shiina T, Tsunoyama Y, Nakahira Y, Khan MS (2005) Plastid RNA polymerases, promoters, and transcription regulators in higher plants. Int Rev Cytol 244: 1–68[CrossRef][Web of Science][Medline]

Silhavy D, Maliga P (1998) Mapping of promoters for the nucleus-encoded plastid RNA polymerase (NEP) in the iojap maize mutant. Curr Genet 33: 340–344[CrossRef][Web of Science][Medline]

Steinberg TH, Mathews DE, Durbin RD, Burgess RR (1990) Tagetitoxin: a new inhibitor of eukaryotic transcription by RNA polymerase III. J Biol Chem 265: 499–505[Abstract/Free Full Text]

Suzuki Y, Kawazu T, Koyama H (2004) RNA isolation from siliques, dry seeds, and other tissues of Arabidopsis thaliana. Biotechniques 37: 542–544[Web of Science][Medline]

Toyoshima Y, Onda Y, Shiina T, Nakahira Y (2005) Plastid transcription in higher plants. CRC Crit Rev Plant Sci 24: 59–81

Weihe A, Börner T (1999) Transcription and the architecture of promoters in chloroplasts. Trends Plant Sci 4: 169–170[CrossRef][Web of Science][Medline]

Yao J, Roy-Chowdhury S, Allison LA (2003) AtSig5 is an essential nucleus-encoded Arabidopsis {sigma}-like factor. Plant Physiol 132: 739–747[Abstract/Free Full Text]

Young DA, Allen RL, Harvey AJ, Lonsdale DM (1998) Characterization of a gene encoding a single-subunit bacteriophage-type RNA polymerase from maize which is alternatively spliced. Mol Gen Genet 260: 30–37[CrossRef][Web of Science][Medline]




This article has been cited by other articles:


Home page
DNA ResHome page
W. K. Cho, S. Geimer, and J. Meurer
Cluster Analysis and Comparison of Various Chloroplast Transcriptomes and Genes in Arabidopsis thaliana
DNA Res, February 1, 2009; 16(1): 31 - 44.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
J. Azevedo, F. Courtois, M.-A. Hakimi, E. Demarsy, T. Lagrange, J.-P. Alcaraz, P. Jaiswal, L. Marechal-Drouard, and S. Lerbs-Mache
Intraplastidial trafficking of a phage-type RNA polymerase is mediated by a thylakoid RING-H2 protein
PNAS, July 1, 2008; 105(26): 9123 - 9128.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
W. Chi, J. Ma, D. Zhang, J. Guo, F. Chen, C. Lu, and L. Zhang
The Pentratricopeptide Repeat Protein DELAYED GREENING1 Is Involved in the Regulation of Early Chloroplast Development and Chloroplast Gene Expression in Arabidopsis
Plant Physiology, June 1, 2008; 147(2): 573 - 584.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
G. W. Bassel, P. Fung, T.-f. F. Chow, J. A. Foong, N. J. Provart, and S. R. Cutler
Elucidating the Germination Transcriptional Program Using Small Molecules
Plant Physiology, May 1, 2008; 147(1): 143 - 155.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
F. Courtois, L. Merendino, E. Demarsy, R. Mache, and S. Lerbs-Mache
Phage-Type RNA Polymerase RPOTmp Transcribes the rrn Operon from the PC Promoter at Early Developmental Stages in Arabidopsis
Plant Physiology, November 1, 2007; 145(3): 712 - 721.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
142/3/993    most recent
pp.106.085043v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Web of Science (12)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Demarsy, E.
Right arrow Articles by Lerbs-Mache, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Demarsy, E.
Right arrow Articles by Lerbs-Mache, S.
Agricola
Right arrow Articles by Demarsy, E.
Right arrow Articles by Lerbs-Mache, S.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
ASPB Publications PLANT PHYSIOLOGY® THE PLANT CELL
Copyright © 2006 by the American Society of Plant Biologists